Gene Expression of TTHERM_00433390 During Cell Conjugation in Tetrahymena thermophila
Andrew Ruddy
December 7, 2009
BIO 464 Fall 2009
Bradley University Department of Biology
Abstract
During conjugation of Tetrahymena the cell follows a unique series of meiotic and mitotic nuclear
divisions that closely resemble the events that occur in eukaryotic cells. Cyclin genes when expressed
are used to drive the cell cycle events in eukaryotes through use of cyclin dependent kinases. Data was
collected through use of RT_PCR on the expression of TTHERM_00433390, a possible cyclin gene, found
in the genome of Tetrahymena thermophila. TTHERM_00433390 was named Cyc10. Public databases
were also used to obtain microarray data on TTHERM_00433390 for comparison. After performing the
RT_PCR, it was found that there was little comparison of the data to the obtained microarray. In the
microarray data the expression of TTHERM_00433390 reached peaks at hours two and six. The RT_PCR
data showed a fairly constant over expressed profile. Because of the great difference it is difficult to
create a hypothesis on TTHERM_00433390’s function until further testing is completed.
Introduction
Tetrahymena thermophila is a common freshwater ciliate protozoa that is used as a model organism in
biomedical research. Tetrahymena’s most powerful feature is the fact that it has nuclear dimorphism
(1). This dimorphism allows Tetrahymena to posses two different forms of its nuclear genome. The
micronucleus (MIC) is area in which genetic information that will be passed on through conjugation is
stored. The macronucleus (MAC) serves as Tetrahymena’s somatic nucleus in which the MAC is actively
transcribed and determines a cells phenotype (2).
In response to stressful conditions, starvation, conjugation will occur in Tetrahymena’s different mating
cell types. It has been found that the nuclear events occurring during conjugation in Tetrahymena are
similar to the events that occur during meiosis in eukaryotes (3). The events of conjugation also occur
fairly quickly, usually in a range of about 14 hours. Figure 1 shows the basic outline of the conjugation
cycle of Tetrahymena.
Figure 1. Events in the Tetrahymena thermophila conjugation cycle. Taken from Miao, et al., PLoS ONE.
2009; 4(2): e4429.
At the beginning of conjugation, hours 1-6, the two different mating type cells undergo meiosis and
through use of a pilius, the haploid nuclei are exchanged. The exchanged nuclei undergo further
division, usually between hours 6-8, and as a result a new MAC and MIC are created. Following
conjugation the cell will search for a new mate in order to transfer its genomic DNA. When a new mate
is found the MAC of the cell is destroyed allowing conjugation to begin and the MIC undergoes meiosis
in preparation for haploid exchange. If Tetrahymena cells are no longer starved, conjugation will come
to a halt and the cells will undergo mitosis.
The ability for the cells to undergo mitosis and meiosis is due to the regulation of cyclin proteins. Cyclin
proteins bind to a corresponding Cyclin-dependent Kinase (CDK) and controls the activation of hundreds
of proteins used in the cell cycle. CDK perform this task by phosphorylating select regions of proteins
which in turn activates or inactivates the targeted protein. During the cell cycle the CDKs are grouped
into one of three classes: G1 Cyclin-CDKs, S-phase Cyclin-CDKs and Mitotic Cyclin- CDKs. The G1 CyclinCDKs serve as a control that moves the cell into the S-phase. These CDKs are used to phosphorylate and
thereby activate the many genes used in chromosomal replication. S-phase CDKs become active due to
a phosphate being applied from a G1 Cyclin-CDK. Once activated the S-phase CDKs interact with
complexes located on DNA’s origin of replication. Once the origin of replication is phosphorylated,
replication is triggered which signals the start of S-phase. The last group of CDKs, Mitotic Cyclin-CDKs,
creates interactions with hundreds of different proteins to promote chromosomal condensation,
formation of the microtubules, and the other essential parts needed for M phase completion. The
activation of each type of CDK creates a checkpoint within the cell cycle. In order for the cell to move
onto the next stage of the cycle the current CDK and must complete all of its required tasks and be
degraded before the next stages CDK is produced.
For this study 15 possible cyclin genes in the organism Tetrahymena thermophila were selected and
their expression profiles were obtained. The determined expression profiles were then compared to
predicted expression patterns that were obtained from microarray data.
