Supplementary Materials and Methods
Reagents and cell culture
All chemicals and reagents unless otherwise stated, were purchased from Sigma
(St.Louis, MO). Media were purchase from Invitrogen (Carlsbad, CA) unless
otherwise stated. Recombinant TRAIL (rTRAIL) was from R&D Systems
(Minneapolis, MN) and zVAD from Santa Cruz (Santa Cruz, CA). The following
Western blot antibodies were used in this study: rabbit anti-TRAIL (Peprotech, Rocky
Hill, NJ), rabbit-anti-TRAIL-R1 (Santa Cruz), rabbit-anti-TRAIL-R2 (Cell Signaling
Technology, Beverly, MA), mouse anti-caspase-3 (Imgenex, San Diego, CA), mouse
anti-caspase-8 (Cell Signaling Technology), mouse anti-XIAP (BD Pharmingen, San
Jose, CA), mouse-anti-cFlip (Enzo Life Sciences, Farmingdale, NY), sheep antiCuZnSOD (The Binding Site, Birmingham, UK) and mouse-anti--tubulin (D10)
(Santa Cruz). Peroxidase-conjugated secondary antibodies were anti-mouse, antirabbit and anti-sheep (Santa Cruz). For the TRAIL receptor stain we used monoclonal
anti-TRAIL-R1 (DJR1) and anti-TRAIL-R2 (DJR2-4) antibodies (1 µg/106 cells;
BioLegend, San Diego, CA) that were conjugated to Phycoerythrin (PE). The isotype
control antibody (MOPC-21) (1 µg/106 cells) was also purchased from BioLegend.
The PE-conjugated antibodies against CD11b (M1/70), CD19 (6D5), CD117 (2B8),
CD45 (30-F11), TER-119 (TER-119), CD29 (HMß1-1), Sca-1 (E13-161.7), and
CD44 (IM7) were purchased from BioLegend and were used at a concentration of 0.2
µg/106 cells. The following isotype controls (BioLegend) were used: PE-conjugated
Rat IgG2aκ (RTK2758), PE-conjugated Rat IgG2bκ (RTK4530) and PE-conjugated
Armenian Hamster IgG (HTK888).
Human colon adenocarcinoma Colo205 cells (gift from Eva Szegezdi), human cervix
carcinoma Hela cells (ATCC), human pancreatic cancer PancTu1 cells (gift from
1
Simone Fulda) as well as human embryonic kidney 293 cells (Invitrogen) were grown
in Dulbecco’s modified eagle medium (DMEM) supplemented with 10% FBS, 100
U/ml penicillin and 100 g/ml streptomycin. Human colorectal tumor HCT116 cells
(ATCC), their isogenic daughter cell line HCTp53-/- (gift from Bert Vogelstein) and
HT-29 (ATCC) cells were grown in McCoy’s (Lonza, Basel, Switzerland)
supplemented with 10% FBS, 100 U/ml penicillin and 100 g/ml streptomycin.
Human ovarian cancer cell line A2780 (gift from Eva Szegezdi) and human
pancreatic cancer cell lines BxPc-3 (ATCC) and Colo357 (gift from Eva Szegezdi)
were grown in RPMI-1640 medium supplemented with 10% FBS, 100 U/ml
penicillin and 100 g/ml streptomycin. MSCs (murine) were grown in low-glucose
DMEM supplemented with 15% FBS, 100 U/ml penicillin and 100 g/ml
streptomycin. Human MSCs were from Lonza and cultured in NH Expansion Medium
(Miltenyi, Bergisch Gladbach, Germany) and 100 U/ml penicillin and 100 µg/ml
streptomycin.
Transfection of 293 cells
For the transfection of 293 cells (5x105 cells/well) we used the calcium phosphate
transfection method. Before the transfection, fresh 2% FBS containing medium was
added. For each well of a 6-well plate, 0.5 ml HBS were aliquoted into a sterile 1.5 ml
Eppendorf tube. In a separate tube 5 μg of plasmid DNA were mixed with 250 μl
CaCl2 (2.5 mM) and enough distilled water to bring the total volume to 0.5 ml. The
CaCl2/DNA mix was then added to the HBS drop-wise under vortexing. After 25 min
of incubation at room temperature, the mixture was slowly added to the media. 4 h
later, the medium was removed and the cells were washed with PBS and fresh
medium (1 ml) added. Another 48 h later the medium was collected and centrifuged
2
before the TRAIL concentration was measured by TRAIL ELISA. Subsequently the
supernatants were diluted to a TRAIL concentration of 2 ng/ml using normal growth
medium and then applied to the respective cancer cells.
