Supplementary materials and methods
Immunohistochemistry
Human samples and mice xenograft tissue samples were fixed in 10% neutral buffered
formalin and paraffin-embedded.
Four µm sections were cut and deparaffinized in
Histoclear. Heat Induced Epitope Retrieval (HIER) was performed on sections utilizing
a pressurized de-cloaking chamber (Biocare Medical, LLC, Concord, CA, USA) and
incubated in citrate buffer (pH 6.0) at 990C for 18 min. The sections were then washed
thrice with PBS and endogenous biotin activity was blocked using Avidin/Biotin blocking
kit (Vector Laboratories, Burlingame, CA, USA) according to manufacturer’s
instructions. Further, endogenous peroxidase activity was quenched with 0.3%
hydrogen peroxide in methanol. The sections were blocked with 10% normal serum for
30 min to prevent non-specific binding and then incubated overnight with the primary
antibodies (1:100) for WIF1, β-catenin, TCF-4, E-cadherin, cyclin D1, WNT1, p53, p21,
VEGF (Santa Cruz Biotechnology, Santa Cruz, CA, USA), caspase-3 (Cell Signaling
Technology, Danvers, MA, USA), c-myc and CD31 (BD Biosciences, NJ, USA), and
CD44 (Calbiochem). The biotinylated secondary antibodies (Vector Laboratories,
Burlingame, CA) were used at a dilution of 1:400. The slides were further processed by
using a Vectastatin ABC kit (Vector Laboratories, Burlingame, CA, USA). Antibody
binding was visualized using 3,3'-diaminobenzidine (Sigma-Aldrich) as chromogen.
Nuclei were counterstained with Mayer’s haematoxylin. A negative control sample was
included in each run by omitting the primary antibody. For statistical analysis, the
intensity of WIF1 immunostaining was scored as 0 (negative), 1 (weak), 2 (moderate)
and 3 (strong) in human tissues.
1
Terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) staining
was performed in tissue sections using ApopTag peroxidase in situ apoptosis detection
kit (Chemicon Int., Temecula, CA, USA) according to the manufacturer’s instructions.
Briefly, sections were deparaffinized, rehydrated and incubated with Proteinase K for
20 min at 37° C and then washed with PBS. The endogenous peroxidase activity was
quenched with 3% hydrogen peroxide for 10 min at room temperature. After washing
with PBS, the sections were incubated with working concentration of terminal
deoxynucleotidyl transferase (TdT) at 37° C for 1 h. The sections were then washed
with PBS and finally incubated with anti-digoxigenin conjugate (peroxidase) at room
temperature, and the signal was visualized with diaminobenzidine as chromogen.
Mitotic activity was evaluated directly by counting mitotic figures on 10 randomly
selected fields of H&E stained tumor sections. Mitotic activity is expressed as a ratio of
number of mitoses per high power field (200X). Microvessel density was measured
based on the number of blood vessels stained for CD31 by analyzing 10 randomly
selected fields (400X).
Immunofluorescence
The tissue sections were processed as explained under immunohistochemistry and the
sections were then sequentially exposed to Phospho-Histone H3 antibody (Upstate) for
1 h at 30◦C and its appropriate secondary fluorescent conjugate alexa fluor 568 (red)
(Invitrogen) for 30 min at room temperature. Subsequently, fluorescein conjugated
TUNEL staining was performed using ApopTag in situ apoptosis detection kit
(Chemicon Int) according to the manufacturer’s instructions. The slides were then wet-
2
mounted and counterstained with Hoechst 33342 (Invitrogen).
Microscopic examination
Tissue sections were examined using Nikon 80i microscope base. For bright field, 10X
or 60X digital images were taken with PlanAPO objectives and DXM1200C camera
(Nikon, Melville, NY, USA). Fluorescent images were taken with 20X PlanFluoro
objective utilizing CoolSnap ES2 camera (Photometrics, Tucson, AZ, USA). All images
were captured utilizing NIS-Elements software (Nikon, Melville, NY, USA).
