Cyclin gene expression of CYC4 during conjugation of the ciliate Tetrahymena thermophilia
ABSTRACT
Conjugation, the sexual stage of the ciliate cell cycle, follows a unique series of meiotic and
mitotic events that involve nuclear divisions, chromosome fragmentation, genomic rearrangements, and
nuclear destruction. It is known that cyclin proteins monitor similar cellular events in other model
systems. However, few studies have focused on the involvement of cyclins in the regulation of the
distinct steps of conjugation. The purpose of this study was to determine the role of cyclin gene
T.Therm_00189230 (renamed as CYC4) of the ciliate Tetrahymena thermophilia in the regulation of
conjugation. To investigate the putative function of the cyclin gene, the expression profile of the gene in
T. thermophilia was collected from public databases and complemented with RT-PCR analysis. The
expression pattern of the cyclin gene demonstrated that the gene was not transcribed at high enough
amounts to be detected in the study. It is believed that the primers used included a cryptic intron
sequence not detected by the public Tetrahymena genome databases. Further investigation needs to be
done in order to determine with confidence the putative function of this cyclin gene.
INTRODUCTION
Tetrahymena thermophilia, a ciliated protozoan, is a well-established eukaryotic model organism
that has been used to study basic cellular mechanisms and has facilitated important eukaryotic
discoveries such as dynein, telomeres, telomerase, and catalytic RNA (ribozymes) (Maio et al., 2009).
However, one of the most important features of T. thermophilia is its nuclear dimorphism (Lui et al.,
2007). Each cell of the ciliate has two distinct nuclei, the micronucleus (MIC) and macronucleus (MAC).
The MIC is the germline nucleus and participates in conjugation, the sexual stage of the ciliate life cycle.
The MAC is the somatic nucleus and participates in amitosis, the asexual stage of the ciliate life cycle
(Won et al., 1998).
Conjugation is induced in T. thermophilia under stressful conditions (Maio et al., 2009).
Conjugation proceeds when two cells of different mating types are mixed during starvation. The cell
types pair, undergo meiosis, and exchange haploid nuclei. The zygotic nucleus participates in further
divisions, ultimately producing a silent MIC and active MAC. During the zygotic nucleus divisions, the
MAC genome undergoes a series of rearrangements and amplifications that allows it to develop into a
transcriptional machine. The MIC becomes silent. An intensive study by Maio et al. (2009) describes the
events of conjugation in detail (Figure 1).
QuickTime™ and a
TIFF (Uncompressed) decompressor
are needed to see this picture.
Figure 1. Stages of conjugation in Tetrahymena thermophilia. Figure taken from Miao et al., PLoS ONE. 2009; 4(2):
e4429.
Conjugation and other stages of the cell cycle are tightly regulated by cyclins (Zhang et al.,
2002). Cyclins are proteins that are expressed at specific points within the cell cycle that must be
destroyed in order for the cell to continue its progression through the cell cycle. Cyclins regulate the
progression of cells through the cell cycle by binding and activating cyclin-dependent kinases (CDKs).
There are three types of cyclin-CDKs: G1, S-phase, and mitotic. G1 cyclin CDKs activate transcription
factors that activate genes for DNA polymerase, dNTP synthesis, and S-phase cyclins. S-phase cyclin
CDKs phosphorylate and activate pre-replication complexes so that DNA polymerase in G1 can recognize
the complexes and begin replication. Mitotic cyclin CDKs activate proteins involved in the processes of
nuclear condensation, nuclear envelope fragmentation, and spindle formation.
Two cyclins are expressed for each stage of the cell cycle (e.g. G1, S-phase, mitosis), which
serve as pre- and post-checkpoints (Zhang et al., 1999). Overall, 23 cyclin genes have been identified in
T. thermophilia (Maio et al., 2009). It was hypothesized that each of these cyclin genes was involved in
the regulation of the distinct steps of conjugation. Additionally, the objective of this study was to
determine the expression pattern for the T. thermophilia cyclin gene T.Therm_00189230 (renamed as
CYC4) during conjugation. It was predicted that the cyclin gene would be expressed throughout different
time points of conjugation, and by integrating the expression profile of the gene with RT-PCR analysis, a
putative function of the gene could be determined.