Apoptosis assay
Apoptosis was measured according to Nicoletti et al.1 and has been described
previously.2 Briefly, the trypsinized cells including the medium were directly
transferred into FACS tubes and centrifuged at 1,300 rpm for 7 min at 4o C. After
washing with PBS, Nicoletti buffer (Sodium citrate 0.1 % (w/v) containing 0.1 %
Triton X-100 (w/v) and propidium iodide 50 g/ml) was added to the cell pellets,
tubes were vortexed for 10 s at medium speed and left for 5 h in the dark (4o C). The
fluorescence intensity was then measured in a flow cytometer and analyzed with the
Venturi One software package (Applied Cytometry, Sheffield, UK). Untreated cells
were taken as reference to calculate specific apoptosis by subtraction of the basal
apoptosis values from the cell death levels of treated cells.
Generation of adenoviral vectors and transduction of MSCs
The sTRAIL segment (aa114-aa281) was amplified by PCR from a pcDNA3.TRAIL
(full-length) that we have described earlier3 and subcloned into the Xba1 and Not1
sites of pcDNA3. Then the signal peptide sequence stretch of the human fibrillin-1
was ligated into the remaining multi-cloning site using BamH1 and EcoR1. This DNA
fragment was generated by hybridization of sense and antisense oligonucleotides
encoding the hFib signal peptide. The oligonucleotides were designed to generate the
respective restriction enzyme overhangs after hybridization. Subsequently, the
cassettes for the Furin cleavage site (Furin CS) and the Isoleucine-zipper (ILZ), which
3
were also generated by oligonucleotide-hybridization, were ligated into the plasmid
using EcoR1/Sal1 and Sal1/Xba1, respectively. The constructs were validated by
sequencing. The resulting vector was termed pcDNA3.sTRAIL closely resembling a
sTRAIL construct first described by Kim et al.4
TRAIL variants, sTRAILDR5 (D269H) and sTRAILDR4 (S159R) were generated using
the Quick-Change site-directed mutagenesis kit (Stratagene, La Jolla, CA) and
confirmed by DNA sequencing.
Recombinant E1/E3-deleted adenoviral vectors expressing sTRAIL and variants
(Ad.sTRAIL, Ad.sTRAILDR4 and Ad.sTRAILDR5), DsRed (Ad.DsRed) and EGFP
(Ad.EGFP) from the cytomegalie virus (CMV) promoter/enhancer elements were
generated using the ViraPower adenoviral expression system (Invitrogen) as
described earlier.5 Transduction of MSCs was carried out as described earlier.5
Histological analyses
Tumor and liver samples taken during necropsy were fixed in 10% neutral-buffered
formalin, paraffin embedded and 4-μm sections were stained with hematoxylin and
eosin (H&E). Additionally Masson’s Trichrome staining was carried out on tumor
sections as follows. Slides were rinsed and placed in Bouin’s solution overnight at
room temperature. The next day slides were washed, stained with Weigert
Hematoxylin for 10 min, rinsed in distilled water and stained with Biebrich scarletacid fuchsin for 5 min followed with immersion in phosphomolybdic/phosphotungstic
acid solution for 15 min and stained with aniline blue for 5 min. Slides were then
rinsed, dehydrated with 95% and absolute alcohol and mounted. Immuno-staining for
proliferating cell nuclear antigen (PCNA) was performed on 4-μm paraffin sections
by the avidin-biotin-peroxidase complex (ABC) method using the ABC reagent
4
(Vector Laboratories, Burlingame, CA). Mouse anti-PCNA monoclonal antibody
(clone PC 10; 1:100; Leica Biosystems, Newcastle, UK) was used as the primary
antibody. Briefly, paraffin sections were deparaffinized, immersed in 10 mM citrate
buffer (pH 6.0) and heated for 10 min in a microwave, and thereafter placed in
methanol containing 0.3% H2O2 for 30 min at room temperature to inactivate
endogenous peroxidase. Then the sections were incubated in 4% BSA for 1 h at room
temperature to reduce non-specific binding and successively incubated in the primary
antibody overnight at 4° C. The sections were then incubated in goat anti-mouse
biotin-conjugated secondary antibody for 1 h followed by incubation in ABC reagent
for 30 min at room temperature. The slides were then washed and the signals were
visualized with peroxidase-diamino-benzidine. Sections were counterstained with
Methyl Green.
