Supplementary Figures
Supplementary Figure 1. Generation of ERM deficient mice. a, ERM genomic locus and
targeting vector. BamHI (B), XhoI (X) sites and recombined XhoI/SalI (X/S) sequence are
indicated in the region surrounding ERM exons 2 to 5. The translation initiation site (ATG)
is indicated within exon 2. The locations of probes used in Southern analysis (5’ probe, and
3’ Probe) and the locations of the PCR primers (5’ Primer, 3’ Primer) used for PCR-based
analysis of the targeted allele (see (c) below) are indicated. b, Southern analysis of ERM
allele in mice. The 5’ probe in (a) was used to hybridize with BamHI digested genomic
DNA. The wild-type ERM allele generates a 3.2 Kb hybridizing fragment, and the ERMallele
generates a 2.2 Kb hybridizing fragment. Data shown are from three mice of strain
E7, identifying wild type ERM+/+ (+/+), heterozygous ERM-(+/-) and homozygous ERM-mice
(-/-). c, Genomic PCR analysis of mutant ERM allele. The 5’ and 3’ Primers
indicated in (a), were used to amplify DNA templates from mice in b. The wild type ERM
allele generates a PCR fragment of 1 Kb, and the ERM-allele generates a 300 bp fragment as
expected from the deletion of exons 2 through 5. d, Northern analysis of ERM mRNA.
Total brain RNA (10 g) from wild-type ERM (+/+), heterozygous ERM- (+/-) and ERMhomozygous
(-/-) mice was analyzed by Northern blot using a full-length ERM cDNA probe,
a specific cDNA probe containing ERM exons 2 through 5, and a GAPDH probe as a control.
e, Sequencing of the mutant ERM transcript from germline targeted mice. RNA from testes
of wild type (+/+) and homozygous ERM--(-/-) mice was used as template for amplification
by RT-PCR, cloned and sequenced. Shown is the sequence trace of the cloned mutant ERM
transcript. The boxes around the sequence trace correspond to the expected sequences of
exon 1 and exon 6 of wild type ERM, indicating a perfect splice junction. At the right is a
schematic representation of the wild type and the mutant ERM transcripts, identifying the
expected loss of exons 2 through 5 in the latter. Methods: For Southern analysis, BamHIdigested DNA from ES clones or from tail biopsies was hybridized with the 250bp DNA
fragment located immediately upstream left arm described above. For PCR-based
1
genotyping, we used the following oligonucleotides: 5’GACAGGCAGGCAATACTAAAGTG, and 5’-CTGGCTATCGCTGTAGAATGAAC.
Total tissue RNA was isolated using RNeasy kit (Qiagen). An ERM cDNA probe spanning
exons 2 through 5 was generated using primers: 5’- TTTTATGGTCCCAGGGAAATC, and
5’- CTGGGACAAACTGCTCATCA. Wild-type and mutant ERM transcripts characterized
in Supplemental Figure 1 were amplified by RT-PCR from testis total RNA using the
following primers: 5’-GCCCAGCCCGCCACGGAG, and 5’ACTGGCTTTCAGGCATCATC, cloned into pGEM-Teasy vector (Promega) and
sequenced.
Supplementary Figure 2. Normal histology of brain and lung from wild-type and ERM-mice. Tissues were fixed in 10% formalin, embedded in paraffin, and stain with hematoxylin
and eosin.
Supplementary Figure 3. a, ERM mRNA is expressed in Sertoli-cell-only W/Wv (ckitW/W-v) testis. Total RNA from 10-week-old wild-type or c-kitW/Wv (W/Wv) testis was
analyzed by RT-PCR for ERM, GATA-1, Stra8 and HPRT. b, ERM mRNA expression in
isolated cell types from the testes. RNA from isolated Sertoli cells1, spermatogonia2, and
pachytene spermatocytes and round spermatids3 was analyzed for ERM, Stra8 and HPRT
expression.
Supplementary Figure 4. ERM expression remains restricted to Sertoli cells in the testis
throughout adulthood. LacZ staining was performed on frozen sections from 2, 3, 4, 5, 6
week and 12 month old ERM+/IRES-LacZ testes.
Supplementary Figure 5. Immunohistochemical staining of ERM protein in wild-type and
ERM-/- testis using 3H7 monoclonal ERM antibody. a, ERM protein is expressed in the
nucleus of Sertoli cells in the wild-type testis. b, ERM protein is undetectable in ERM-/testis. c, Negative control for immunohistochemistry. d, ERM antibody is specific for ERM.
Immunoreactivity of ERM antibody to Sertoli cells is neutralized by pre-incubating ERM
antibody with purified ERM protein.
2
Supplementary Figure 6. Potential ERM regulated genes in Sertoli cells. RT-PCR analysis
of primary Sertoli cells of 4-week-old wild-type or 4-week-old and 10-week old ERM-/- male
mice was carried out for SDF-1, CCL7, CXCL5, GATA-1, GDNF and HPRT
(Supplementary Table 4). Sertoli cell markers GATA-1 and GDNF levels were unchanged
(shown in lower panel). (Methods) Primary Sertoli cells were isolated from WT and ERM-/mice as described1 and maintained in serum free media prior to RNA isolation. Biotinylated
cRNA target was hybridized to Affymetrix 430 2.0 Murine Genome Arrays and fluorescence
intensity normalized to wild-type 4 week Sertoli cell as baseline. Genes with reduction
greater than 3 fold in both pair wise comparisons between 4 week wild-type and 4 week
ERM-/- and between 4 week wild-type and 10 week ERM-/- chip are listed in Supplementary
Table 4.
Reference List
1. Karl,A.F. & Griswold,M.D. Sertoli cells of the testis: preparation of cell cultures and
effects of retinoids. Methods Enzymol. 190, 71-75 (1990).
2. Hofmann,M.C., Braydich-Stolle,L. & Dym,M. Isolation of male germ-line stem cells;
influence of GDNF. Dev. Biol. 279, 114-124 (2005).
3. Mays-Hoopes,L.L., Bolen,J., Riggs,A.D. & Singer-Sam,J. Preparation of
spermatogonia, spermatocytes, and round spermatids for analysis of gene expression
using fluorescence-activated cell sorting. Biol. Reprod. 53, 1003-1011 (1995).
3