METHODS
The cyclin gene was identified at the Tetrahymena Genome Database (www.ciliate.org) by
searching for proteins with the keyword “cyclin.” A BLAST search with a cyclin protein sequence ensured
that the cyclin gene was identified using this method. Microarray data during conjugation (Miao et al.,
2009) was collected for the gene from the Tetrahymena Gene Expression Database (TGED;
http://tged.ihb.ac.cn). PCR primers (Forward: 5’-TGGATTGCCAAGAGGTAGAAG-3’; Reverse: 5’AGGTGAGTGTGCAAACGAGA-3’) flanking an intron were generated for the gene using Primer3 (Steve
Rozen and Helen J. Skaletsky 2000) and ordered from Integrated DNA Technology (Coralville, IA). OligodT-primed M-MLV reverse transcription (RT; Ambion) was performed on RNA collected from control cells
and from cells at various stages of conjugation using the Trizol reagent (Invitrogen) according to the
manufacturer’s protocol. 1 mL of cells (2.1 x 103 cells/mL) was collected at each time point, pelleted at
6k rpm, supernatant discarded, and cells resuspended in 1 mL of Trizol. 180 ng of each template RNA
was used per reverse transcription reaction. cDNA was diluted 1:5 and used as a template for PCR. PCR
was performed in 25 uL reactions using GOTaq (Fisher, Hampton, NH) with 1 uL of each primer (10 uM).
15 uL of completed PCR reaction products were separated on a 2% agarose gel. DNA bands were
visualized using ethidium bromide and photographed with a Kodak EDAS290 imaging system. Band
intensities were determined using ImageJ (Abramoff, M.D. et al., 2004).
RESULTS
Cyclin gene T.Therm_00189230 was successfully identified at the Tetrahymena Genome
Database and a BLAST search with the cyclin protein sequence confirmed its identification (Figure 1).
Using known intron sequences identified by Tetrahymena genome public databases, PCR primers flanking
a large intron were successfully designed, resulting in an expected 888 bp product size.
Microarray data during conjugation collected from TGED demonstrated that the cyclin gene was
most actively transcribed at conjugation hours 4 and 13 post-mixing (Figure 2). Additionally, the cyclin
gene was least actively transcribed at conjugation hour 0 and between conjugation hours 6 and 10 postmixing. However, RT-PCR analysis failed even though the primers amplified well from the template
genomic DNA (Figure 3). Quantified band intensities from the RT-PCR gel further demonstrated that the
primers failed to amplify actively transcribed mRNA during the various time points during conjugation
(Figure 4). Only the template genomic DNA band exhibited high enough transcription levels to be
quantified.
