Word file (699 KB )

advertisement
Supplementary Information
1. Materials and Methods
Screening of AMD samples using fluorescence in situ hybridization (FISH)
FISH was used to screen the eight samples collected from within the Richmond
Mine in March 2003. Samples were probed with previously designed1 group-specific
(LF655, LF1252, SUL229, FER656 and TH1187) and domain level probes (EUB338mix, ARC915, and EUK-mix) using strandard protocols2, in order to identify a
community suitable for community genomics. After initial screening, the 5-way
community sample was selected for detail characterization for the following reason (i)
typical of biofilms from the AMD system (based on biofilms characterized in prior
research), (ii) it was dominated by Leptospirillum species that are known to be of
particular significance in acid mine drainage generation, (iii) because it contained
Ferroplasma closely related to F. acidarmanus, but in relatively low abundance (to
reduce sampling of this already well characterized organism), and (iv) the abundance of
eukaryotes was low. The 5-way community members were quantified with genus-level
probes (see above) by counting cell hybridized with specific probes relative to those
counted with DAPI (4’, 6’–diamidino-2-phenylindole dihydrochloride).
Preparation of environmental DNA
Genomic DNA was extracted from ~1g of 5-way biofilm (containing 109-1010
cells) using a protocol similar to that used for the extraction of high molecular weight
DNA from marine picoplankton assemblages3. The biofilm sample was homogenized
using a 16G1 syringe and embedded in a 0.8% agarose plug. Plugs were placed in a
1
buffer solution (100mM NaCl, 50mM Tris-Cl, 100mM EDTA, pH 8) and treated with
lysozyme (5mg/ml) at 37ºC for 3 hrs and then transferred to a second buffer solution
(100mM NaCl, 50mM Tris-Cl, 500mM EDTA, pH 8) treated with proteinase k
(0.2mg/ml) at 50ºC for 24 hrs. Plugs allows to equilibrated in 1x TE buffer (10mM TrisCl, 1mM EDTA, pH 8) prior to running the DNA out of the plug using pulse field gel
electrophoresis. High molecular weight DNA (>20Kb) was excised for the gel and
precipitated.
16S rRNA gene libraries
Polymerase chain reaction (PCR) was performed on gel purified DNA using
modified 27f (bacterial; 5’-AGRGTTTGATYMTGGCTCAG-3’) and 23f primers
(archaeal; 5’-TCCGGTTGATCCYGSC-3’), in combination with universal 16S rRNA
gene
primers
(1391r;
5’-GACGGGCRGTGWGTRCA-3’,
and
1492r;
5’-
GGYTACCTTGTTACGACTT-3’). PCR products from bacterial and archaeal primer
sets were pooled and cloned into pCR® 2.1-TOPO® vector using TOPO TA cloning kit.
Double-ended plasmid sequences for 384 clones were aligned and analyzed using the
ARB sequence analysis software package (www.arb-home.de) (3). Phylogenetic trees
based on comparative analysis of the 16S rRNA genes were constructed by distance and
parsimony methods, using PAUP* version 4.0b2a. The robustness of the tree topology
was tested by bootstrap resampling under a range of outgroup configurations.
2
Library construction and plasmid end- sequencing
3 kb DNA shearing and plasmid sub-cloning. Approximately 3-5 ug of isolated DNA
was randomly sheared to 3-4 kb fragments in a 100 μl volume using a HydroShear™
(GeneMachines, San Carlos, CA).
The sheared DNA was immediately blunt end-
repaired at room temperature for 40 min using 6 U of T4 DNA Polymerase (Roche), 30 U
of DNA Polymerase I Klenow Fragment (NEB, Beverly, MA), 10 μl of 10 mM dNTP
mix (Amersham), and 13 μl of 10x Klenow Buffer in a 130 μl total volume. After
incubation the reaction was heat inactivated for 15 min @ 70oC, cooled to 4oC for 10 min
and then frozen @ -20oC for storage. The end-repaired DNA was run on a 1% TAE
agarose gel for ~ 30-40 min @ 120 volts. Using ethidium bromide stain and UV
illumination, 3-4 kb fragments were extracted from the agarose gel and purified using
QIAquick™ Gel Extraction Kit (QIAGEN).
Approximately 200-400 ng of purified
fragment was blunt-end ligated for 40 min into the Sma I site of 100 ng of pUC 18
cloning vector (Roche) using the Fast-Link™ DNA Ligation Kit (Epicentre, Madison,
WI). Following standard protocols, 1 μl of ligation product was electroporated into
DH10B Electromax™ cells (Invitrogen, Carlsbad, CA) using the GENE PULSER® II
electroporator (Bio-Rad, Hercules, CA). Transformed cells were transferred into 1000 L
of SOC and incubated @ 37oC in a rotating wheel for 1 h. Cells (usually 20-50 μl) were
spread on 22 x 22 cm LB agar plates containing 100 g/mL of ampicillin, 120 g/mL of
IPTG, and 50 g/mL of X-GAL. Colonies were grown for 16 h at 37oC. Individual white
recombinant colonies were selected and picked into 384-well microtiter plates containing
LB/glycerol (7.5%) media containing 50 g/mL of ampicillin using the Q-Bot™
multitasking robot (Genetix, Dorset, U.K.). To test the quality of the library (XYG), 24
3
colonies were directly PCR amplified with pUC m13 -28 and -40 primers using standard
protocols. Libraries are considered to pass PCR QC if they have > 90% 3 kb inserts. For
more details see research protocols at www.jgi.doe.gov.
Plasmid amplification. 2 mL aliquots of saturated E. coli cultures (DH10B) containing
pUC18 vector with random 3-4 kb DNA inserts grown in LB/glycerol (7.5%) media
containing 50 g/mL of ampicillin were added to 8 mL of a 10 mM Tris-HCl pH 8.2 + 0.1
mM EDTA denaturation buffer. The mixtures were heat lysed at 95oC for 5 min then
placed at 4oC for 5 min. To these denatured products, 10 mL of an RCA reaction mixture
(Templiphi™ DNA Sequencing Template Amplification Kit, Amersham Biosciences)
were added. The amplification reactions were carried out at 30oC for 12-18 hrs. The
amplified products were heat inactivated at 65oC for 10 min then placed at 4oC until used
as template for sequencing.
Plasmid sequencing.
Aliquots of the 20 ml amplified plasmid RCA products were
sequenced with standard M13 –28 or –40 primers. The reactions typically contained 1
mL of the RCA product, sequenced with 2 pmoles of standard M13 –28 or –40 primers, 1
mL 5x buffer, 0.8 mL H2O, and 1 mL BigDye sequencing kit (Applied Biosystems) at 1
min denaturation and 25 cycles of 95oC-30 sec, 50oC-20 sec, 60oC-4 min, and finally
hold at 4oC. The reactions were then purified by a magnetic bead protocol (see research
protocols, www.jgi.doe.gov) and run on an ABI PRISM 3730 (Applied Biosystems)
capillary DNA sequencer.
