Supporting Methods
Superdex 200 gel filtration chromatography
HDA14 was expressed and purified on Ni-NTA agarose as described in Experimental Procedures.
The pure enzyme was dialyzed into PBS plus 0.1 M KCl, concentrated to 50 µL and
chromatographed at 0.5 mL/min on a Superdex 200 gel filtration column and 0.5 mL fractions
collected. Column fractions were blotted for HDA14 using the affinity-purified antibodies as
described in Experimental Procedures. The column was calibrated with the following standards:
Ferritin (440 kDa), catalase (232 kDa), aldolase (158 kDa), BSA (66 kDa), ovalbumin (43 kDa) and
ribonuclease (13.7 kDa).
Cloning and expression of proteins
HDA14. The Arabidopsis thaliana HDA14 clone (NCBI accession number: NP_567921,
GI: 332660831) was obtained from the RIKEN Bioresources Center and used for PCR
using
the
following
primers:
TATAAGATCTCAATGTCCATGGCGCTAATTGTC-
forward
3’;
reverse
primer:
primer:
5’5’
-
TATAAAGCTTTTATAAGCAATGAATGCTTTTGG- 3’ and PCR conditions: 1 cycle
of 3 min 94◦C, 35 cycles of 1 min 94◦C, 1 min 65◦C, 2 min 72◦C, followed by 1 cycle of
10 min 72◦C. The HDA14 PCR product was digested and ligated into a pRSET A
expression vector (Invitrogen), amplified, then sequenced at the University of Calgary
DNA Sequencing Laboratory. The 6His-HDA14, with a predicted mass of 50 kDa, was
expressed in BL21 (DE3) E. coli cells. Typically 1L of cells were grown at 30°C,
induced with 0.5 mM IPTG for 24 hr. The soluble protein was purified on Ni-NTA
(Qiagen) and confirmed to be HDA14 by mass spectrometry. One liter of cells produced
0.1 mg pure soluble protein. Since much of the recombinant protein was in the insoluble
fraction, HDA14 was purified from this fraction after solubilization with guanidine-HCl
using the manufacturer instructions (Qiagen) and this was used for antibody production.
ELP3. The Arabidopsis thaliana ELP3 clone (AGI number: At5g50320, GI: 332008542) was
obtained from the RIKEN Bioresources Center and used for PCR using the following primers:
forward primer: 5’GGGAAGATCTCAATGGCGACGGCGGTAGTG 3’; reverse primer:
5’CCCCAAGCTTTCAAAGAAGATGCTTCACCATG 3’ and PCR conditions: 1 cycle of 2 min
95◦C, 2 cycles of 30 seconds 95◦C, 1 min 55◦C, 2.5 min 75◦C, 18 cycle of 30 seconds 95◦C, 1 min
60◦C, 2.5 min 75◦C followed by 10 min 75◦C. The ELP3 PCR product was digested and ligated
into a pRSET A expression vector (Invitrogen), amplified then sequenced at the University of
Calgary DNA Sequencing Laboratory. The 6His-ELP3, with a predicted mass of 67.8 kDa, was
expressed in BL21 (DE3) E. coli cells. The recombinant protein was in the insoluble fraction;
therefore ELP3 was purified from this fraction after solubilization with guanidine-HCl using the
manufacturer instructions (Qiagen) and thus was used for antibody production. Typically 1 L of
cells was grown at 37◦C, induced with 0.5 mM IPTG for 18 hr. The solubolized protein was
purified on Ni-NTA and confirmed to be ELP3 by mass spectrometry. One liter of cells produced
4 mg pure protein.
Purification of recombinant human 6His-PR65 protein from Escherichia coli
BL21 (DE3) cells expressing the PR65 clone (pET28-PR65His; GI: 4558258) were
grown in 4 L of LB media at 37◦C until the OD600 reached 0.2-0.3 before being induced with 0.3
mM IPTG. Cells were grown for an additional 5 hr before being harvested and lysed in 20 mM
Tris-HCl pH 7.5, 30 mM imidazole pH 7.5, 150 mM NaCl, 0.1 mM PMSF, 1 mM benzamidine by
two passes through the French Press and then clarified by centrifugation at 35000 rpm for 45
min at 4◦C. The soluble protein was purified on Ni-NTA. To further purify the 6His-PR65
protein, it was dialyzed into Mono-Q buffer A (20 mM Tris-HCl pH 7.5, 2 mM EDTA, 0.2 mM
EGTA, 0.1% (v/v) -ME) and chromatographed on a 1 mL Mono-Q column. The column was run
at 0.8 mL/min and a gradient of 0-40% Mono-Q buffer B (20 mM Tris-HCl pH 7.5, 2 mM EDTA,
0.2 mM EGTA, 1 M NaCl, 0.1% (v/v) -ME) was applied over 20 column volumes and 0.5 mL
fractions were collected.
Pure fractions were pooled and dialyzed against 2 L of PBS,
concentrated and stored at -80◦C until use. A yield of approximately 1 mg of purified PR65
protein was obtained from 1 L of culture.
Purification of recombinant GST-PR65 protein from Escherichia coli
PR65 was sub-cloned into pGEX-6p for expression as an N-terminal Glutathione S-transferase
(GST)-tagged fusion protein and transformed into BL21 (DE3) bacterial cells for heterologous
protein expression. GST-PR65 expressing BL21 (DE3) bacterial cells were grown in 1L LB at
37◦C to an OD600 of 0.5 followed by induction with 0.1 mM IPTG. Bacterial cells were grown at
23◦C for 4 hr and subsequently pelleted by centrifugation at 4000 rpm for 15 min. Cell
resuspension was performed using 40 mL PBS containing 1 mM PMSF, 1 mM benzamidine and
stored at -80◦C until use. GST-PR65 expressing bacterial cells were lysed and supernatant
clarified as above. Clarified GST-PR65 supernatant was incubated with glutathione coupled
Sepharose (Sigma) for 1 hr at 4◦C, then washed sequentially by gravity with 5 column volumes
PBS, 50 column volumes PBS containing 0.75M NaCl and 5 column volumes PBS. GST-PR65
was eluted by gravity using 10 mM reduced glutathione buffered by 50 mM Tris-HCl pH 8.0.
Purified GST-PR65 was dialyzed sequentially against PBS and 50% PBS/glycerol for storage until
use.