T.THERM_00189230 (gene)
ATGATGTCAACTTTTTAAAAATAGAATTCCTCCCAATATTAAGCTTAGgtaaaatagttttttttattcaagattattaagattattttctttttat
caagatccatattcaataaataaaaacatgatacaaaaaaaaatagtttgtgatcaaaatctttctatccagttgtttctccttctcaaaatgcatt
ttattaatcattctttatttaacccataattagATTAACAACAACTTAATTGTCGAAGAGTACAATTTCATCAATGATTTCACTTAAGATGCTAGTC
GTGGAATCCATTCATAGAATGATTTCAATGCCTAAAATTTATAAAACCCTCTTAGCAATAGATAAAAGCCTGCTACTTCTATGTCCATGATTGATGA
AAATTCAAATACTATTCCTTTTTTTTAAAAGAGACATTCAATGAAGAGCACCTATTGTAACTAAAATGACTTAATTTTTTAAAATAAAATGAATTAT
TCATAAAGAATGCCTTTTGAAGAAGTTGTTTCGTTACAACCCTAATAAATAATTTACTCTTAAAAGTCAGTAGCTTGTGAAGATTAGCAAAATATGA
AGTAAAGTGTTAAATTTCCTGCTTAAGTTGGCTAAAACTAATAACAGAGCAGCACTTTAAACAATTACTCAAACGACCTATCTCCTATAGACATGAC
ATTTTAGTAAATAAGCACTTAAAGTAGCTCTCCTGATTTCGATTTAGCAGTCATTAAAAATCCCTCCTCATCTTAAAACGTAAACATAAGCAATAAG
TCTAGTTCTTTTGTTGGGTCTGGGTCTATTAGCGGAATGAGCAGCTTTAAATAAATGAGTAACAACTAATAAAAAAGCATGAATTAATCTTCATAAT
AATAAGCAATTGCCAAAGAATATAAAAATTACTCTTAAAGTGGAAATAGCATGTAGGAGCTAAGTTCTGTTAGCACTAGAGTTAACAGCTATAGTAC
AAATGCAAGCTCTGGATTAAATAAAAATAAATCTAGCAACTACACATTCTAAGAAGAGTAAGATGAGAATTCATAAGTCTGCAGCAATATTTTAATA
GATTAGATGGATTGCCAAGAGGTAGAAGATTTCAGTCTTTATATCTAAGAGTATGAAAAGTAAAATGCAAACTCTAGCTAAGAACAATAGAGAAAAT
AGGCAATTTCCTAAGAAGATATTTATTAAGAGTAACTTTTTGGTGGTAATCCTCAATACGTTCCTAAGTACGGCTACTAAATAGTCTAACACCTCTT
CAAACAACAGgtaattacttattaaattatttctatctattgttattgaaagtcctaaagattttcaaagattaaggataaaaatatttctaaaata
ataagaatttgaaatagaaataatcttgcaaaaatggcttcaaaaagcaatttaaaattgagttattcaatatattccttgttccgttttcaagttt
ttaaagtaaataaatggaaaaatatgtgatagataaattatgatttttatccgctattttttttttaaattatttgattaaaacccatagaaataat
taattttcaacaaattttttgccaaattttcttaattaaaaccaaaataatatcaatcaaataaattaaagagttaaattataacttaaagaaaatc
tttaaactatcctttatttacaataaaaaaaatattactataattgatacctagatagataggtacatgttttattaaaattttgcatcattatttt
tctaatttttctcaagattaaaataaaagaaaaatgaaaaatttgaaattcattaaattttgcgcttaattttactttaaatttatcttgcatttat
taatattttaattttaaaaataaatagAGAAACTATAAAATAACTGTAATCACTGATCCTAGAGAATTAATTATTAGAGAAAATCTAATTGATTTAA
TGTCTCGTTTGCACACTCACCTTAAGTTGCAAGAAGAAACACTTTATCTTGCTGTAAATATTTTCGCCAGATACTTAGACGTCTAAAAACAAAACTA
CTAAAACTAAAAAATTGTAACTCTAGTTGCAACTTGTCTCTTCATAGCTGCTAAATACTAAGAAATTTATCCTCCTCCTCTTCGTGATTTTTTACAT
GTCCTTAAACTCAATAAAATCCAAGCTAATACTTCTGATATATGTGATTTAGAAGGAAGCATTCTCAATAAATTAAACTTTTCTCTCTTCGGTCCTA
CTCGTTTACAATTCCTTGAAGCTTATTTCTCTTAAATTACTCTAGACCCATCTCAAGTCAGCTTTTGCTATTATTTACTTGAACTAACAAACTTAAA
CCACTCCTTCTACAAATATGACCACAGTGAAATTGCTGCTGCATGCATACTTTTAAGTGAAAAATTCAAAAATATTTCTGGCAAATATTTTTGGAGT
GAAAAATTAGAACTAATTACAAACTATAAATAATAAGATGTTTATGACTGCGTTGAAGAGCTTTATTAGTACTTAGTTAATGTAGGACACAACAGGA
AAAAATTATTTATTTACTCCAAATATTCTGAACAAAAATACAAATCTGTTGCTTTGATTGATTATGACCTCACTCACAATGTTAATAACTAAACCAA
CTAAGAAAGCACTTAAGATGGATTTTACATTTCTACTTCTAATAATCAAAAAAGTGAGAATAACTACTCATAGTAATAAAAAATTTACACAAATAAG
TAAATGACACAATCCTAATAACTATCTTAGTCTTGCAATTAAGGCTATAACAGTAGCATGACTTAATCAACCTATAACATGACTTATTCATAAAATA
GTTAGAACTACGATTCATAACAGATACAAGAGTAACAATATTATTCTAAATAAATGTCTTAATAAAACAATTAAATTGCTTACTCTAAATGCAAATC
TGAATGCTATGCTGAGGAATATGACGAAAACTCTGTTAGCTTTCATTCTTAAGCCAGATAAAATTAACCAAATTTCAAATATGACATTACAAAATAC
TCAAAAATTTACTGA
