Supplementary material for Bonaventure et. al.
Supplementary results:
Analysis of TPC1 mRNA expression
To investigate the possibility that the onset of the fou2 phenotypes correlate with changes in
the level of TPC1 mRNA, the expression of this transcript was analyzed in mutant and wt
leaves at different stages of development by 2 different methods. Gel blot analysis did not
detect changes in the steady-state levels of TPC1 transcripts in young and mature wt and
mutant leaves (Fig. S2) and also to exogenous JA or mechanical wounding (Fig. S2). In
contrast, RT-qPCR detected 2-fold higher levels of TPC1 mRNA in young wt and fou2 leaves
compared to mature leaves, and 2-fold higher levels in wounded fou2 leaves but not in those
of wt (Fig. S2). Thus, based on the more sensitive qPCR technique, TPC1 transcripts appear
to be slightly more abundant in young leaves and wound-induced in fou2 but not in wt leaves.
Supplementary Materials and Methods:
Genetic mapping: The fou2 mutant was backcrossed three times with Col-0 wt to remove
second site mutations. To generate a mapping population, fou2 homozygous plants (Col-0)
were outcrossed to wt Landsberg erecta plants. An initial F2 mapping population of 50 fou2
homozygous individuals was genotyped with SSLP markers. After positioning the fou2 gene
close to marker ciw5 on top of chromosome IV, 519 fou2 homozygous individuals from the
same F2 population were genotyped using existing CAPS markers located in the same
chromosomal region (Fig. 4A). After positioning the fou2 allele close to marker T5L23.3, new
CAPS and SSLP markers were designed based on Col-0 and Ler polymorphisms. These new
markers were named according to their BAC location (Fig. 4A, Table S2). The mutation was
finally bracketed in a chromosomal segment of approximately 30 Kb, which contained seven
genes and was included in BAC clones F9H3 and T5L23.
Sequencing : The complete coding sequence of the genes contained between markers F9H3.3
and T5L23.3 (Fig. 4A) were PCR-amplified from fou2 genomic DNA using the LA Taq
enzyme (Takara, Shiga). Direct sequencing of these genomic PCR fragments was performed.
Retrieved sequences were aligned against the publicly available Arabidopsis genomic
sequence. The primers used to amplify the TPC1 gene were acttggatgctcctgaacttcttgc and
accaattatagccaattgagcggat. The sequences of the primers used to amplify the remaining genes
in the interval analyzed are available upon request. The TPC1 cDNAs from wild-type (Col-0)
and fou2 plants were obtained by reverse transcription of total RNA as described above and
PCR using primers gctttcaattcgatccagtaa and gctcttaacgatcttgttttg. The mutation found in fou2
plants was confirmed by sequencing the TPC1 gene and its corresponding cDNA from fou2
and wild-type plants (Col-0). No mutations were identified in the sequences corresponding to
the remaining genes analyzed. Sequence comparison of various TPC1 putative orthologs was
conducted with ClustalW software.
Vector construction and plant transformation: A segment of genomic DNA spanning the
complete TPC1 coding sequence and its own promoter was PCR amplified using LA Taq
enzyme (Takara, Shiga) and primers (Table S3) containing gene specific sequences and
Gateway cloning sites attB1 and attB2 (Invitrogen, CA). The 7 kb genomic amplicon was
cloned into the binary vector pMDC100. The TPC1 cDNA was PCR amplified using LA Taq
enzyme (Takara, Shiga) and primers (Table S3) containing gene specific sequences and
Gateway cloning sites attB1 and attB2 (Invitrogen, CA). The 2.2 kb genomic amplicon was
cloned into the binary vector pMDC32. Arabidopsis fou2 and wild-type (Col-0) plants were
transformed by Agrobacterium-vacuum infiltration. Transgenic seedlings were selected on
agar plates containing kanamycin (50 g/ml) or hygromycin (25 g/ml).
Northern blot analyses: Total RNA extraction and Northern blots were performed using
standard procedures. A 550 bp PCR fragment derived from amplification of the At-TPC1
cDNA was radiolabeled with [-P32]-dCTP by primer extension and used as a probe for filter
hybridizations.
T-DNA insertion lines: Homozygous plants containing a T-DNA insertion in TPC1
(SALK_145413 and GABI865C03) were identified by PCR using gene and T-DNA specific
primers (Table S4). Both T-DNA/TPC1 junctions of SALK_145413 line were amplified and
sequenced to confirm the T-DNA insertion point. Total RNA was extracted from leaves of
both homozygous ko lines, reversed transcribed and the presence of full length ATPC1
mRNA evaluated by PCR (primers: gctttcaattcgatccagtaa, gctcttaacgatcttgttttg). The eIF4A1 mRNA was co-amplified as a control using the same primers as indicated above.
Mutant crosses: Pollen from fou2 plants was used to pollinate coi1-1 (Col-0) flowers. fou2
coi1-1 double mutants were retrieved in the F2 generation. The presence of homozygous coi11 and fou2 alleles was confirmed by CAPS markers. The fou2 mutation destroys an EcoRV
site present in wt genomic DNA and a CAPS marker was developed (primers:
cttatcacaacaactgagagcc, cttcagagccatctccaacac). A CAPS marker for the coi1-1 allele has been
previously described (15). Heterozygous seedlings derived from the F1 generation of
reciprocal crosses between fou2 and tpc1-2 were analyzed with CAPS markers (fou2) and
PCR (T-DNA) (see above).