Materials and Methods
Plasmid construction
Wild-type SIM-GFP was cloned into pCDNA3.1. The VI double mutant of SIMGFP was obtained by quick-change mutagenesis. The primers used were: SIMV/A-F (5’-GAGAAAGGGATC
CAAGGCCGACGTAATCGATCTCAC-3’), SIM-V/A-R (5’-GTGAGATCGATTACG
TCGGCCTTGGATCCCTTTCTC-3’), SIM-I/A-F (5’-GTTGACGTAATCGATCTCG
CCATAGAGTCTTCATCGGAC-3’) and SIM-I/A-R (5’-GTCCGATGAAGACTCTA
TGGCGAGATCGATTACGTCAAC-3’). The deletion mutation was obtained from
PCR and ligation. The primers were SIM-Del-F (5’-TAGGCGGCCGCTCGAGGA
TCTTTTTCCCTC-3’) and SIM-Del-R (5’-CTTTCTCTTCTTTTTTGGTGATCCAG
ATCCCTTGTCGTC-3’). For the two-repeat SIM peptide, WT-SIM-2r and SCSIM-2r cDNA, were amplified by the following primers: syn-SIM-M-F (5’CATGGATC CATGGATTATAAAGATGATGATGATAAACCTAAAAAAAA ACG
TAAAGTTGGTGTTTCTGATATTAAAGATA-3’), syn-SIM-M-R1 (5’-GAAGTTTCA
ACAGGAGGAGAAGGAGAACGAGTAACAGATTCATCAACATCAGAAATATC
TTTAATATCAGAAACACC-3’), syn-SIM-W-F (5’-CATGGATCCATGGATTATA
AAGATGATGATGATAAACCTAAAAAAAAACGTAAAGTTGGTAAAGTTGATG
TTATTGATCT-3’), syn-SIM-W-R1 (5’-GAAGTTTCAACAGGGGAG AAGGAGA
ACGTTCAGAAGAAGATTCAATAGTAAGATCAATAACATCAACTTTACCAAC3’), syn-SIM-M-R2 (5’-GATTCAACATCAGAAATATCTTTAATATCAGAAACA
TTAGTAGAAGA AATAGAAGTTTCAACAGGAGGAG-3’), syn-SIM-W-R2 (5’CAGAAGAAGATTC AATAGTAAGATCAATAACATCAACTTTATTAGTAGA
AGAAATAGAAGTTTCAA CAGGAGGAG-3’), syn-SIM-M-R3 (5’-TGAGAAT
TCTCATTTATCATCATCATC TTTATA-3’), syn-SIM-W-R3 (5’-TGAGAATTCTC
ATTTATCATCATCATCTTTA TAATCTTCAGAAGAAGATTCAATAG-3’); and the
cDNA products were cloned into either pcDNA-3.1, pDS-Red-C1 or
pJS74(Bennardo et al., 2008).
Cell culture, transient transfection and stable expression cell lines
MCF-7 cells were maintained in DMEM (GIBCO) supplemented with 10% (v/v)
fetal bovine serum (Irvine Scientific), 1 mM sodium pyruvate, nonessential amino
acids and 100 g/ml penicillin and streptomycin (Irvine Scientific). MCF-10A
cells were maintained in the DMEM/F12 with 10% (v/v) fetal bovine serum,
penicillin/ streptomycin (100 g/ml), nonessential amino acids, EGF (20 ng/ml),
Hydrocrotisone (0.5 g/ml), Insulin (10 g/ml) and Cholera toxin (100 ng/ml).
PC3 cells were maintained in PRMI 1640 (GIBCO) with 10% FBS, nonessential
amino acids and 100 g/ml penicillin and streptomycin. For mouse ES cell lines
(strain 129/Sv), DMEM medium was supplemented with 10% FBS (Embryonic
Stem Cell Tested & Qualified, Gemini), nonessential amino acids and 100
g/ml penicillin and streptomycin (Irvine Scientific). Cells were grown to 70% to
80% confluence and transfected with plasmids and lipofectamine (Invitrogen)
according to the manufacturer’s protocol.
