Cyclin gene expression of T.Therm_00526250 during conjugation of the ciliate
Tetrahymena thermophilia
Abstract
Conjugation, the sexual reproduction of ciliate, is a series of meiotic and mitotic
cell divisions, resulting in new micro and macro nuclei. In this process, the cell regulates
nuclear divisions, chromosome fragmentation, genomic rearrangements, and nuclear
destruction. Cyclin proteins have been observed in other organism, as cell cycle
regulators. The focus of this study was to determine the role of the gene,
TTherm_00526250, in the conjugation cycle of Tetrahymena thermophilia. The gene
was named CYC11. From the expression profile, the function of the gene could be
determined. The expression pattern, was obtained from a public data base, and RT-PCR.
Expression was observed from C0 to C8 and at C14, in both expression patterns.
However, the RT-PCR showed expression in vegetative and starvation, while the
database did not. From the expression profiles, it is possible that TTherm_00526250 is
involved in the separation of sister chromatid at the end of meiosis I. Most likely the
cyclin is involved in the breaking down of cohesin, by activating separase. Further
investigation needs to be done, in determining the expression pattern and ultimately gene
function.
Introduction
The ciliate Tetrahymena thermophilia is a well established, eukaryotic model
organism. Because of research done on T. thermophilia, telomerase, telomeres, dynin,
and many other eukaryotic structures and processes have been discovered (Maio et al.,
2009). Ciliates can undergo two types of reproduction. The first, is asexual reproduction
where the genetic information of the ciliate is replicated and the two resulting daughter
cells are genetically identical. The other form of reproduction involves conjugation of
two different Tetrahymena thermophilia. Conjugation takes place in response to stressful
stimuli, such as starvation (Maio et al., 2009). In the first step of conjugation, two
Tetrahymena of different mating types undergo meiosis and exchange haploid nuclei.
The zygotic nucleus of the cells then undergo further divisions, resulting in a macro and
micro nucleus (Liu et al., 2007). The micronucleus remains silent, with very few genes
being expressed. The macronucleus genome is processed and amplified, resulting in a
nucleus capable of transcribing large numbers of mRNA (Won et al., 1998). The next
time the Tetrahymena encounters a stressful situation, the macronucleus is destroyed and
conjugation begins again. This process is shown below in figure 1.
QuickTime™ and a
TIFF (Uncompressed) decompressor
are needed to see this picture.
Figure 1. Stages of conjugation in Tetrahymena
thermophilia. Figure taken from Miao et al., PLoS ONE.
2009; 4(2): e4429.
The process of conjugation relies heavily on regulatory proteins called cyclins.
Cyclins are expressed at different times during the conjugation process (Zhang et al.,
2002). They hold the cell at a specific stage, until they are destroyed. Cyclins act by
binding and activating cyclin dependent kinases. These kinases then phosphorylate
specific proteins, inactivating or activating them. To date, 23 cyclins have been
identified in T. thermophilia (Maio et al., 2009). The hypothesis of this study is, each
cyclin is involved in regulating, distinct steps in the cell cycle. Another aim was to
identify the expression pattern of CYC11, T.Therm_00526250 using RT-PCR. From this,
a possible function of the gene could be determined.
Methods
Cyclin genes were identified at the Tetrahymena Genome Database (www.ciliate.org) by
searching for proteins with the keyword “cyclin”. A BLAST search with a cyclin protein
sequence ensured that all cyclin genes were identified using this method. Microarray
data during conjugation (Miao, et al., PLoS ONE. 2009; 4(2): e4429) were collected for
each gene from the Tetrahymena Gene Expression Database (TGED; tged.ihb.ac.cn).