4
Approximately 5% of the sequences were produced with an alternate protocol
using 1 mL RCA product, 4 pmoles primer, 5 mL dH2O, and 4 mL DYEnamic™ ET
terminator sequencing kit (Amersham Biosciences). Cycle sequencing conditions were
30 rounds of 95oC-25 sec, 50oC-10 sec, 60oC-2 min, hold at 4oC. The reactions were then
purified by a magnetic bead protocol (see research protocols, www.jgi.doe.gov) and run
on a MegaBACE 4000 (Amersham Biosciences).
Vector and quality trimming of shotgun data
Raw sequence data processed through Phred (Ewing and Green) were trimmed
according to standard JGI trim-15 protocol as follows.
1) Vector sequence is identified with CrossMatch (Smit, Green)
2) Phred quality scores are averaged over windows of 11 bases (+/- 5 on either side of
the base under consideration)
3) The longest stretch of at least 100 bases of non-vector sequence with windowaveraged quality of at least 15 is kept as the "trim-15" dataset. Reads whose longest
window is shorter than 100 nucleotides are not used in subsequent analyses.
124,805 reads totaling 124.4 MB untrimmed sequence (average untrimmed read
length 996 bases) were generated as described above. After trimming, 103,462 reads
totaling 76.2 MB in trimmed length remained (average trimmed read length 737 bases).
By comparisons with known sequence in other projects, we estimate that 99.88% of the
trimmed bases can be aligned, and those that align are 99.97% identical, so that this trim
procedure produces reads that are 99.85% accurate.
The trimmed set includes 50,973 pairs of reads from the same clone (both 3' and 5'
5
ends of the insert survive trimming) and 1,516 unpaired reads. Thus 98.5% of reads in
the trimmed data set are paired.
Local depth calculation
In a conventional shotgun project, "depth" is defined as the number of reads that
sample an average base pair in the genome (either strand). This may be generalized
(Chapman, unpublished) to define a "local" depth for each shotgun read based on the
number of high quality alignments that it participates in with other shotgun reads. Since
alignments can overlap either end of a read, we define "local depth" as
d_local = n_alignments / [ 1 + ( l - 2 L_0 )/ L ]
where n_alignments is the number of observed alignments of specified quality, l is the
length of the read in question, L_0 is the minimal detectable alignment (22 bases) and L
is the mean read length (737 bases).
For this study, pairwise alignments were generated by the MALIGN module of
the JAZZ assembler, which uses a banded Smith-Waterman alignment triggered when
two trimmed reads share more than 10 exactly matching runs of 13 nucleotides along a
diagonal. Thus alignments of at least 22 consecutive matching bases are detected, but
only runs of 13 consecutive matching bases are required. The scoring system for these
alignments is +1 for match and -4 for mismatch, so that for long overlapping regions
alignments up to 80% identity matches may be detected. The overall percent-identity
distribution of these alignments was used to determine an alignment quality threshold for
the purposes of calculating local read depth. That distribution for the present dataset is
6
shown in Supplementary Figure 1. Based on this analysis, alignments of greater than
99% were used in computing local depth. Using an alternate cutoff of 98% produces a
similar local depth distribution (data not shown).
Supplementary Figure 1: Number of alignments detected vs. alignment percent identity.
Assembly of community genomes
Shotgun reads that survived the "trim15" protocol described above were
assembled into scaffolds using JAZZ, an assembly tool for large and potentially
polymorphic shotgun assembly projects. No advance partitioning of the reads was made.
7
Details of the assembly method were similar to those described in the assembly of the
polymorphic animal genomes of Fugu and Ciona4. There were two principal differences.
First, non-uniform depth was not penalized here as it was in those two cases because of
the heterogeneous nature of the community sample, that is, we already knew that the
sequence depth varied from 3-10X depending on the genome in question. Matching
reads of as low as 95% identity were allowed to participate in the assembly to incorporate
different haplotypes from the same genome. Defining the score of a pairwise read
alignment as
score = # matches - 19*(# mismatches + # gaps),
any alignment with score greater than or equal to 500 was considered "high quality" and
was used in the earliest stages of assembly. Additional self-consistent rounds of read
placement relied on lower scoring alignments and read-pair linkage to incorporate
additional reads into the assembly. No alignment with a score less than zero was used.
Internal self-consistency of the assembly is confirmed by the relative position and
orientation of read-pair ends within the scaffolds. Only 2.8% of clones with both ends
placed in the assembly are not placed within three standard deviations of the expected
end separation and in the expected orientation. An additional 1.5% of clones have both
ends placed within an insert length of a scaffold end and may therefore provide additional
unconfirmed scaffold linkage.
Assignment of scaffolds to genomes based on GC content and assembled depth
The shotgun reads show bimodal distributions of GC content and "local" depth
(Supplementary Fig 2). After assembly, these characteristics can be used to assign
8
assembled scaffolds to bins of scaffold GC and "assembled" depth. Here assembled
depth is defined as the net length of reads assembled into a scaffold divided by the length
of that scaffold. This is an accurate representation of sampling depth in the limit of long
scaffolds. Since the typical scaffold in our assembly is greater than 10 kb and contains
over 100 assembled reads, both the GC content and assembled depth are subject to less
statistical fluctuation than is found for individual reads. The sharper distributions allow
clear assignment of most scaffolds to well-defined bins of high and low GC content
(bacterial and archaeal, respectively) and high and low assembled depth. Only scaffolds
longer than 2kb are reported, since shorter scaffolds are subject to greater variation in
assembled depth. Such variations can be due to random statistical variations or cloning
bias.
Supplementary Figure 2A: Read average GC content vs. local read depth.
Supplementary figure 3A shows the distribution of scaffold GC content, with
the contribution of each scaffold weighted by its length. The bimodal distribution is
related to the bimodal distribution observed for single reads (see supplementary figure
2), but the peaks are sharper due to the averaging across the length of the scaffold. A
9
clear separation is found around GC=0.435. About 100 kb of assembly (approximately
1%) lies between GC=0.42 and GC=0.45. It is likely that some of this sequence is misassigned between the bacterial and archaeal genomes.
Supplementary Figure 3A: Scaffold bases vs. GC content
Supplementary Fig. 3B shows the distribution of assembled depth for scaffolds
longer than 2kb. The separation of low and high depth scaffolds is not as clean as for GC
content. By separating scaffolds first by GC content (above or below 0.44) and then
checking the distribution of assembled depths (Supplementary Fig 3C) we see that the
bacterial (high GC) scaffolds show a peak at 2-3X and another at 9-10X, allowing a clear
separation above and below 5.5X. Some scaffolds from the approximately 150 kb (1.5%
of the assembly) with assembled depth between 5X and 6X may be mis-assigned between
the Leptospirillum group II (high depth) and group III (low depth) genomes. Similarly,
the low GC (archaeal) scaffolds show peaks in assembled depth around 3.5X and 10-
10
11X, with the separatrix between the two peaks at 7X. Again, approximately 150 kb
(1.5% of the total assembly) with depths between 6.5X and 7.5X may be mis-assigned
between Ferroplasma type II (high depth) and the various low depth archaeal genomes.