Methods
Cyclin genes were identified at the Tetrahymena Genome Database (www.ciliate.org) by searching for
proteins with the keyword “cyclin”. A BLAST search with a cyclin protein sequence ensured that all
cyclin genes were identified using this method. Microarray data during conjugation (2) were collected
for each gene from the Tetrahymena Gene Expression Database (TGED; http://tged.ihb.ac.cn). PCR
primers flanking an intron were generated for each gene using Primer3 (4) and ordered from Integrated
DNA Technology (Coralville, IA). Oligo-dT-primed M-MLV reverse transcription (RT; Ambion) was
performed on RNA collected from control cells and from cells at various stages of conjugation using the
Trizol reagent (Invitrogen) according to the manufacturer’s protocol. 1 mL of cells (2.1 x 103 cells/mL)
were collected at each time point, pelleted at 6k rpm, supernatant discarded, and cells resuspended in 1
mL of Trizol. 180 ng of each template RNA was used per reverse transcription reaction. cDNA was
diluted 1:5 and used as a template for PCR. PCR was performed in 25 uL reactions using GOTaq (Fisher,
Hampton, NH) with 1 uL of each primer (10 uM). 15 uL of completed PCR reaction products were
separated on a 2% agarose gel. DNA bands were visualized using ethidium bromide and photographed
with a Kodak EDAS290 imaging system. Band intensities were determined using ImageJ (5).
Results
Bioinformatics
>TTHERM_00433390(gene)
ATGTTTTAAAATACAAATTTCAACTGCAATCAGGAAGGTTAAAGTTAGAGAATTAATTCGAATGTCTAGG
GCTCAAGTGGTAAAGAGAGGAGATAACAGAACTAATCACAGAAGATGAACAATTAATAAAAAAATGAGTA
GAGAAGCAAGTAAAAAAATAGACGTAGCAGTAGAAAATCTTAGAGTAAGAATTCAAATAATAATGCTACA
TAGATAGAATAGCAAAACTAGTAATAAGAATTGATAAATAACTAAAGAGTAGAGAGCGCTTAAAATTCCA
ACAAAAAAATAGGATAATCTACCAATTCTACTTTATCGTCCTCCATTTAATCATCTCCTAGTTCTTATAC
TTCATAGTTTCCTTCTATAAGTGAAATTACTTAGTTAACTGTCCTTAAAGGAAATTCAAATAATTATACA
AATAAAACTAATTTTTTAAGCTCTCCAAATGAAAATTCATACTAAGATTCACCTGCTTAAAATCAATAGC
AGCGAAGTGTTTCTCCTGTCAAAGAAGAGAGAAAGTATGATTCAGATGATCAAGAGAATAACCCAAGTCT
TGCAAACTTATAAACAAGCAATACAAATAACTCCATAAACAATATCCAAAATAATAACAACATGAATATT
CATATTAACTAAATGAATTAAAGTATCGCAAGTAATAATAACTTAGGAATTTCAAATTTCATGAATGGCA
ACAGTAGCCAAAGCAATCATTTAAGCCACATTCACTAGCACCACTCACATAACTTACAGCAAATGTGCTG
TCCTTTAAATAACAGTAGCAATTTGAACAGTATGATAAGCAGCAATAACTTTGATATTAATAACACTAGT
AGTTGTCATGAGAAATCTAGTTCAAAGCAGAGAAATGTAAATGGAAAAGGCAAAAAATATGGATATAAAC
ATGGATAAATGAATCTGAACTGTGATTAAAATAGTTTGAATGGTAAAGAGCAGCACAAAACATGCCAAAT
AAATTGCGAATAAGCACTATGCTAGAATAATAAAAGCTTAAGAAATTTATCAAACTTACTAAAAAGCTTG
AAATTTTCACCTCTACTTGCTTAATAATAGTAAGTAACATAGAGCTTAATGACTTTACCCTTCGAACTTC
ACTTCATTATTTGTTCTTATTTATCTCCCAAAGATATTTACCTGCGCCTTGCAAATGTAAATTAGTACTT
CCGTAAAATGTGTAAAGATACTCGTCTTTGGAGCTATATCTAGAAGTTTTAGACTTTGACCATTAATGAC
AAATATTAGAAGAATATCCCTGTAGTAGAACGCAGATCCAAAGGAAGACTCTTTTCAGCAGTATCCCGTC
TAGATCATAATCAGgtaaaaaataaattgtccttcattttaaattttctatttcaaattttaaatcaatc