PCR primers flanking an intron were generated for each gene using Primer3
(frodo.wi.mit.edu/primer3) and ordered from Integrated DNA Technology (Coralville,
IA). Oligo-dT-primed M-MLV reverse transcription (RT; Ambion) was performed on
RNA collected from control cells and from cells at various stages of conjugation using
the Trizol reagent (Invitrogen) according to the manufacturer’s protocol. 1mL of cells
(2.1 x 103 cells/mL) was collected at each time point, pelleted at 6000 rpm, supernatant
was discarded and cells resuspended in 1 mL of Trizol. 180 ng of each template RNA
was used per reverse transcription reaction. cDNA was diluted 1:5 and used as a
template for PCR. PCR was performed in 25 L reactions using GOTaq (Fisher,
Hampton, NH) with 1 L of each primer (10 L ). 15L of completed PCR reaction
products were separated on a 2% agarose gel. DNA bands were visualized using
ethidium bromide and photographed with a Kodak EDAS290 imaging system. Band
intensities were determined using ImageJ (Abramoff, M.D., Magelhaes, P.J., Ram, S.J.
"Image Processing with ImageJ".
Biophotonics International, volume 11, issue 7, pp.
36-42, 2004.)
Results
The cyclin gene TTherm_00526250 was identified at the Tetrahymena Genome
Database. A BLAST search was run to confirm its identification. The PCR primers were
designed using known intron sequences from the Tetrahymena genome public databases
(Figure 2). Microarray data collected from TGED showed expression starting at C0,
peaking at C4, and returning to baseline at C8. There was a small peak at C14 (Figure 3).
The RT-PCR analysis showed expression in both vegetative and starvation periods. It
was also expressed at C0-C2, C4-C7, and C14 (Figure 4). When peak intensities were
quantified, peak expression was observed in vegetative growth (Figure 5).
>TTHERM_00526250(gene)
CACCTTTAATAAATAAAACTTCAAACAAC
ATTTCTTCATAGGAAACTCAGTCATCCAGCTATAAAACAATCAAAAAGAAAATCGTAACCAAATTGAAACTTTCTGCTAGCGGATCTAC
CTAGTACACTGACTCTTCTTAATATAAGAGAAGCGCCAAATTAAGCAAAGCAAAAGATCTCAATAAAAAGATTATTTTTGACGATTATC
CATCTCAGTCATTGGAATTGACTAGGACTCAAATGGATGCGTTTTCTTAAGAAAGTCACATTCCTTCTTAGTTGAGGATATTAGACACT
CAATCATAGAACTTTGGATACTGTCATTCTTAGCTTGATGATGATAATGAAATGAAAGTCAATAATTAATATCAAGCTATTTTAGAAAA
TGAAAATTAATATCAAATGCATCAACATATTTATTAAAACGACGATAATTCTAACAGCTGCGTATTTCAATAGACAAACTATGATTCAA
TTAACATACAATAATACAATTAGAATCTCAATAAAGTAAGTAGAAAGCTTTAAAATGTATAAGACTAGCCAAAAAATATTTCTTAAAGA
GAGATGATTGCTGAGAGTGTCAGCATTTAGTCTCATAACCAATCCAATAACAATGAAAATAATCAAAATTAATTAACTGTTTAGAAAAA
TGAGAGCCATAGCAACGAATGCATGGAATATAATGATGAAAATTAAATGAAAACGAGCTAATAACAAATAAAAAACAATATAAACAGGT
CTGAAAGGGTATTACTTGGAGAAATTACTTAGTAATTAAAGCCTCTTTAAAGTCCATAATTGGAAGAAGAATTTTAATTTAACAATAAT