Thus using both GC content and assembled depth we can cleanly classify most scaffolds,
with a few percent of the assembly likely to be mis-assigned.
Supplementary Figure 3B: Scaffold bases vs. assembly depth
11
Supplementary Figure 3C: Scaffold bases vs. assembly depth
Analysis of intra-species variation
To assess sequence variation within a scaffold, we used two methods. First, we
used the multiple alignment of trimmed reads as produced by the assembly. These
multiple alignments were parsed to count the number of occurrences of each nucleotide at
each column of the multiple alignment. A site is flagged as potentially polymorphic if at
least two reads indicated at least two different nucleotides (or gap). This condition
requires a depth of at least 4 at any base to identify a polymorphism.
As an assembly independent test, we aligned (trimmed) shotgun reads to their
position on the consensus genomes performed in two steps as follows. First, all of the
trimmed (using our trim15 protocol as in the assembly) reads were blasted against all of
the scaffolds using a local installation of NCBI BLAST with word size 24, mismatch
12
score -6, and E-value cutoff 10^-199.
89,757 trimmed reads were assigned to the
scaffold to which they had their highest scoring BLAST alignment.
No specific
requirement was made as to the percent identity or percent hit of these alignments.
Average percent identity of these alignments was 99.6% and average percentage-oflength in the alignment was 98%.
25,531 of these highest scoring alignments were to the 55 scaffolds assigned to
the Ferroplasma type II genome by GC/depth analysis. These reads were re-aligned to
the scaffold to which they had their highest scoring alignment using a more sensitive
blastn with word size 16, mismatch score –6, and e-value cutoff 1e-100, with multiple
alignment output (option –m 3).
As above, the resulting multiple alignments were parsed using the custom Perl
script m3Parser.pl (J. Chapman) to identify polymorphisms supported by two or more
reads. The number and type of each observed polymorphism (for location with BLAST
depth less than 20) is:
Three confirmed alleles at each locus (deletion indicated by “-“)
cg- 1, at- 3, gt- 3, ac- 5, ct- 6, gn 8, -n 11, ag- 12, cn 17, acg 44, cgt 47, agt 69,
act 76,
two alleles at each locus:
an 55, tn 59, c- 162, g- 169, a- 280, t- 286, cg 1207, at 2043, ac 2593, gt 2602, ag
10021, ct 10236,
where "ct 10236" for example means both a "c" and a "t" were observed occurring on at
least 2 reads apiece in 10,236 positions in the alignment.
13
A small number of
corroborated “n” (unknown base) positions were observed. The dominant variations,
however, are single nucleotide substitutions.
Transitions outnumber transversions
approximately 2:1. The distribution of depth observed in the multiple alignment is shown
in Supplementary Fig 4.
Supplementary Fig 4: Number of bases vs. BLAST multiple alignment depth
Shown in Supplementary Figure 5 is the fraction of polymorphic sites observed
as a function of depth of coverage using assembly multiple alignments. Note that that
low depth regions of the genome are less likely to redundantly sample distinct variants
than high depth regions, leading to an ascertainment bias. We can correct for this by
modeling each nucleotide position has having two alleles (which is true for the vast
majority of polymorphic sites), with the major allele occurring with probability p and the
minor allele with probability (1-p). We can then fit the observed data to a two parameter
14
fit: the fraction of polymorphic sites x and the frequency p of the major allele. The best
fit is to x=3.5% and p=0.80, suggesting that the average polymorphism rate for confirmed
variants of 2.2% is artificially lowered by the sampling bias. The implied heterozygosity
is then 2xp(1-p) = 1.1%
Supplementary Figure 5: Polymorphism rate vs. depth of read coverage for the
Ferroplasma type II consensus genome.
Annotation for Gene/Operon identification and functional characterization
To identify protein and RNA genes in genomic sequences from an environmental
sample we applied the Fgenesb_annotator pipeline developed by Softberry Inc
(http://www.softberry.com/berry.phtml?topic=gfindb)
which
provides
completely
automatic comprehensive annotation of bacterial sequences. The pipeline includes
protein, tRNA and rRNA genes identification, finds potential promoters, terminators and
15
operon units. Predicted genes are annotated based on comparison with known proteins.
The package provides options to works with a set of sequences such as scaffolds of
bacterial genomes or short reads of DNA extracted from some bacterial community. The
final annotation can be presented in GeneBank form to be readable by visualization
software such as Artemis5. The gene prediction algorithm is based on Markov chain
models of coding regions and translation and termination sites. For annotation of mixed
microbial community we use parameters of gene prediction computed based on a large
set of known microbial sequences. Operon models are based on distances between ORFs,
frequencies of different genes neighboring each other in known bacterial genomes and
information from predicted potential promoters and terminators. The parameters of gene
prediction are automatically learned on initial steps of sequence analysis, so the only
input necessary for annotation of new genome is its sequence. Optionally, parameters
from closely related genomes can be used, instead of learning the new parameters.
Bacterial gene/operon prediction and annotation requires, besides Fgeneshb_annotator
programs and scripts, Blast6, NCBI Non-Redundant database (NR) and the file
reconstructed from COG database7. Ribosomal RNA genes are annotated using Blast
similarity with all known bacterial rRNA database. For prediction of tRNA genes
pipeline uses tRNAscan-SE package 8.
Manual
partial
annotation of ORFs
was
carried out
using
Artemis
(http://www.sanger.ac.uk/Software/Artemis). The results of the automated annotation
were examined to confirm product assignment, COGs, and start codon positions.
16
2. Supporting Text
Sequence Assembly and Analysis
We generated 103,462 high quality reads averaging 732 base pairs for a total of
76.2 million base pairs. To characterize the raw shotgun sequences prior to assembly, we
first assessed their GC content and local shotgun depth (Supplementary Fig. 2). GC
content is bimodal, with well-defined peaks at 38% and 55%. Assignment of shotgun
reads containing 16S rRNA gene and other conserved markers indicates that the low GC
cluster is archaeal, consistent with the GC distribution of the fer1 genome, and the high
GC cluster is bacterial. The discrepancy between the abundance of bacteria and archaea
determined by FISH (Fig. 1B) and from the integrated areas under peaks
(Supplementary Fig. 3A) indicates that the shotgun library contained a bias that
increased the sampling of archaeal genomes. Figure 2 indicates that two genomes were
sampled at ~10x coverage and three genomes at ~3x coverage.
Comparison of the archaeal genome fragments with the near complete fer1
genome 16 yields a plot containing three peaks (Supplementary Fig. 6). Genome
fragments containing the 16S rRNA genes were used to assign peaks to organism types.
