1
Supplementary Methods
Linkage analysis and inbred strain genotyping
An initial genome screen for NTN QTLs was performed on 92 F2 animals at the
extreme of the phenotype distribution for crescent formation. Genotypes were
generated from spleen DNA for 128 microsatellites spread across all autosomes and
the X chromosome, using fluorescently labelled primers separated on an ABI 3700
(Applied Biosystems) and scored using Genotyper 2.0 (Applied Biosystems). Animals
at either extremes were treated as affected and unaffected and microsatellite markers
with genotypes showing P < 0.01 on chi square were used to genotype all 177 F2
animals. Around 10% of markers showed heterozygosity in the Lewis parental strain
due to apparent contamination of the Lewis breeding stock. These markers were
discarded from the linkage analysis. Multipoint linkage analysis was carried out with
QTL Cartographer1. Fcgr3 was placed on the genetic linkage map using exon 5
genotypes from the entire F2 cross analysed by Mapmaker QTL2. Genetic variance
attributable to individual QTLs was extracted from multipoint linkage analysis using
Mapmaker QTL. Narrow sense heritability was calculated as the ratio of the genetic to
phenotypic variance.
Fcgr3 exon 5 genotype was determined by PCR and agarose gel electrophoresis on the
following rat strains: SHR (Charles River, UK); ACI, AS (cryo), BDII, BDIX, BDV, BH, BN,
BS, DA, E3, F344, LE, LEW-a2, LOU/C, MNS, MWF, NAR, OM, WC, WF, EXBH, LEWci2, SPRD-Cu3 and SPRD-zi (all donated by H Hedrich, Hannover); SHRSP (by A
Dominiczak, Glasgow); SS rats (by J Rapp, Ohio); and SHR/Kyo, WTC, WKYO, DON, and
2
IS/Kyo (by T Serikawa, Kyoto). The PCR primers used to amplify exon 5 genomic DNA were
5'-GTCCCTAAATTCTGAATTTC-3' and 5'-AAAGAAGTCACAGAAAGGAG-3'.
Reverse Transcription
RT-PCR of Fcgr3-rs exon5_226- was performed with primers 5'CGGCATCCACCAGCTCTCTAGTTGG-3' and5'-CCCAGAGCATCATGTGTCCTGGT-3'
as described3.
Sequencing
Column-purified PCR products were directly sequenced on both strands using BigDye
sequencing kit on an ABI Prism 3700 DNA Sequencer. PCR products were cloned using the
p-GEM-T Easy Vector System II kit (Promega) and extracted DNA from selected clones
sequenced with T7 and SP6 p-GEM primers. Presence of the G129 variant was verified by
direct sequencing and by sequence analysis of cloned cDNA, genomic DNA and gel-purified
PCR products.
Southern Analysis
The probe for the Southern analysis of rat Fcgr3 was created from gel-extracted Fcgr3
exon5_226- amplified from Lewis genomic DNA using primers 5'TGAGTCCAGGACAGCTCCAGAGC-3' and 5'-TGGTGATCCTCCTGCCTCAGCC-3'. The
probe for Southern analysis of human FCGR3A and FCGR3B was amplified from human
genomic DNA using primers 5'-CTGGATTTGCAACCCCATCAT-3' and 5'CCACTACGGCTAATGTTCTA-3' and column purified to yield a 520 bp product from the 3'
untranslated region that was 96% identical between FCGR3A and FCGR3B.
3
Haplotype map
Genotypes and a subsequent haplotype map of the Ntn1 QTL were generated from
genomic DNA of several rat strains (Fig. 3c) for 17 markers spread across the 28 Mbp
region of linkage (D13Rat32, D13Rat129, D13Rat33, D13Rat133, D13Csc1, Fcgr2
(G388T), D13Csc2, D13Csc3, D13Csc4, Fcgr3 intron 4 (CCAA)n, D13Csc5,
D13Mgh8, D13Rat86, D13Rat34, D13Arb15, D13Got87, D13Rat51) Five new
informative microsatellite markers flanking the Fcgr3 gene were identified from the
rat genome sequence (using the Tandem Repeats Finder tool –
http://tandem.bu.edu/trf/trf.html) and designated with the prefix D13Csc. A further
multiallelic microsatellite was identified by inspection of the rat genome sequence
within Fcgr3 intron 4. The multiple peaks observed within the Fcgr3 intron 4
microsatellite always co-segregated according to parental strain in the F2 cross,
supporting the presence of tandem duplication at this locus. PCR primers amplifying
Fcgr3 exon 5 as above were used to identify strains that carried the exon 5 deletion
ΔG129. The Fcgr2 T388G SNP was genotyped by direct sequence analysis of PCR
products amplified from Fcgr2 exon 3. Primer sequences of the genotype assays
developed in-house are given below. Fluorescently labelled microsatellite PCR
products were separated on an ABI 3700 or 3730XL (Applied Biosystems) and scored
using GeneMapper Software v3.7.