AACTACTTTTAAAATTAAGAAGAAGAGTAAGGCTTAGCTAATTTCAGAACTTAGTAGAATTAATTTATCTAAGAAGATAATCATGGAAG
TTTATTTTATCCTTGCGATGATGTTAACTTTATTGAAAATGATGAATTTAATTATGATCAATACAACAACCCCTCTTTAATTTATAATC
CTATGGACGACTTAAATAGAAATTGTTTTTAATTCTTCGAAGCTAGCAACAGCTAACAGTTTTAAAAGGAGCAGGCTTAACCTTAGAGG
AAGCTTACAATGAGAGAAATGCTTGATTAATTTAATCAAGAAGACACATTTAGCTTCGATGATTAAGACCTATAGAATTTTGAAATCAG
ATAGAGCGATTACATCGTTGATCCTTAAAGTCTTTAAAACTACAACAGTAATTTCACTAACTTTGCTAAAAAAAGAGCAATCCTCATTG
ACTGGATGCAAGAAGTTAGCACTGGCTTCTCTTTCAAAAGGGAGACTTATTAGTAGTCGATTTCGATTATTGATAGATACTTTGAAAGG
GTTCAATAAGTTCCTAAAAACCAGCTTTAATTAGTAGGAGCAACTGCGCTTTTGATCGCTCATAAAATAGAAgtaaataatttaagaaa
atattaattcgctaattcattcaataagattttataattgaatttgcattttacaaatttaaaaattaaatctaaatataaatttaata
acaaacaagcaaacaaacaaacaaataatgtgtttgtttatttatttaattgatttgattgcttcaaaaatttaatttaattttagaaa
ttaaaaatttaatattcaaaaatctctttttaatattgatttgatttttacccactttactaacgtaaactgataaatttgataatccc
aaattacattttaaggaaaatttggtaagatatttatttaatgtaaatctttgattaaattaagGAAGTAATATGTAAGAAGAACGAAG
AGTTCATCACTATATGCAATGGTGGATATACAAACAGCTAATTTATATAGATGGAAATTGACATTTGCTTAGTAAGTTACCAACTAAAA
TAATAAATAAATATTAAGTTATTCATTTTTATAAAATAGAAATTGAAATTCGAATTAAATACTCCTACCCCTTACTTTATAATGAATTA
GTTAATGCTGAGGTGGGATGGGCTTGTGGAGTAGTACAAAGAATTATTTGACAACGACATAATATTCTTTAAAAAAAATAACTAAAAGT
CTTTCCTTCTCTTCTCTAAGGTGTGCTAATATATTGACTGTTCTTACTATAACATATACATCTACAATTATCCTATAAAATACGTTATA
GCCTTATTCATGTATTCAACCTTATGTGGAAGCCTTATACAAAATAGAGATATTGATGTCAAATTAAGCCACCTAAATTAATTATTCGA
TCATTTTATTTAAAACACTTTAAACTTAGAGTCTTGCAGTGACTTATAAAACGTAAAATTATTTACAGACTAATTCATGGACCTAAATA
TTTGCGATAAGgtacccataacaaattaatatatcaacaggcaggatgataaaatatatgtaattttattcttgaaatgataaaaaatc
taaattttctaatcaatattttaaacaaaaatagGAAAGCTATGAAAATGTTTGCAGTCAACAATTATATAATAGAGATTTTAAAAGAC
TCTTCGGTATTGGAGATTGA
TCAATCTCCAATACCGAAGAG
Figure 2: The template genomic DNA sequence for cyclin gene
T.Therm_00526250.
Red = intron; yellow = PCR primers
flanking the large intron that were used in RT-PCR
analysis.
QuickTime™ and a
decompressor
are needed to see this picture.
Figure 3: Microarray expression profile from TGED for
cyclin gene TTherm_00526250. L = vegetative log phase
growth; S = starvation at 0, 3, 6, 9, 12, 15, and 24 hours;
C = conjugation at 0, 2, 4, 6,8, 10, 12, 14, 16, and 18
hours post-mixing.
V
S
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
QuickTime™ and a
decompressor
are needed to see this picture.
Figure 4: RT-PCR analysis: Lane 1 = DNA MW marker; lane 2 =
CU428 genomic DNA template (contains intron); lanes 3,4 =
CU427 and CU428 vegetative log phase growth; lanes 5,6 =
CU427 and CU428 starved for 24 hours; lanes 7-24 =
conjugation at hours 0-18 post-mixing.