The first peak in Figure 2B (> 98% identity to fer1) was assigned to a Ferroplasma
species closely related to the fer1 genome, hence forth referred to as Ferroplasma type I.
The peak centered at 77% in Fig. 2B was assigned to a second Ferroplasma species (type
II), and the peak centered at 63% to “G-plasma” and “A-plasma”. The genomes of
Ferroplasma type II and fer1 are clearly divergent, despite their near identical 16S rRNA
genes. As noted previously (9), this illustrates the limitation of the highly conserved 16S
rRNA gene in resolving distinct genome types.
17
Supplementary Figure 6: Diagram showing the comparison of low GC archaeal
scaffolds vs. the fer1 genome. The peak on the right side (at > 98%) is the fer1
population, that at 77% is the Ferroplasma type II population, and that at 66% is
attributed predominantly to “G-plasma”.
Based on these results, the bacterial component at 10x coverage was assigned to
Leptospirillum group II and the archaeal component at 10x coverage to Ferroplasma type
II. The genomes of Leptospirillum group III, Ferroplasma type I, and “G-plasma”,
correspond to the bacterial and archaeal groups at about 3x coverage (Supplementary
Fig. 2). “A-plasma”, and Sulfobacillus were sampled at < 1.5x coverage.
Supplementary Figure 7 illustrates the degree of conservation of gene order
between the consensus Ferroplasma type II and fer1 strain genomes.
Because the
Ferroplasma type II genome is in many unlinked scaffold it was necessary to order the
18
scaffolds in an arbitary manner. Figure 6 assumes that the scaffold order is the same as in
fer1. The result shows that, within scaffolds, gene order is highly conserved. The large
apparently displaced is fragment is not a rearrangement but the result of a transposaseinduced artifact (arrow).
Supplementary Figure 7: The degree of conservation of gene order within scaffolds in
the Ferroplasma type II consensus genome relative to fer1. In this plot, the contigs were
ordered by reference to the fer1 genome. Plot constructed using the promer program
within the MUMmer3.0 software package.
Supplementary Figure 8 illustrates the 20 kb region surrounding the region of
the Ferroplasma type II consensus genome shown in Figure 2 (main text). Open reading
frames are shown in red, together with their annotation. The green line shows average
read depth and the blue line shows the number of nucleotide polymorphisms averaged
over 100 bp windows that overlap by 50 bp.
19
Supplementary Figure 8: A 20 kb region of the Ferroplasma type II consensus genome
showing depth (green), polymorphism frequency (blue) and open reading frames (red).
Supplementary Figure 9 shows a portion of the Ferroplasma type II genome
(scaffold 10, 49133 - 51430) illustrating individual reads compared to the consensus
sequence. Atpositions of nucleotide polymorphisms, the base chosen was the one that
occurred in twoof the three strains (thus the consensus sequence approximates that of a
common ancestorto the green, pink, and yellow strains). Note that three nucleotide
polymorphism patternsare present in most areas (dark green indicates sequence that could
be either pink orgreen). Analysis of this region and other regions around the genome
(scaffolds 1, 5, 9,10) showed that the result presented here is representative. Note that the
yellow variantcontains many more polymorphisms than pink or green and is the only type
that showsevidence for heterogeneity within the polymorphism patterns (beyond possible
sequencing errors).
20
KEY:
.....
.....
.....
.....
nucleotide polymorphism pattern 1
nucleotide polymorphism pattern 2
nucleotide polymorphism pattern 3
could be either nucleotide polymorphism pattern 1 or 2
............ approximate location of recombination
QUERY
49133
XYG64329.g1
XYG59333.g1
XYG56626.b1
XYG44001.b1
XYG57594.g1
XYG54764.b1
XYG41658.g1
XYG3845.b2
XYG30835.b1
XYG40273.g1
XYG22594.b3
XYG53925.g1
XYG29746.g1
XYG23480.b1
559
658
131
369
745
105
442
151
620
453
540
341
111
151
atggaatggaaaactgtatgtgacccgtccgaagttgaggcaggaaaaagcaaggaat
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
...............a........a....g.......g.a.t................
...............a........a....g.......g.a.t................
QUERY
XYG64329.g1
XYG59333.g1
XYG56626.b1
XYG44001.b1
XYG57594.g1
XYG54764.b1
XYG41658.g1
XYG3845.b2
XYG53925.g1
XYG40273.g1
XYG30835.b1
XYG22594.b3
XYG44963.b1
XYG29746.g1
49191
501
716
189
311
687
163
384
209
283
395
562
482
1034
169
ttgaaattagtggtaagaaaatactagtttcaaatatagatggaaggttttatgcaa
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
................a....................g.......a...........
................a....................g.......a...........
QUERY
XYG64329.g1
XYG59333.g1
XYG56626.b1
XYG44001.b1
XYG57594.g1
XYG54764.b1
XYG41658.g1
XYG3845.b2
XYG40273.g1
XYG53925.g1
XYG30835.b1
XYG22594.b3
XYG29746.g1
49248
444
773
246
254
630
220
327
266
338
226
505
425
226
tagatgccctgtgctctcacatgggtggagatctggggaagggaaaaatagaaggaaag
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...............................g....................g......
...........................................................
...........................................................
...........................................................
...............................g....................g......
...............................g....................g......
...............................g....................g......
QUERY
XYG64329.g1
XYG59333.g1
XYG56626.b1
XYG44001.b1
XYG57594.g1
XYG54764.b1
XYG3845.b2
XYG40273.g1
XYG53925.g1
XYG41658.g1
XYG30835.b1
XYG22594.b3
49307
385
832
305
195
571
279
325
279
167
268
446
366
gatgtaatatgcccgaaacaccatgcaaaatttgatatgaaaacaggaaacgtggataaa
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
....................................g...c.........g.........
....................................g...c.........g.........
....................................g...c.........g.........
21
49190
502
715
188
312
688
162
385
208
563
396
483
284
168
94
49247
445
772
245
255
631
219
328
265
227
339
506
426
978
225
49306
386
831
304
196
572
278
269
324
280
168
447
367
284
49366
326
891
364
136
512
338
384
220
108
209
387
307
XYG44963.b1 917
XYG29746.g1 285
....................................g...c.........g......... 858
....................................g...c.........g......... 344
QUERY
XYG64329.g1
XYG56626.b1
XYG44001.b1
XYG57594.g1
XYG54764.b1
XYG3845.b2
XYG40273.g1
XYG53925.g1
XYG41658.g1
XYG30835.b1
XYG22594.b3
XYG44963.b1
XYG50049.b1
XYG29746.g1
49367
325
365
135
511
339
385
219
107
208
386
306
857
87
345
aacatcaacggatttgtcaaggcaataacaagaaaggaggcaaagcaccttagttcata
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
.................t....................t..c...g.t..g........
.................t....................t..c...g.t..g........
.................t....................t..c...g.t..g........
.................t....................t..c...g.t..g........
.................t....................t..c...g.t..g........