Marker
Forward Primer
Reverse Primer
D13Csc1
GACCCCTATGTGCCAACAGT
TCAAGATGTCGGTGCAAGTC
Fcgr2 (G388T)
AGGTTCTTGGGGCTTCCTTC
TGCAGTAAACAGATCCACCC
D13Csc2
AGGGGAAGGAAGGAGAAACA
AGCCGGAGCTGCATAGAGTA
D13Csc3
GTCTCCTGTGCTTGCCTTTC
AGGCAGAACTGCACCTCCTA
D13Csc4
CCGTGCACAAAAGTTCTCAA
ATTATTGCCACCCACATGGT
4
Fcgr3 intron 4
(CCAA)n
GACAGCTCCAGAGCTCTGT
AGGAGCAGATGAATCAGGAA
D13Csc5
GCCCTCTTCTGGAGTGTCTG
AGAAATGCCCATCCATTGAG
Western analysis
Lysis of cells was performed in homogenisation buffer (Tris base 0.1M, TritonX100 1%V/V,
and EDTA 5mM, pH 7.5) with complete mini protease inhibitor cocktail (Roche Applied
Science). Blots were blocked in phosphate buffered saline with 5% dried milk
(Marvel)(PBSM) for one hour at room temperature followed by an overnight incubation at
4ºC with primary antibody in PBSM. Blots were washed twice in phosphate buffered saline in
0.05% Tween-20 (PBST) at room temperature for 5 minutes each, then incubated in
secondary antibody in PBST at room temperature for one hour. Blots were washed four times
at 10 minute intervals with PBST and proteins visualized by chemiluminescence with ECL
Plus Western Blotting Detection Reagents (RPN2132, Amersham) and Hyperfilm ECL
(RNP2103, Amersham) according to manufacturer's instructions. For detection of myc tag the
primary antibody was a 1:1000 dilution of anti-myc 4A6 (05-724, Upstate) and the secondary
was a 1:400 dilution of peroxidase labelled anti-mouse antibody (NA931, Amersham). For
detection of Fcgr3-rs the primary was a 1:1000 dilution of rabbit antiserum raised against the
ten C-terminal amino acids of the predicted cytoplasmic domain of Fcgr3-rs and the
secondary was a 1:20,000 dilution of peroxidase-labelled anti-rabbit antibody (NA934vs,
Amersham).
ADCC by visual assessment
Thioglycollate-elicited peritoneal exudate cells4 were added to 8-well chamber slides (Nunc)
at 104 cells/well and purified by adherence. Macrophages were rested for 24 hours, labelled by
incubation with green fluorescent dye di-octadecyloctacarbocyanine, washed and co-cultured
5
with 103 rat mesangial cells (passage 5) coated with 10g ml-1 of a monoclonal IgG2a
antibody to the mesangial cell antigen Thy1.15, donated by W Bagchus, Groningen. After 48
hours, death of mesangial cells was identified by nuclear morphology following staining with
Hoechst 33258 and propidium iodide (10g ml-1 each). All cells were counted within every
40x objective high-powered field along the diagonal line between opposite corners of each
square well.
Semi-automated calcein release assay of macrophage killing
Thioglycollate-elicited peritoneal exudate cells4(PEC) were harvested. Contaminating RBCs
were removed by brief incubation in hypotonic lysis buffer (Serotec). Cells were then counted
and resuspended in 10% foetal calf serum (FCS), phenol-red free DMEM. PEC and cultured
rat mesangial cells were co-incubated in the presence or absence of anti-Thy1.1 antibody.
5x106 rat mesangial cells (passage 8-12) were trypsinised and re-suspended in 1ml PBS with
1g calcein (calcein–AM, Cat No C3100, Molecular Probes) and incubated at 37oC for
30mins. Cells were washed 3 times with PBS and resuspended in 10% FCS phenol-red free
DMEM with antibiotics (Sigma D5921). In each well of a sterile polystyrene 96-well tissue
culture plates was added: 200l 10% FCS DMEM, 10g ml-1 anti-Thy1.1 antibody; 2x104
calcein-labelled mesangial cells and 2x105 peritoneal exudate cells. The plates were incubated
in 37oC, 5% CO2 and 50l supernatant from each well transferred to fresh 96 well plates for
reading after 16 hours incubation. Fluorescence was measured by a multi-well fluorimeter
(absorption 480nm, emission 535nm).