6000
Arbitrary Units of Intensity
5000
4000
3000
2000
1000
0
427V428V427S 428S C0
C1
C2
C3
C4
C5
C6
C7
C8
C9 C10 C11 C12 C13 C14 C15 C16 C17 C18
RNA Collection Time Points
Figure 5: Quantification of band intensities from RT-PCR
analysis for cyclin gene T.Therm_00526250 determined by
ImageJ. .
Discussion
The primary goal of this experiment was to determine the expression pattern from
CYC11, TTherm_00526250. RT-PCR analysis showed expression during vegetative and
starvation phases, as well as early in conjugation. The results obtained, did not agree
with the microarray expression obtained from TGED. The microarray data showed
baseline expression in vegetative and starvation periods. This expression pattern was not
seen in the RT-PCR, where expression was observed during both periods. However,
some similarities were seen. Both assays showed expression from C0 to C8, small
expression at C14. An unexpected result in the RT-PCR was any gene expression at C4.
The RNA was incorrectly collected at C4, so there should have been no expression
observed. It is possible that gel was incorrectly loaded, with C3 and C4 being reversed.
While the two sets of expression data do not completely agree, a guess at the gene
function can be made from where the two expressions agreed.
Because both assays show expression at the beginning of C0, the cyclin is active
during conjugation, suggesting it is a mitotic cyclin. From the TGED microarray, peak
expression occurs at C4. At C4 the two conjugating cells have just completed Meiosis I,
and are entering Meiosis II (Maio et al., 2009). In Meiosis I, the micronuclei of the
Tetrahymena double their genetic material and pair sister chromatid (Zhang et al., 1999).
These sister chromatid are held bonded together by cohesin. Cohesin is then broken apart
to allow the separation of the sister chromatid. This separation is mediated by the
anaphase promoting complex/cyclosome (APC/C). The APC/C leads to the activation of
separase, by ubiquitinating its inhibitor, securin (Li et al. 2009). The gene
TTherm_00526250, could be involved in this process.
Further investigation is need, in order to determine function. RNA should be recollected from conjugating T. thermophilia, and a new RT-PCR should be run. A
Northern blot assay should also be run, looking at RNA expression. After the expression
pattern is well understood, further experiments should be run to determine the function of
the gene.
References
Abramoff, M.D., Magelhaes, P.J., Ram, S.J. "Image Processing with
ImageJ".
Biophotonics International, volume 11, issue 7, pp. 36-42, 2004.
Li, M., and Zhang, P. (2009). The function of APC/CCdh1 in cell cycle and beyond. Cell
Division. 4:2.
Liu, X.Y., Lee, K.L., Mao, Y.Z., Liu, T., and Jin, L.P. (2007). Differential gene
expression during stationary phase between amicronucleates and micronucleates
of the ciliated protist, Pseudourostyla cristata. Current Genetics 8:401-11.
Miao, W., Xiong, J., Bowen, J., Wang, W., Liu, Y., Braguinets, O., Grigull, J., Pearlman,
R.E., Orias, E., and Gorovsky, M.A. (2009). Microarray analyses of gene
expression during the Tetrahymena thermophila life cycle. PLoS ONE 4: e4429.
Won, K.A., Schumacher, R.J., Farr, G.W., Horwich, A.L., and Reed, S.I. (1998).
Maturation of human cyclin E requires the function of eukaryotic chaperonin
CCT. Molecular and cellular biology 18:7584-9.
Zhang, H., Adl, S.M., and Berger, J.D. (1999). Two distinct classes of mitotic cyclin
homologues, Cyc1 and Cyc2, are involved in cell cycle regulation in the ciliate
Paramecium tetraurelia. Journal of Eukaryotic Microbiology 46:585-96.