.................t....................t..c...g.t..g........
QUERY
XYG64329.g1
XYG56626.b1
XYG57594.g1
XYG54764.b1
XYG20429.b2
XYG3845.b2
XYG40273.g1
XYG41658.g1
XYG30835.b1
XYG22594.b3
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYG29746.g1
49426
266
424
452
398
691
444
160
149
327
247
798
146
869
404
tgaggtaaaggagaatgaaggaaaattatcaataaatatttaaatatcttatttt 49480
....................................................... 212
....................................................... 478
....................................................... 398
....................................................... 452
....................................................... 637
..................g......................g............ 498
..................g......................g............ 106
.........a...g.g....................................... 95
.........a...g.g....................................... 273
.........a...g.g....................................... 193
.........a...g.g....................................... 744
.........a...g.g....................................... 200
.........a...g.g....................................... 815
.........a...g.g....................................... 458
QUERY
XYG64329.g1
XYG56626.b1
XYG68351.g1
XYG57594.g1
XYG54764.b1
XYG20429.b2
XYG3845.b2
XYG40273.g1
XYG41658.g1
XYG30835.b1
XYG22594.b3
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYG29746.g1
49481
211
479
160
397
453
636
499
105
94
272
192
743
201
814
459
tatttagttttatttgaggatattaggaacgtttttatacgattttctattgcattat
.....g.......................t............................
.....g.......................t............................
.....g.......................t............................
.....g.......................t............................
.....g.......................t............................
.....g.......................t............................
..........................................................
..........................................................
...................g......c...............................
...................g......c...............................
...................g......c...............................
...................g......c...............................
...................g......c...............................
...................g......c...............................
...................g......c...............................
QUERY
XYG64329.g1
XYG56626.b1
XYG52138.b1
XYG68351.g1
XYG57594.g1
XYG54764.b1
XYG65051.g1
XYG20429.b2
XYG43221.b1
XYG37108.b1
XYG3845.b2
XYG30835.b1
XYG22594.b3
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYG29746.g1
XYD5460.g1
49539
153
537
927
102
339
511
813
578
64
758
557
214
134
685
259
756
517
58
tatgtttccggataaatttgaatactatgcaccagagagcatagaggaggctgctgaatt
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
.......................
............................................................
............................................................
..................................a.........................
..................................a.........................
..................................a.........................
..................................a.........................
..................................a.........................
..................................a.........................
..................................a.........................
22
49425
267
423
77
453
397
443
161
49
150
328
248
799
145
403
49538
154
536
103
340
510
579
556
48
37
215
135
686
258
757
516
49598
94
596
868
43
280
570
754
519
86
699
616
155
75
626
318
697
576
117
QUERY
XYG64329.g1
XYG46859.b1
XYG56626.b1
XYG52138.b1
XYG57594.g1
XYG54764.b1
XYG65051.g1
XYG20429.b2
XYG43221.b1
XYG37108.b1
XYG3845.b2
XYG30835.b1
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYG29746.g1
XYD5460.g1
XYG14070.b3
49599
93
69
597
867
279
571
753
518
87
698
617
154
625
319
696
577
118
95
tttgaatggacatgaagatgcaaaggtacttgccgggggacagagcctgatacctttact
......................................................-.....
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
........c...................................................
........c...................................................
........c...................................................
.............................................t..t...........
.............................................t..t...........
.............................................t..t...........
.............................................t..t...........
.............................................t..t...........
.............................................t..t...........
.............................................t..t...........
49658
35
128
656
808
220
630
694
459
146
639
676
95
566
378
637
636
177
154
QUERY
XYG46859.b1
XYG56626.b1
XYG52138.b1
XYG57594.g1
XYG54764.b1
XYG65051.g1
XYG31650.g1
XYG20429.b2
XYG12638.g2
XYG43221.b1
XYG37108.b1
XYG3845.b2
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYG29746.g1
XYD5460.g1
XYG14070.b3
49659
129
657
807
219
631
693
732
458
609
147
638
677
565
379
636
637
178
155
gaagctcagattcacatcagttccgcaacttgtggatataggcagaatcaagggcatgga
...................................................a........
...................................................a........
...................................................a........
...................................................a........
...................................................a........
...................................................a........
...................................................a........
...................................................a........
....t..............................................a........
............................................................
............................................................
............................................................
......t.................a...................................
......t.................a...................................
......t.................a...................................
......t.................a...................................
......t.................a...................................
......t.................a...................................
49718
188
716
748
160
690
634
673
399
550
206
579
736
506
438
577
696
237
214
QUERY
XYG46859.b1
XYG56626.b1
XYG52138.b1
XYG57594.g1
XYG54764.b1
XYG31650.g1
XYG65051.g1
XYG20429.b2
XYG12638.g2
XYG43221.b1
XYG37108.b1
XYD5460.g1
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYG29746.g1
XYG14070.b3
49719
189
717
747
159
691
672
633
398
549
207
578
238
505
439
576
697
215
tgcgatctcatttcatggaaaaaccctggaaatagctgcaatggcaaggacagccgacat
.........................................................t..
.........................................................t..
.........................................................t..
.........................................................t..
.........................................................t..
.........................................................t..
.........................................................t..
.........................................................t..
.................-.......................................t..
............................................................
............................................................
..g............g......................................a.....
..g.....t......g..g.....t..........................t..a.....
..g.....t......g..g.....t.............................a.....
..g.....t......g..g.....t.............................a.....
..g.....t......g..g.....t.............................a.....
..g.....t......g..g.....t.............................a.....
49778
248
776
688
100
750
613
574
339
491
266
519
297
446
498
517
756
274
QUERY
XYG46859.b1
XYG56626.b1
XYG52138.b1
XYG57594.g1
XYG65051.g1
XYG31650.g1
XYG20429.b2
XYG12638.g2
XYG43221.b1
XYG37108.b1
49779
249
777
687
99
573
612
338
490
267
518
tggggaaaaccaggaaataagaaagaaattccccatattgagcgaggctgcaggactca
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
-............-.............................................
...........................................................
...........................................................
23
49837
307
835
629
40
515
554
280
434
325
460
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYD5460.g1
XYG14070.b3
445
499
516
298
275
...........................t....................a..g.....t.
...........................t....................a..g.....t.
...........................t....................a..g.....t.
...........................t....................a..g.....t.
...........................t....................a..g.....t.