Stable expression cell lines were generated by DNA transfection and
selected using selective media (DMEM, 10% FBS, 800 µg/ml G418, 100 g/ml
penicillin and streptomycin, 1 mM sodium pyruvate, nonessential amino acids).
The individual cell lines were checked for protein expression by Western blot.
Normocin (InvivoGen) was added to the entire cell medium at 100 g/ml to
prevent mycoplasma contamination.
Immunoprecipitation and Western Blot
Nuclear lysates from MCF-7 cells at various time points after radiation were
prepared in the presence of protease inhibitor cocktail mix (Roche), 40 mM Nmethylmaleimide (NEM) and benzonase (Sigma-Aldrich). Protein concentrations
in the lysate were determined by Bradford assays and confirmed by applying
10% of the lysate to SDS-PAGE stained with Coomassie blue. IP was carried
out by incubating with anti-FLAG M2 (1:1000, Stratagene) antibody overnight and
protein G beads for further 4 hours. After extensive washing (5 times with co-IP
buffer <20 mM Tris-HCl, pH 8.0, 150mM NaCl, 0.01% Tween20> ), pull-down
proteins was separated by SDS –PAGE, and Western blotted using various
antibodies against proteins that are known to be involved in DSB repair.
Immunocytochemistry and antibodies
For immunocytochemistry, cells were plated in 8-well chamber slides (Lab Tek)
and treated as indicated. Cells were washed in PBS and fixed in 4% (v/v)
paraformaldehyde for 20 min at room temperature. The fixed cells were washed
in PBS and permeabilized for 30 min at room temperature in PBS with 0.2% (v/v)
Triton X-100. After permeabilization, the cells were blocked for 60 min at room
temperature in blocking buffer (PBS containing 5% BSA). After blocking, cells
were incubated with mouse monoclonal antibody against PML (1:1000, Abcam)
for 1 h at room temperature in incubation buffer (PBS containing 1% BSA). Cells
were then washed 3 times with incubation buffer and incubated with fluorescent
secondary antibody (goat anti-mouse, Texas Red, Jackson Immunoresearch) for
1 h at room temperature. After incubation, cells were washed and the nuclei
were stained with 4’,6-diamidino-2-phenylindole (DAPI; 1g/ml). Slides were
mounted and viewed with a 40x objective on a Zeiss LSM510 fluorescence
microscope.
Comet assay
5105 WT-SIM and Del-SIM stably expressing cells were plated on petri dishes
one day before the irradiation. The cells were irradiated at either 4 Gy or 10 Gy
(Cs137 irradiator) and incubated at 37oC for 30 min or 2 h. Cells were harvested
from petri dishes by enzyme disaggregation and resuspended in ice-cold PBS.
Cells were analyzed for DNA damage by the CometAssay Kit (Trevigen),
according to the manufacturer’s instructions. Thirty comet images from each
slide were visualized by microscopy and the tail moment (%DNA in tail  tail
length) was quantified by Cometscore (TriTek corp.).
Clonogenic assay
5105 WT-SIM-GFP and VI-SIM-GFP stably expressing cells were plated on petri
dishes one day before irradiation. Before (without irradiation) or after irradiation,
cells are seeded out in appropriate dilutions to form colonies in 2 weeks.
Colonies were fixed with glutaraldehyde (6.0% v/v), and stained and visualized
with crystal violet (0.5% w/v).
Cell viability assay
1x103 MCF-7, MCF-10A, PC3 or stable expressing cells were plated in a 96-well
plate one day before transfection or drug treatment to reach 50% confluence.
Transfection was performed using lipofectamine 2000, according to the
manufacturer’s protocol. Twenty-four hours after transfection, the cells were
either treated with Dox, CTP or radiation. Cells were incubated for an additional
48 to 72 h before the cell viability assay was performed. The CellTiter 96 AQueous
One Solution Cell Viability Assay kit (Promega) was used to analyze cell viability,
according to the manufacturer’s instructions.