Creation of Fc Receptor Constructs
Fcer1g was PCR-amplified from WKY spleen cDNA, using the primer pair 5'AAGCTTGCCACCATGATCCCAGCGGT-3'and 5'-
6
TCTAGATTACTATTGGGGTGGTTTC-3', and then cloned into pUSEamp(+)
(Upstate). Fcgr3 and Fcgr3-rs were amplified from Lewis spleen cDNA with forward
primer 5'-AAGCTTGCCACCATGACTTTGGAG-3' and reverse primer 5'TCTAGATTATTAGCCATACGATGGGAT-3'. Clones were re-amplified with
forward primer 5'CGGAAGCTTGCCACCATGGAGCAGAAACTCATCTCTGAAGAGGATCTGAC
TTTGGAGACCCAGATGTTTCAG-3' and reverse primer 5'CCTTGAGCACCTGGATCCATGGGG-3' and recloned. Site-directed mutagenesis
was performed on the Fcgr3 construct for G129 with primers 5'GAGAAATCTTCAAACCTCGGGGAGGACTGGAGGAAATCCC-3' (forward) and
5'-GGGATTTCCTCCAGTCCTCCCCGAGGtTTGAAGATTTCTC-3' (reverse). All
alpha subunit constructs were cloned into the pcDNA3.1/Hygro©(+) expression
vector (Invitrogen; V870-20).
For inserting an N-terminal myc tag into the Fcgr3 constructs, 1.0µg of the Fcgr3,
Fcgr3-rs and Fcgr3-G constructs were amplified with forward primer 5'CGGAAGCTTGCCACCATGGAGCAGAAACTCATCTCTGAAGAGGATCTGAC
TTTGGAGACCCAGATGTTTCAG-3' and reverse primer 5'CCTTGAGCACCTGGATCCATGGGG-3'. Constructs and PCR products were cut
with HindIII and BamHI and ligated to each other.
Transfection
COS-1 cells, a gift from H Davidson, Cambridge, were maintained at 37ºC and 5%
CO2 in DMEM (Invitrogen; 41966-029), supplemented with 10% FCS (Sera
Laboratories International; EU-000-F), 100U ml-1 penicillin, 100µg ml-1 streptomycin,
7
0.25µg ml-1 amphotericin B (Invitrogen; 15240-062). 10µg of Fcer1g construct was
transfected into COS-1 cells using the calcium phosphate method following the
manufacturer’s instructions (BD Biosciences; K2051-1). The cells were maintained
with 700µg ml-1 G418, (Geneticin®, Invitrogen; 11811-064). COS-1 cells stably
expressing Fcer1g construct were then transfected via electroporation with 10µg of
Fcgr3, Fcgr3-rs or the mutagensied Fcgr3 constructs using 260kV and 960µF. Cells
were maintained with 700µg ml-1 G418 and 200µg ml-1 Hygromycin B (Invitrogen;
10687-010). Transfection was confirmed by western blot.
Phagocytosis of sheep red blood cells (SRBCs) by COS-1 transfectants.
COS-1 transfectants were trypsinised, harvested and washed with PBS. In each well
of 8 well chamber slide (LabTek-II®, Nunc cat.no.177402), 2 x 104 COS-1 cells were
diluted in 300l 10% FCS-DMEM with G418 or G418 and hygromycin as appropriate,
and cultured at 37oC for 40 hours. Then, 0.2 ml SRBCs (Rockland, cat. No. R3110050) were incubated with 9 mg anti-SRBC antibody (Rockland, cat. No. 113-4139) at
4 oC for 1 hour. Control SRBCs were incubated with 1% BSA. SRBC were washed
three times with PBS after incubation and diluted in 200l 10% DMEM. 50l SRBCs
were added to the COS-1 transfectants in each chamber well. The supernatant was
removed 30 minutes later. SRBC which were not taken up by RBC were removed by
gentle washing in lysis buffer. The slides were fixed with 4% paraformaldehyde and
stained with Quick Diff solution (Glamidor Technical Services LTD) and internalised
SRBC counted. For co-transfection of Fcgr3 constructs, cells expressing Fcer1g and
Fcgr3 were newly transfected with either Fcgr3 or Fcgr3-rs in a bicistronic expression
vector, pAdKS17, with lipofectamine. Fcgr3 or Fcgr3-rs alpha-chains were driven
8
from a CMV promoter and green fluorescent protein was expressed in a second open
reading frame to confirm transfection efficiency which was >70%.