387
557
458
356
333
QUERY
XYG46859.b1
XYG56626.b1
XYG52138.b1
XYG65051.g1
XYG31650.g1
XYG20429.b2
XYG12638.g2
XYG43221.b1
XYG37108.b1
XYD5460.g1
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYG14070.b3
49838
308
836
628
514
553
279
433
326
459
357
386
558
457
334
tagctgatcctctggtaagaaatatgggcacaataggtggcgatatatgccatggtgac
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
..........c..........................g..a.....t...........t
..........c..........................g..a.....t...........t
..........c..........................g..a.....t...........t
..........c..........................g..a.....t...........t
..........c..........................g..a.....t...........t
49896
366
894
570
456
495
221
375
384
401
415
328
616
399
392
QUERY
XYG46859.b1
XYG56626.b1
XYG52138.b1
XYG65051.g1
XYG31650.g1
XYG20429.b2
XYG12638.g2
XYG43221.b1
XYG37108.b1
XYD5460.g1
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYG14070.b3
49897
367
895
569
455
494
220
374
385
400
416
327
617
398
393
ccagcaaacgatttccctgcggtaatgcttgcccttggagcggaatttgaagttacat
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..........................................................
..g.............................t........a........g.......
..g.............................t........a........g.......
..g.............................t........a........g.......
..g.............................t........a........g.......
..g.............................t........a........g.......
QUERY
XYG46859.b1
XYG52138.b1
XYG59333.b1
XYG65051.g1
XYG31650.g1
XYG20429.b2
XYG12638.g2
XYG43221.b1
XYG37108.b1
XYD5460.g1
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYG14070.b3
49955
425
511
868
397
436
162
316
443
342
474
269
675
340
451
cggccaggggaaaaaggattattaaagctgaggatttctttacagatacattcacga
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
.......................c.................................
.......................c.................................
..a.a.a.....................c..................gt........
..a.a.a.....................c..................gt........
..a.a.a.....................c..................gt........
..a.a.a.....................c..................gt........
..a.a.a.....................c..................gt........
QUERY
XYG46859.b1
XYG52138.b1
XYG59333.b1
XYG65051.g1
XYG31650.g1
XYG20429.b2
XYG12638.g2
XYG43221.b1
XYG61193.b1
XYG37108.b1
XYD5460.g1
XYG44963.b1
XYG50049.b1
XYG67885.b1
XYG17385.b3
XYG14070.b3
50012
482
454
811
340
379
105
259
500
885
285
531
212
732
283
680
508
ctgcattgaatacgggtgaaatacttacaaaaataaaaatagaagataacaaatcctca
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
.........................................................
...........................................................
....................................t......................
....................................t......................
....................................t......................
...........c....g...................................g......
...........c....g...................................g......
...........c....g...................................g......
...........c....g...................................g......
.........c....g...................................g......
...........c....g...................................g......
24
49954
424
952
512
398
437
163
317
442
343
473
270
674
341
450
50011
481
455
812
341
380
106
260
499
286
530
213
731
284
507
50070
540
396
753
282
321
49
201
558
827
227
589
154
790
225
624
566
QUERY
XYG46859.b1
XYG52138.b1
XYG59333.b1
XYG53505.b1
XYG65051.g1
XYG31650.g1
XYG12638.g2
XYG43221.b1
XYG61193.b1
XYG37108.b1
XYG34660.g1
XYD5460.g1
XYG44963.b1
XYG67885.b1
XYG17385.b3
XYG14070.b3
50071
541
395
752
108
281
320
200
559
826
226
750
590
153
224
623
567
ggaaggtacctgaaatacacaaaatacgcaggtgatttttctatccttggcatagctgta
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
...................a........................................
...................a........................................
...................a........................................
...................a........................................
...................a........................................
QUERY
XYG46859.b1
XYG52138.b1
XYG59333.b1
XYG53505.b1
XYG65051.g1
XYG31650.g1
XYG12638.g2
XYG43221.b1
XYG61193.b1
XYG37108.b1
XYG34756.g1
XYG34660.g1
XYD5460.g1
XYG24951.b1
XYG67885.b1
XYG17385.b3
XYG14070.b3
50131
601
335
692
168
221
260
140
619
766
166
686
690
650
749
164
563
627
gatctgtcaatggatggaacaaaagttcgaagagcaggaataggactcacaaactgcgg
...............................................t...........
...............................................t...........
...............................................t...........
...............................................t...........
...............................................t...........
...............................................t...........
...............................................t...........
........................a..................................
........................a..................................
........................a..................................
........................a..................................
........................a..................................
..c...........c..g.............a...........................
..c...........c..g.............a...........................
..c...........c..g.............a...........................
..c...........c..g.............a...........................
..c...........c..g.............a...........................
QUERY
XYG46859.b1
XYG52138.b1
XYG59333.b1
XYG53505.b1
XYG65051.g1
XYG31650.g1
XYG20701.g3
XYG12638.g2
XYG43221.b1
XYG61193.b1
XYG37108.b1
XYG34756.g1
XYG34660.g1
XYG24951.b1
XYG17385.b3
50190
660
276
633
227
162
201
30
81
678
707
107
627
631
690
504
agcaactgcattgaaagcaaggaaagccgaagaattccttgagggaaaagaaataaatga
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
........................................................
..........-...........................-...-.............
...................t........................................
...................t........................................
...................t........................................
...................t........................................
...................t........................................
..................c..ag....g..............a.....g.g.........
..................c..ag....g..............a.....g.g.........
50249
719
217
574
286
103
142
84
29
737
648
48
568
572
631
445
QUERY
XYG46859.b1
XYG52138.b1
XYG59333.b1
XYG53505.b1
XYG65051.g1
XYG31650.g1
XYG20701.g3
XYG43221.b1
XYG61193.b1
XYG34756.g1
XYG34660.g1
XYG22734.b2
XYG49572.b1
XYG24951.b1
XYG17385.b3
50250
720
216
573
287
102
141
85
738
647
567
571
808
91
630
444
tgaaaacatcgcaaaggcggccgatttgcttctgaaaataactgatttcgttgatgatga
........c....n..............................................
........c...................................................
........c...................................................
........c...................................................
........c...................................................
........c...................................................
........c...................................................
....................................g.......................
....................................g.......................
....................................g.......................
....................................g.......................
............g.....a......................................c..
............g.....a......................................c..
............g.....a......................................c..
............g.....a......................................c..
50309
779
157
514
346
43
82
144
797
588
508
512
749
150
571
385
25
50130
600
336
693
167
222
261
141
618
767
167
691
649
94
165
564
626
50189
659
277
634
226
163
202
82
677
708
108
628
632
708
691
106
505
685
QUERY
XYG46859.b1
XYG52138.b1
XYG59333.b1
XYG53505.b1
XYG31650.g1
XYG20701.g3
XYG43221.b1
XYG61193.b1
XYG34756.g1
XYG34660.g1
XYG4045.g2
XYG22734.b2
XYG49572.b1
XYG24951.b1
XYG17385.b3
50310
780
156
513
347
81
145
798
587
507
511
79
748
151
570
384
caatggcagcacaaaattcaaagaaaaattattaaaatatctctttaaaaaagccgtaa
...........................................................
...........................................................
...........................................................
...........................................................
...........................................-...............
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
.....................g.........................c...........
.....................g.........................c...........
.....................g.........................c...........
.....................g.........................c...........