Cell lines
HeLa and C33A human cervical cancer cell lines were obtained from the American
Tissue Culture Collection (ATCC) and maintained as recommended. The CC1 cell line
was obtained from Dr. Lamonis A. Laimins and maintained as reported (Rader et al.,
1990).
Treatment with 5-aza-2'-deoxycytidine
Cervical cancer cell lines were treated with the demethylating agent 5-aza-2'deoxycytidine (50 µM) for 4 days. Total RNA, genomic DNA and protein were isolated
and subjected to real-time reverse transcriptase-polymerase chain reaction (RT-PCR),
methylation studies (methylation-specific PCR and bisulfite sequence analysis) and
western blot analysis, respectively.
Real-time RT-PCR analysis
3
Total RNA was isolated from cells, microdissected human cervical normal and cancer
tissues, and tumor xenograft tissues using TRIzol reagent (Invitrogen, Carlsbad, CA,
USA) and subjected to reverse transcription with SuperscriptTM II RNase H - Reverse
Transcriptase and random hexanucleotide primers (Invitrogen, Carlsbad, CA, USA).
The cDNA was subsequently used for real-time RT-PCR by SYBR chemistry (SYBR®
Green I; Molecular Probes, Eugene, OR, USA) using gene specific primers
(Supplementary Table 1) and Jumpstart Taq DNA polymerase (Sigma-Aldrich, St.
Louis, MO, USA). The crossing threshold value determined by real-time RT-PCR was
noted for the transcripts and normalized with -actin. The changes in mRNA were
expressed as fold change relative to control with ± SD value.
Methylation-specific PCR (MSP)
Genomic DNA was extracted from normal and cervical cancer samples, and cervical
cancer cell lines as we previously described (Queimado et al., 1998). Bisulfite
modification of genomic DNA was carried out using the EZ DNA Methylation Kit (Zymo
Research, Irvine, CA, USA). Bisulfite-modified genomic DNA was amplified using
primers that were specific for methylated (M) and unmethylated (U) DNA. The
sequences of the M-specific primers were 5’-GGGCGTTTTATTGGGCGTAT-3’
(forward) and 5’-AAACCAACAATCAACGAAAC-3’ (reverse). The sequences of the Uspecific
primers
were
5’-GGGTGTTTTATTGGGTGTAT-3’
(forward)
and
5’-
AAACCAACAATCAACAAAAC-3’. For sequencing analysis, bisulfite-modified genomic
DNA was amplified using primers 5’-GAGTGATGTTTTAGGGGTTT-3’ (forward) and 5’CCTAAATACCAAAAAACCTAC-3’ (reverse), designed to amplify nucleotides -555 to -
4
140 of the WIF1 promoter region as previously described (Mazieres et al., 2004).
Following PCR, the products were run in 1% agarose, then cut, blunted by standard
protocol and cloned into pJET 1.2 vector. At least 5 random clones were selected for
colony PCR and sequenced.
WIF1 construct
WIF1
was
amplified
from
testis
cDNA
with
the
primers
5’-
GAGATCTCTCGAGAGGAGGTCCTGAGCAGCATG-3’ (BglII-XhoI-2-WIF1-F) and 5’TACCGCGGCCGCTAATGGTGATGGTGATGGTGCCAGATGTAATTGGATTCAGGTG
-3’ (WIF1-R2-H6.NotI-KnpI), cloned in pGEM-T-EASY vector and sequenced. The
pGEM-T WIF1 insert was then digested with XhoI and NotI, cloned into pCI-blast XhoI
and NotI sites. Insertion sites were confirmed by sequencing.
Transfection and proliferation assay
Exponentially growing HeLa cells were plated onto 96-well plates at the density of
1×104 cells/well and transfected simultaneously with either pCI blast (empty vector) or
pCI blast-WIF1 using LipoD293 transfection reagent (SignaGen Laboratories,
Ijamsville, MD, USA). Cell proliferation was assessed at different time intervals (24, 48
and 72 h) by hexosaminidase assay (Landegren, 1984).