Figure 1. The template genomic DNA sequence for cyclin gene T.Therm_00189230. Red = intron;
yellow = PCR primers flanking the large intron that were used in RT-PCR analysis.
QuickTime™ and a
TIFF (Uncompressed) decompressor
are needed to see this picture.
Figure 2. Microarray expression profile from TGED for cyclin gene T.Therm_00189230. L =
vegetative log phase growth; S = starvation at 0, 3, 6, 9, 12, 15, and 24 hours; C = conjugation at
0, 2, 4, 6,8, 10, 12, 14, 16, and 18 hours post-mixing.
V
S
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18
QuickTime™ and a
TIFF (Uncompressed) decompressor
are needed to see this picture.
QuickTime™ and a
TIFF (Uncompressed) decompressor
are needed to see this picture.
Figure 3. RT-PCR analysis: Lane 1 = DNA MW marker; lane 2 = CU428 genomic DNA template
(contains intron); lanes 3,4 = CU427 and CU428 vegetative log phase growth; lanes 5,6 = CU427 and
CU428 starved for 24 hours; lanes 7-24 = conjugation at hours 0-18 post-mixing. RNA concentrations
were standardized using Nanodrop prior to RT-PCR.
Quantification of Band Intensities from RT-PCR Analysis for cyclin gene
T.Therm_00189230
1
0.9
Arbitrary Intensity Units
0.8
0.7
0.6
0.5
0.4
0.3
0.2
0.1
C1
8
C1
7
C1
6
C1
5
C1
4
C1
3
C1
2
C1
1
C9
C1
0
C8
C7
C6
C5
C4
C3
C2
C1
C0
42
8S
42
7S
42
8V
42
7V
0
RNA Collection Time Points
Figure 4. Quantification of band intensities from RT-PCR analysis for cyclin gene T.Therm_00189230
determined by ImageJ. .
DISCUSSION
The expression pattern of the cyclin gene T.Therm_00189230 during conjugation was
investigated in this study. RT-PCR analysis revealed that although the primers amplified well
from the genomic DNA template, the primers failed to amplify the cDNA expressed at the
collection time points during conjugation to high enough levels to be detected in this study.
This most likely suggests that the primers designed included a cryptic intron sequence not
identified by the public genome-sequencing databases. New primer sets should designed in
order to test the transcription levels of the cyclin gene throughout various time points during
conjugation.
By integrating the expression profile and RT-PCR analysis with other studies detailing
the cellular events of conjugation, it is possible to determine the putative function of this cyclin
gene. According to its expression profile from TGED, cyclin gene T.Therm_00189230 is most
highly expressed around the fourth and thirteenth hours of conjugation. Conjugation hours 3.54 and 13 are defined by chromosome pairing and the completion of meiosis I and
exconjugation, respectively (Maio et al., 2009). During these phases of conjugation, genomewide DNA rearrangement is a common phenomenon. In meiosis I, synapsis and crossing over
occur in the micronucleus (MIC), in which homologous chromosomes pair and exchange genetic
information (Zhang et al., 1999). These processes are important in the development of the
zygotic MIC. The latter half of conjugation (hours 10-14) is characterized by the destruction of
the old macronucleus (MAC) and the development of the new MAC (Maio et al., 2009).