Repair Assay
Mouse ES cell lines (WT and Ku70-/-) expressing the DR-GFP and EJ5-GFP
reporters were previously described (Bennardo et al., 2008). For transient
transfection to measure DSB repair, 2.5×104 DR-GFP or EJ5-GFP mouse ES
cells were plated in a 60 mm plate and transfected the next day with 0.8 µg/ml
pCBASceI mixed with 3.6 µl/ml Lipofectamine 2000 (Invitrogen) along with 0.8
µg/ml WT-SIM-2r or SC-SIM-2r expression plasmids. Three days after
transfection, GFP-positive cells were quantified by flow cytometry on a Cyan
ADP (Dako).
Poly-SUMO chain formation
Poly-SUMO chains were obtained from the modified in vitro SUMOylation
reaction which contains 4.375 M of GST-SUMO3 and His-SUMO-2, 40 M of
Ubc9 and E1, and 5 mM ATP in a total 100 l reaction. Purification of these
proteins was described in our pervious study (Song et, al., 2004). The reaction
was carried out at 37°C for 4 h and then diluted to 1 ml with 1X PBS. The polySUMO chains were first separated from His-SUMO-3 monomer by glutathione
beads and then eluted by 10 mM glutathione. The eluted poly-SUMO chains
were subsequently separated from GST-SUMO-3 monomer by Ni-NTA
chromatography. The eluted poly-SUMO chains were dialyzed and
concentrated.
Purification of GST-WT-SIM and GST-SC-SIM
Wild type (GST-WT-SIM) or scrambled SIM protein (GST-SC-SIM) was
subcloned into the pGex4T-S expression vector (Amersham). The proteins were
overexpressed at 37°C as an N-terminal GST fusion protein in Escherichia coli
BL21 (DE3) cells (Invitrogen) in LB media. When OD A595 nm reached 0.6, 1 mM
of isopropyl 1-thio-β-D-galactopyranoside (IPTG) was added to the media and
the cells were grown for an additional 4 h at 37°C. The harvested cells were
resuspended in the lysis buffer containing 1× phosphate buffered saline (PBS),
pH 7.4, 150 mM sodium chloride, 5 mM -mercaptoethanol (-ME),1x BugBuster
and Benzonase Nuclease (Novagen,1000X), and the pellet was isolated by
centrifugation (15,000g  30 min). The protein was solubilized in 8M urea and
renatured in a buffer containing 1×PBS, pH 7.4, 150 mM sodium chloride, 10 mM
-mercaptoethanol and 5% glycerol. The GST-tagged proteins were then purified
by glutathione agarose resin and eluted in a buffer containing10mM glutathione.
SIM pull-down
100 pmoles of GST-WT-SIM or GST-SC-SIM were precoated in a single well in
96-well EIA/RIA plate (Costar) at 4 °C overnight. After precoating, the plate was
blocked by 5% BSA at 37 °C for 2 h. Equal amount of His-SUMO2 and GSTSUMO3 protein mix (1:1) or polymer SUMO2/3 in 100 l PBS was added to the
wells and the plate was incubated at 37oC for 2h. The unbound proteins were
removed by washing three times in washing buffer <1XPBS, 0.01% Tween 20>.
100 l of rabbit anti-SUMO 2/3 antibody (Abgent, 1:1000) was added to each well
and the plate was incubated at 37oC for 1h. The wells were then washed three
times by 1X PBS containing 0.01% Tween-20. Horseradish peroxidase (HRP)
conjugated goat anti-rabbit antibody (Bio-Rad, 1:2000) was then added to the
wells and the plate was incubated at 37 °C for 1 h. After washing three times,
3,3’,5,5’-tetramethylbenzidine (TMB) and hydrogene peroxide (H2O2)
(1:1)(Pierce) were added into the wells to develop an intense blue color. The
plate was then read at 450nm by an ELISA reader, SpectraMax M5 (Molecular
Devise) after the reaction was stopped by adding 100l of 1N phosphoric acid.
Statistical analysis
All statistical analysis was carried out by Student’s t test.
Laser microbeam induced DNA damage
Details of the experiments are in the caption of Fig. S4.