Cell cycle analysis
HeLa cells (3 x 105 cells/well) were plated onto six-well plates and simultaneously
transfected with either empty vector or pCI blast-WIF1 using LipoD293, and cell cycle
5
analysis was performed as we described previously (Natarajan et al., 2008). Briefly, 72
h post-transfection, the floating and attached cells were collected and centrifuged at
1000 rpm for 5 min. The supernatant was discarded, and the cells were washed and
suspended in PBS. Single-cell suspension was fixed in ice-cold 70% ethanol for 2 h at
4°C. The cells were centrifuged to remove the ethanol and washed with PBS. The fixed
cells were then incubated with 1 mg/ml propidium iodide (Sigma-Aldrich St. Louis, MO,
USA), 0.1% Triton X-100 (Sigma-Aldrich) and 2 µg DNase-free RNase (Sigma-Aldrich)
in PBS for 30 min at room temperature in dark. Flow cytometry was done with a
FACSCalibur analyzer (Becton Dickinson, Mountain View, CA, USA), capturing 50,000
events for each sample. Results were analyzed with ModFit LT software (Verity
Software House, Topsham, ME, USA).
Caspase-3/7 activity
HeLa cells (1 x 104 cells/well) were plated onto 96-well black plates and transfected
simultaneously with either empty vector or pCI-blast-WIF1. Caspase-3/7 activity was
measured 72 h post-transfection using the Apo-one Homogeneous Caspase-3/7 Assay
kit as per the manufacturer’s instructions (Promega, Madison, WI, USA).
Western blot analysis
Cells and xenograft tumor samples were homogenized in cell lysis buffer (Cell
Signaling Technology, Beverly, MA, USA) and further sonicated and centrifuged at
12,000 rpm for 10 min at 4°C. Fifty µg proteins per lane were separated on 10%
sodium
dodecyl
sulfate-polyacrylamide
gel
electrophoresis
(SDS-PAGE)
and
6
electrotransferred to Immobilon-P membranes (Millipore, Bedford, MA, USA). The
membranes were blocked for 1 h with 5% non-fat milk and incubated overnight with
primary antibodies [active β-catenin (Upstate, Millipore, Temecula, CA, USA), TCF-4
(Abcam, Cambridge, MA, USA), WIF1, Bax, Bcl-2 and Actin (Santa Cruz
Biotechnology, Santa Cruz, CA, USA)]. This was followed by incubation with secondary
antibodies coupled with HRP (Santa Cruz Biotechnology, Santa Cruz, CA, USA) for 1 h
at room temperature. The membrane was then washed thrice in TBS-T.
Immunoreactive antibody–antigen complexes were visualized with the enhanced
chemiluminescence reagents (Thermo Scientific, Rockford, IL, USA).
Statistical analysis
Statistical analyses were performed using SAS® STAT Version 9.1 (SAS Institute Inc.).
Independent means were compared using unpaired Student's t tests whose degrees of
freedom were corrected, when appropriate, for inequality of variance. Data are
expressed as mean ± s.d. for at least three independent experiments. We considered a
P < 0.05 to be statistically significant.
References
Landegren U. (1984). Measurement of cell numbers by means of the endogenous enzyme
hexosaminidase. Applications to detection of lymphokines and cell surface antigens. J Immunol
Methods 67: 379-388.
Mazieres J, He B, You L, Xu Z, Lee AY, Mikami I et al. (2004). Wnt inhibitory factor-1 is
silenced by promoter hypermethylation in human lung cancer. Cancer Research 64: 4717-4720.
Natarajan G, Ramalingam S, Ramachandran I, May R, Queimado L, Houchen CW et al. (2008).
CUGBP2 downregulation by prostaglandin E2 protects colon cancer cells from radiation-induced
mitotic catastrophe. Am J Physiol Gastrointest Liver Physiol 294: G1235-1244.
7
Queimado L, Reis A, Fonseca I, Martins C, Lovett M, Soares J et al. (1998). A refined
localization of two deleted regions in chromosome 6q associated with salivary gland carcinomas.
Oncogene 16: 83-88.
Rader JS, Golub TR, Hudson JB, Patel D, Bedell MA, Laimins LA. (1990). In vitro
differentiation of epithelial cells from cervical neoplasias resembles in vivo lesions. Oncogene 5:
571-576.
8