QUERY
XYG46859.b1
XYG59333.b1
XYG50722.b1
XYG53505.b1
XYG20701.g3
XYG43221.b1
XYG61193.b1
XYG34756.g1
XYG34660.g1
XYG4045.g2
XYG22734.b2
XYG49572.b1
XYG24951.b1
XYG17385.b3
50369
839
454
905
406
204
857
528
448
452
138
689
210
511
325
agggaatagggggtgtaccgaaatgatagttaacataaaggtaaatggaaaggaat
..........t.............................................
..........t.............................................
..........t.............................................
..........t.............................................
..........t.............................................
........................................................
........................................................
........................................................
........................................................
........................................................
...........................g.......................a....
...........................g.......................a....
...........................g.......................a....
...........................g.......................a....
QUERY
XYG46859.b1
XYG59333.b1
XYG50722.b1
XYG53505.b1
XYG20701.g3
XYG61193.b1
XYG34756.g1
XYG34660.g1
XYG4045.g2
XYG6314.g2
XYG22734.b2
XYG49572.b1
XYG24951.b1
XYG17385.b3
50425
896
398
849
462
260
472
392
396
194
750
633
266
455
269
ataaaaaggacgtggaacccaggacattgcttgctactttcataagagatgatctgagg
..........................................................a
..........................................................a
..........................................................a
..........................................................a
..........................................................a
...........................................................
...........................................................
...........................................................
...........................................................
..................................................
....................................................c......
....................................................c......
....................................................c......
....................................................c......
QUERY
XYG59333.b1
XYG50722.b1
XYG53505.b1
XYG20701.g3
XYG61193.b1
XYG34756.g1
XYG34660.g1
XYG4045.g2
XYG6314.g2
XYG22734.b2
XYG49572.b1
XYG24951.b1
XYG17385.b3
50484
339
790
521
319
413
333
337
253
700
574
325
396
210
cttacaggaacccatataggatgcgatacaacaaactgcggggcatgcagtgtacttatg
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
................................c..............t.c......g...
................................c..............t.c......g...
................................c..............t.c......g...
................................c..............t.c......g...
50543
280
731
580
378
354
274
278
312
641
515
384
337
151
QUERY
XYG46859.b1
XYG59333.b1
XYG50722.b1
XYG53505.b1
XYG20701.g3
50544
1015
279
730
581
379
gatggaaaagcagtaaagtcgtgcaccgtactggctgtgcaggcagatggccatgaaata
............................................................
............................................................
............................................................
............................................................
............................................................
50603
1074
220
671
640
438
26
50368
838
97
455
405
24
203
856
529
449
453
137
690
209
512
326
50424
895
399
850
461
259
912
473
393
397
193
634
265
456
270
50483
954
340
791
520
318
414
334
338
252
701
575
324
397
211
XYG61193.b1
XYG34756.g1
XYG34660.g1
XYG4045.g2
XYG6314.g2
XYG22734.b2
XYG49572.b1
XYG24951.b1
XYG17385.b3
353
273
277
313
640
514
385
336
150
.................a..........................................
.................a..........................................
.................a..........................................
.................a..........................................
.................a..........................................
..c.........................................................
..c....g....................................................
..c....g....................................................
..c....g....................................................
QUERY
XYG59333.b1
XYG50722.b1
XYG53505.b1
XYG20701.g3
XYG61193.b1
XYG34756.g1
XYG34660.g1
XYG4045.g2
XYG6314.g2
XYG22734.b2
XYG49572.b1
XYG24951.b1
XYG17385.b3
50604
219
670
641
439
293
213
217
373
580
454
445
276
90
gagaccatagaaaacgaaagtgatgctgacctgaaaaaaataaaagaaagctttgtt
........................a................................
........................a................................
........................a................................
........................a................................
.........................................................
.........................................................
.........................................................
.........................................................
.........................................................
..a.................c....................................
..a.................c....................................
..a.................c....................................
..a.................c...........................
QUERY
XYG59333.b1
XYG50722.b1
XYG53505.b1
XYG37428.b1
XYG20701.g3
XYG61193.b1
XYG34756.g1
XYG34660.g1
XYG4045.g2
XYG6314.g2
XYG22734.b2
XYG49572.b1
XYG24951.b1
XYG36956.b1
50661
162
613
698
796
496
236
156
160
430
523
397
502
219
757
gaagaaaatggccttcagtgcggattctgcacaccgggaatgataatgacatcact
........................................................
........................................................
........................................................
........................................................
........................................................
........................................................
........................................................
........................................................
........................................................
........................................................
...................................a....................
...................................a....................
...................................a....................
...................................a....................
QUERY
XYG59333.b1
XYG50722.b1
XYG53505.b1
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG20701.g3
XYG61193.b1
XYG34756.g1
XYG34660.g1
XYG4045.g2
XYG6314.g2
XYG22734.b2
XYG49572.b1
XYG24951.b1
XYG36956.b1
50717
106
557
754
737
740
755
552
180
100
104
486
467
341
558
163
701
ttatatgctcaggaagaacaaaaacccgagcgatgactacataaaaacaaacctgggag
...............................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
................................gg.........................
.................................g.........................
.................................g.........................
................................gg.........................
QUERY
XYG50722.b1
XYG53505.b1
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG20701.g3
50776
498
813
678
681
696
611
gaaatctctgcagatgcactggatatgtttcaattattaactccataaagaaagccagtg
................t...........................................
................t...........................................
................t...........................................
................t...........................................
................t...........................................
................t...........................................
27
294
214
218
372
581
455
444
277
91
50660
163
614
697
495
237
157
161
429
524
398
501
220
43
50716
107
558
753
741
551
181
101
105
485
468
342
557
164
702
50775
60
499
812
679
682
697
610
122
42
46
544
409
283
616
105
643
50835
439
872
619
622
637
670
XYG43221.g1
XYG61193.b1
XYG4045.g2
XYG6314.g2
XYG22734.b2
XYG49572.b1
XYG24951.b1
XYG36956.b1
875
121
545
408
282
617
104
642
............................................................
............................................................
............................................................
............................................................
.........................c........c.........................
.........................c........c.........................
.........................c........c......................
.........................c........c.........................
816
62
604
349
223
676
48
583
QUERY
XYG50722.b1
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG43221.g1
XYG4045.g2
XYG6314.g2
XYG22734.b2
XYG49572.b1
XYG36956.b1
50836
438
618
621
636
815
605
348
222
677
582
agaagataaatgaggaaagggtggtggcaaaatgagttatctggagagatttgcaaatgg
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
.a...................................................t......
.a...............g...................................t......
.a...................................................t......
50895
379
559
562
577
756
664
289
163
736
523
QUERY
XYG50722.b1
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG43221.g1
XYG4045.g2
XYG6314.g2
XYG22734.b2
XYG49572.b1
XYG36956.b1
50896
378
558
561
576
755
665
288
162
737
522
caagggcagatacctggacgatataaaccttgatggaatgttatacatgtcacttgtga
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
..................t......g.................................