Genome rearrangement is a crucial event for reorganizing the new MAC for efficient replication
and transcription. Common programmed genome rearrangements include chromosome
fragmentation, elimination of centromeres and repetitive DNA, ribosomal gene amplification,
and the excision of “internal elimination sequences” (IESs) (Ehrenfeucht et al., 2007).
Because cyclin gene T.Therm_00189230 is highly expressed during two different events
in the conjugation cycle where programmed genome-wide DNA rearrangement is possible, it is
plausible that this gene is involved in the regulatory mechanism behind this phenomenon.
Precisely, it is most likely this cyclin gene regulates crossing over and chromosome
fragmentation. Crossing over and chromosome fragmentation require the recruitment of
proteins that mediate the transfer of genetic information (Hamiliton et al., 2006). Proteins are
needed for the translocation of DNA and the hydrolysis of phosphodiester bonds during crossing
over and chromosome fragmentation, respectively. Since the proteins that perform these
processes share similar functions, it is possible the same mechanism of regulation is used.
Therefore, cyclin gene T.Therm_00189230 could control and recruit the proteins necessary for
this mechanism of genome rearrangement.
However, further investigation needs to be completed in order to confidently determine
the putative function of this gene. Further research should focus on the expression pattern of
the cyclin gene during conjugation using newly designed primers for RT-PCR analysis and be
accompanied by Northern blot analysis. Once the expression profile is complemented with
successful RT-PCR analysis, more advanced experiments can be performed in order to elucidate
the putative function of the cyclin gene.
WORKS CITED
Abramoff, M.D., Magelhaes, P.J., and Ram, S.J. (2004). Image Processing with ImageJ.
Biophotonics International 11:36-42.
Ehrenfeucht, A., Prescott, D.M., and Rozenberg, G. (2007). A model for the origin of internal
eliminated segments (IESs) and gene rearrangement in stichotrichous ciliates. Journal
of Theoretical Biology 244:108-14.
Hamilton, E.P., Williamson, S., Dunn, S., Merriam, V., Lin, C., Vong, L., Russell-Colantonio, J.,
and Orias, E. (2006). The highly conserved family of Tetrahymena thermophila
chromosome breakage elements contains an invariant 10-base-pair core. Eukaryotic Cell
5:771-80.
Liu, X.Y., Lee, K.L., Mao, Y.Z., Liu, T., and Jin, L.P. (2007). Differential gene expression during
stationary phase between amicronucleates and micronucleates of the ciliated protist,
Pseudourostyla cristata. Current Genetics 8:401-11.
Miao, W., Xiong, J., Bowen, J., Wang, W., Liu, Y., Braguinets, O., Grigull, J., Pearlman, R.E.,
Orias, E., and Gorovsky, M.A. (2009). Microarray analyses of gene expression during
the Tetrahymena thermophila life cycle. PLoS ONE 4: e4429.
Won, K.A., Schumacher, R.J., Farr, G.W., Horwich, A.L., and Reed, S.I. (1998). Maturation of
human cyclin E requires the function of eukaryotic chaperonin CCT. Molecular and
cellular biology 18:7584-9.
Zhang, H., Huang, X., Tang, L., Zhang, Q.J., Frankel, J., and Berger, J.D. (2002). A cyclindependent protein kinase homologue associated with the basal body domains in the
ciliate Tetrahymena thermophila. Biochimica et Biophysica Acta 1591:119-128.
Zhang, H., Adl, S.M., and Berger, J.D. (1999). Two distinct classes of mitotic cyclin
homologues, Cyc1 and Cyc2, are involved in cell cycle regulation in the ciliate
Paramecium tetraurelia. Journal of Eukaryotic Microbiology 46:585-96.