Surface Expression of Fcgr3 and Fcgr3-rs
COS-1 cells transfected with respectively Fcer1g, Fcer1g and Fcgr3, Fcer1g and
Fcgr3-rs, and Fcer1g and Fcgr3-G were analysed for surface expression of the
receptors. The transfected alpha-chains included a c-myc tag sequence to assess
transfection efficiency. For flow cytometry staining 2x105 COS cells per stain were
incubated with 1:50 anti-myc monoclonal IgG1 antibody (Upstate Cat 05-724) or
isotype controls, in 2%FCS on ice, one hour. For permeabilised controls, 0.25%
saponin was included. Then 1:50 FITC conjugated anti-mouse antibody in 2% FCS,
was added at 4C, one hour. Following washing, the samples were fixed in 1% PFA
and analyzed using a FACScalibur flow cytometer and CellQuest software (Becton
Dickinson, Mountain View).
Quantification of FCGR3B copy number by quantitative real-time PCR (qPCR)
25 l PCRs were carried out using an Opticon 2 real-time PCR System (MJ Research).
PCR conditions were 2 min at 94oC followed by 40 cycles of 15 sec at 94oC, 1 min at
60oC and 1 min at 72 oC. Melting curve analysis and sequence analysis were performed
to check PCR product specificity. Standard curves were created by serial two-fold
dilution of a top standard of 25ng to 0.78ng of a single genomic DNA sample and run
in triplicate. Samples (2.5ng genomic DNA) were run in duplicate. Oligonucleotides
were designed to specifically amplify the FCGR3B gene using primers selective for the
promoter region: 5'-CACCTTGAATCTCATCCCCAGGGTCTTG-3'and 5'CCATCTCTGTCACCTGCCAG-3'). The CD36 gene was used as a single copy
9
control (primers 5'-TAAGTTCAGGTTCCTGGAATGC-3' and 5'CAAATTATGGTATGGACTGTGC-3'). Normalisation to the control gene Forkhead
Box P2 (FOXP2) (primers 5'-TGACATGCCAGCTTATCTGTTT-3' and 5'GAGAAAAGCAATTTTCACAGTCC-3') was used to give an estimate of copy
number6. The reproducibility of the qRT-PCR assay for each sample was calculated by
estimating the within-sample variation measured through the coefficient of variation
(C.V. % = 100*(standard deviation)/mean). Values which lay more than 1.5 times the
inter-quartile range above the third quartile of the C.V. % were treated as outliers and
removed from the dataset.
Logistic regression analysis
To calculate the odds ratio associated with copy number variation at FCGR3B and to test the
hypothesis that other polymorphisms in the FCGR locus are associated with lupus nephritis,
the dataset was fitted with logistic regression models. Age and gender were included as
covariates in all presented logistic regression models. The goodness-of-fit 2 was used to
estimate whether the models adequately fit the data and the Wald test was applied to estimate
the significance (P-value) of each predictor variable.
The simple logistic regression model included only gene copy number at FCGR3B as the
predictor variable, with FCGR3B gene copy number treated as an ordinal variable and lupus
nephritis phenotype as the outcome (Supplementary Table 1A). The sequential logistic
regression (SLR) was carried out to show whether adding data of FRGR2A and FCGR3A
genes improves the model derived from analysis of FCGR3B copy number alone. In the SLR,
genotype data for FCGR2A-G548A, FCGR3A-T559G and gene copy number at FCGR3B
were used as predictor variables with lupus nephritis phenotype as the outcome. Genotypes of
10
FCGR2A and FCGR3A were treated as categorical predictors by grouping the two
homozygous and the heterozygous states into three distinct classes. The reference category
was the most frequent (homozygous) genotype group. Comparison of log likelihood ratios
between sequential models was used to evaluate improvement in the model by addition of new
predictors that could be independently correlated with the outcome.
References
1.
Basten, C. A., Weir, B. S. & Zeng, Z. B. QTL Cartographer User's Manual
(Department of Statistics, North Carolina State University, Raleigh) (1999).
2.
Lincoln, S. E., Daly, M. J. & Lander, E. S. Mapmaker/QTL Users' Manual
(Whitehead Institute for Biomedical Research, Cambridge, Massachussetts)
(1993).
3.
Aitman, T. J. et al. Identification of Cd36 (Fat) as an insulin-resistance gene
causing defective fatty acid and glucose metabolism in hypertensive rats. Nat
Genet 21, 76-83 (1999).
4.
Cook, H. T., Smith, J., Salmon, J. A. & Cattell, V. Functional characteristics
of macrophages in glomerulonephritis in the rat. O2- generation, MHC class II
expression, and eicosanoid synthesis. Am J Pathol 134, 431-437 (1989).
5.
Bagchus, W. M., Donga, J., Rozing, J., Hoedemaeker, P. J. & Bakker, W. W.
The specificity of nephritogenic antibodies. IV. Binding of monoclonal
antithymocyte antibodies to rat kidney. Transplantation 41, 739-745 (1986).
6.
Iafrate, A. J. et al. Detection of large-scale variation in the human genome.
Nat Genet 36, 949-951 (2004).
11