..................t......g.................................
..................t......g.................................
QUERY
XYG50722.b1
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG6314.g2
XYG43221.g1
50955
319
499
502
517
229
696
gaagcccatatgccagggcaaagataacaaaagtcgagggaggcatgacatcaaaggatt
..........................ca............g...................
..........................ca............g...................
..........................ca............g...................
..........................ca............g...................
............................................................
............................................................
QUERY
XYG50722.b1
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG43221.g1
XYG6314.g2
XYG14794.g1
XYG27674.b1
XYG36956.b1
51015
259
439
442
457
636
169
631
530
403
tgaatgcctactattccatgggtgagaatgaccataaggaacccgttcttgccattgga
...........................................................
...........................................................
...........................................................
...........................................................
...........................................................
................................t..........................
................................t..........................
...........................................................
................................t..........................
QUERY
XYG50722.b1
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG43221.g1
XYG62381.g1
XYG6314.g2
XYG14794.g1
XYG27674.b1
XYG36956.b1
51074
200
380
383
398
577
25
110
572
471
344
gaggtaaactaccagggacaggcaattgccgcagtattcggaaagaaccgttacgagagc
............................................................
............................................................
............................................................
............................................................
............................................................
...........-......t...................c..........
.............................t...................c..........
.............................t...................c..........
.............................t...................c..........
.............................t...................c..........
51133
141
321
324
339
518
71
51
513
412
285
QUERY
XYG50722.b1
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG43221.g1
XYG62381.g1
51134
140
320
323
338
517
72
gaggatttgctttcaaccgtgagtgttgactatgaaccaatggaggctgtatacagcata
............................................................
............................................................
............................................................
............................................................
............................................................
............................................................
51193
81
261
264
279
458
131
28
50954
320
500
503
518
697
723
230
104
795
464
51014
260
440
443
458
170
637
51073
201
381
384
399
578
111
573
472
345
XYG14794.g1 512
XYG27674.b1 411
XYG36956.b1 284
............................................................ 453
............................................................ 352
............................................................ 225
QUERY
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG43221.g1
XYG62381.g1
XYG14794.g1
XYG27674.b1
XYG36956.b1
51194
260
263
278
457
132
452
351
224
gacgatgcaaagaaaaagccccctatatataaggataaaaaagacaatgtgctctcac
..........................................................
..........................................................
..........................................................
..........................................................
....................t..c.........a........................
....................t..c.........a........................
....................t..c.........a........................
....................t..c.........a........................
QUERY
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG43221.g1
XYG62381.g1
XYG14794.g1
XYG27674.b1
XYG36956.b1
51252
202
205
220
399
190
394
293
166
aggaggaagttggtgtgaaattcaatgaaaaagacatagactacgatgtgaaagtgaca
...........................................................
...........................................................
...........................................................
...........................................................
......................t........g..g........................
......................t........g..g........................
......................t........g..g........................
......................t........g..g........................
QUERY
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG43221.g1
XYG62381.g1
XYG14794.g1
XYG27674.b1
XYG36956.b1
51311
143
146
161
340
249
335
234
107
gatacaatactgcttgacagagtttctgccaatcctctagaaacaaggggaattattgcc
............................................................
............................................................
............................................................
............................................................
................................c.....g........a......g.....
................................c.....g........a......g.....
................................c.....g........a......g.....
................................c.....g........
51370
84
87
102
281
308
276
175
61
QUERY
XYG69990.b1
XYG37428.b1
XYG28319.b1
XYG43221.g1
XYG62381.g1
XYG14794.g1
XYG27674.b1
51371
83
86
101
280
309
275
174
gattatcgtgatggcatactcaacgtatatcttccctcacaatccatagtgagggctaaa
................................
........................
...............................................
............................................................
............................................................
............................................................
............................................................
51430
52
63
55
221
368
216
115
51251
203
206
221
400
189
395
294
167
51310
144
147
162
341
248
336
235
108
Supplementary Figure 10 shows the distribution of genes identified in the
Leptospirillum group II and Ferroplasma type II genomes by broad functional category
(COGs). Relative to Ferroplasma, the Leptospirillum group II has a higher incidence of
cell envelope biogenesis, cell motility and secretion, and signal transduction genes and
lower incidence of genes involved in translation, ribosomal structure and biogenesis, and
amino acid transport and metabolism.
29
Supplementary Figure 10: Comparison of COG groups found in the Leptospirillum
group II and Ferroplasma type II genomes.
References
1. Bond, P.L., Banfield, J.F. Design and Performance of rRNA Targeted Oligonucleotide
Probes for in Situ Detection and Phylogenetic Identification of Microorganisms
Inhabiting Acid Mine Drainage Environments. Microb. Ecol. 2, 149-161 (2001)
2. Amann, R.I., Ludwig, W., Schleifer, K.H. Phylogenetic identification and in situ
detection of individual microbial cells without cultivation. Microbiol. Rev. 59, 143–169
(1995)
30
3. Stein, J.L., Marsh, T.L, Wu, K.Y., Shizuya, H., DeLong, E. Characterization of
Uncultivated Prokaryotes: Isolation and Analysis of a 40-Kilobase-Pair Genome
Fragment from a Planktonic Marine Archaeon. J. Bact. 178, 591–599 (1996)
4. Aparicio, S. J. et al. Whole-genome shotgun assembly and analysis of the genome of
Fugu rubripes. Science. 297:1301-10 (2002)
5. Rutherford, K., Parkhill, J., J. Crook, T. Horsnell, P. Rice, M-A. Rajandream and B.
Barrell (2000) Artemis: sequence visualisation and annotation. Bioinformatics 16, 944945.
6. Altschul, S.F., Gish, W., Miller, W., Myers, E.W. & Lipman, D.J. (1990) "Basic local
alignment search tool." J. Mol. Biol. 215, 403-410.
7. Tatusov, R.L., Natale, D.A., Garkavtsev, I.V., Tatusova, T.A., Shankavaram, U.T.,
Rao, B.S., Kiryutin, B., Galperin, M.Y., Fedorova, N.D., Koonin, E.V. The COG
database: new developments in phylogenetic classification of proteins from complete
genomes. Nucleic Acids Res. 29, 22-28 (2001)
8. Lowe, T.M. & Eddy, S.R. tRNAscan-SE: A program for improved detection of transfer
RNA genes in genomic sequence, Nucl. Acids Res., 25, 955-964 (1997)
9. Béjà, O., Koonin, E.V., Aravind, L., Taylor, L.T., Seitz, H., Stein, J.L., Bensen, D.C.,
Feldman, R.A., Swanson, R.V., DeLong, E.F. Comparative genomic analysis of archaeal
genotypic variants in a single population and in two different oceanic provinces. Appl.
Environ. Microbiol. 68, 335-345 (2002)
31
Download
Related flashcards
Epigenetics

15 Cards

Genes

38 Cards

Chromosomes

11 Cards

Create flashcards