Western Blot
Western blots were principally carried out as described previously.6 Briefly, cells
were harvested by trypsinization and lyzed in cell lysis buffer containing 50 mM Tris
pH 7.4, 10% glycerol, 0.5% NP40, 150 mM NaCl, 1 mM MgCl2, 1 mM CaCl2, 1
mM KCl and Complete Mini Protease Inhibitors (Roche). Cell lysates were subjected
to 12% SDS-PAGE and 50 μg protein was loaded per track. The gels were transferred
for 1 h onto PVDF membranes (GE Healthcare Biosciences, Pittsburgh, PA) using a
semi-dry blotter (BioRad, Hercules, CA). Detection was performed by diluting
primary antibodies in TBS, 0.1% Tween and 3% BSA. After incubation and washing
the secondary anti-mouse IgG, anti-rabbit IgG or anti-sheep IgG antibodies
conjugated to horse-radish-peroxidase (Santa Cruz) were added at a dilution of
1:2,000 in TBS, 0.1% Tween, 3% BSA. Detection was performed using ECL Western
5
Blotting Substrate (Pierce, Rockford, IL) and a Fluorochem Imaging System (Alpha
Innotech, Santa Clara, CA).
TRAIL Enzyme-linked Immunosorbent Assay (ELISA)
293 cells were transfected with the calcium phosphate transfection method. The
medium was changed after 4 h and the supernatants then harvested 48 h later for the
TRAIL ELISA. Adenovirally transduced MSCs were either left untreated or treated
with 5-FU (10 M). After 24 h exposure to 5-FU the medium was changed again and
sTRAIL could then accumulate for another 48 h before the medium was harvested,
centrifuged and measured.
RNAi knock-down constructs and stable cell line generation
The following small hairpin (sh) RNA motif was used to target: caspase-8 (c8) (5´GGGTCATGCTCTATCAGAT-3’),
GCTAGAAGGTAATGCAGACTCTGCCATGTC
DR5
-3’),
(5´DR4
(5´-
GCTGTTCTTTGACAAGTTGC-3’), XIAP (5´-GTGGTAGTCCTGTTTCAGC-3’).
Sense and antisense oligos containing the sh-sequence and 5’ overhang representing a
restricted BbsI site and EcoRI site on the 3’ side were hybridized to generate doublestranded DNA fragments. These fragments were then cloned into a modified
pU6.ENTR plasmid (Invitrogen). The resulting pU6.ENTR plasmid was used to
generate the pBlockIt.shc8 pBlockIt.shDR5, pBlockIt.shDR4 and pBlockIt.XIAP
plasmid using the pBlockIt vector (Invitrogen) and LR Clonase II. This was used to
generate stable caspase-8, DR4 and DR5 knockdown clones of HCT116 cells and
stable XIAP knockdown clones of PancTu1 cells. For this, the pBlockIt.shc8,
pBlockIt.shDR4, pBlockIt.shDR5 and pBlockit.shXIAP plasmids were FuGene-
6
transfected (Roche, Basle, Switzerland) into HCT116 and PancTu1 cells, respectively.
Three days later, the transfected cells were split into Blasticidin containing selection
medium. Arising clones were picked, transferred to 24 well-plates and tested for
caspase-8, DR4, DR5 and XIAP silencing, respectively. Clones that did not show a
knock-down were used as controls labeled HCT.shctrl and PancTu1.shctrl. These
control clones were tested and shown to behave like parental HCT116 and PancTu1
cells, respectively.
References
1. Nicoletti I, Migliorati G, Pagliacci MC, Grignani F, Riccardi C. A rapid and
simple method for measuring thymocyte apoptosis by propidium iodide
staining and flow cytometry. J Immunol Methods 1991; 139: 271-279.
2. Mohr A, Buneker C, Gough RP, Zwacka RM. MnSOD protects colorectal
cancer cells from TRAIL-induced apoptosis by inhibition of Smac/DIABLO
release. Oncogene 2008; 27: 763-774.
3. Mohr A, Henderson G, Dudus L, Herr I, Kuerschner T, Debatin KM et al.
AAV-encoded expression of TRAIL in experimental human colorectal cancer
leads to tumor regression. Gene Ther 2004; 11: 534-543.
4. Kim MH, Billiar TR, Seol DW. The secretable form of trimeric TRAIL, a
potent inducer of apoptosis. Biochem Biophys Res Commun 2004; 321: 930935.
5. Mohr A, Lyons M, Deedigan L, Harte T, Shaw G, Howard L et al.
Mesenchymal stem cells expressing TRAIL lead to tumour growth inhibition
in an experimental lung cancer model. J Cell Mol Med 2008; 12: 2628-2643.
6. Zwacka RM, Stark L, Dunlop MG. NF-kappaB kinetics predetermine TNFalpha sensitivity of colorectal cancer cells. J Gene Med 2000; 2: 334-343.
7