aatcaatcaatcaacaaacatatttgaaaacaaattcttggttgaaaaaaccgaaacagattaattcttt
taaatttttgaacgaaattcatttttttaatgttcaattaaattaaaaaaaagTTTATGATTAGAAACGT
GAACATTATGATAAGCAATGCTGGATAAGATGATGGAGTTCCTACTAGTATTTTAAGAGAACTCAGCTAT
TTGTAGGCTCTTGATCACCCAAATATCACAAAgtaattttaattattaattcattaacaagtgaaaaact
actaaatatttattcattattgtattctgctcttttcaaatcagaaaaaattatcttaaaatcatggaga
ttttcataaataaactgaaaaaatattctaaaatattaaatttttatttaatataaaaatagAATTCACG
AAGTAGACATAAAAAATGTGATAGTTCAAATAGTTACAAAAAGATAAGAGTATAACTTGAAGGAATATAC
AAGAAGATATATCAGCTAAGTTCAGGATGACAGTAAGGGACTCACTCGTCCTCAATACAAAATTCCTTTG
ATTAAAGTTAAGGAAATTGCTTACTAGATTCTTGAAGGTTTAAATTACTTGCATCACTAAGGAATTATGC
ATAGAAATTTAAAGATTGATAATATTTTGCTTGATAAAGATGTTGTAAAAATATCAGATTTCGGTCTTTC
AAGACTTGTTTCGATTCCCCACATACCATACACTCCTGAAGATCCTAAAGAAAGAGAACGCTCAGGAAGA
GAAGCTCGCCGTCTTTGGTACAGAGCTCCTGAGCTCCTTTTGAGAAAAAGCATCTACACCTTTGAAATTG
ATATGTGGTCTTTTGGCTGTCTTTTAGCTGAAATTGTTTTGAATGAACCTTTATTTGCTGGAGgtaaaaa
taaataaaataaaaattaatttaaaacaaatagaattttatacaaaattttttttgagcatttacaacta
attaattacaattgtttttatgaaactgatagcaatcaatatattaaatgtctttaaaagcagataaatt
tacaaataatctagatttaggatagctttctaaattaatatcaagcataagttaaaaacagaaaatttaa
atttgaatgcaaattcataaaattaagatattaaggcaacaaacaattatcaatttaatttattttattt
tttgttgttttttttcactcaaaaagaaaaatagataaaatagacaaaataaatgattgattttcatcat
atataaaaataatacttgttaaattgaattagatccattcaaatgacaaataaattgattaattcttttt
atactaaatagATTCTGAAATTGAGTAGCTTTTCAAGGTATTCAAATTTATTGGTTCTCCAGATTCAGAA
ACCTTAATGTCAATGTGTGACAACCCTGATTACTAGCAAACCTTCCCAAAATGGAAAATGATCAATTTAT
CCCATATCTGTGAATAAAATTAGAGTGAAGAATTCAAATAATTAAAGACCACAATGATTCCCAACAGATA
GAACGGATTTTAAAAACTTAAAAATTTAGGCACTATCTTGGGAATGTAAGGAATGTAGCTTTTGAACTCA
TTACTTCAATTAAATCCTTATAAGAGAATATCTTCTCAAGAGGCTCTTAACCATCCATTCTTCGATGAAA
TAAGATAGTAAAGAACTTTAATGAATATTCCCATGCAAATTGATGAAACCATTAATATTAATAAGTGTTG
CAGCTAAGTAGTACCTTCATGCTATTTTTAGTTCTCACTACCTTACTGCCATTTATCAACAATTTATTAA
ACTATGGTTAAATAAGAAAAGATAGAAACCTTGATCAAACCTGATTACATGAAAGACTAAGCCTTAATCA
CTGAAAATATGCGTATAATACTTATTGATTGGCTAACTGATGTAAGCGTTCATTTCGAAGCATAAGACGA
AACTCTTCATTATTGTATTTCTTACATCGACAGgtaaataaaaaccaaatcttcttattttttttaagtt
ataattttattttttaaaataattattttaattaaacgtctttaattaatctttactaaattaatgaata
atattataaatcaaaagAGCTTTGGGTATCATGAATATTGATAAACAAAAACTGCAGTTAGTAGGAGTAA
GTTGCATGAAAATTGCAGAgtaagaaattaatttaataataaagaatttattaatatttaaaatttaaaa
atagTGTATTTAATGAGAGATCTAGAGAATATTACAAATAAGAAAACGCTATCGAATATGCATACATAAC
AGCAGAAGAGTATAATGCAGCTTAACTCATTGCTATGGAGAAAAAAATTCTAAAAGTTCTCTCTTTCTAA
TTAAATACTCCAAATATGATGTATTTTTTAAAAATAATGTGCACTTTATTTGATACTGACTCCTAGGTTT
CCGTTATTGCTATGgtaaattatttattaataaaataaataaatcgtataaaaaataaaagcaaaaatta
tactgattactttttattatgttttgcttttatttttttcaatattattttagtttaaaattttttgatt
tttaatttaaatttatatttgaaaattaaaagTTCCTGGCCGACTTGCTACTTATGAGTTACGAAGCATT
GAGATTTAAACCAAGCTTACTAGCCAGTTGCTGTATATTTTTGAGCTTTTTGACTAACGAGAGAGAACTT
CCTACTTAAGAAAAGCTAAATGAAGTTCGTAGCCTTTTAGACCATTATACTATTAATGAGTTTAAAGAAG
CAGCTGAATTTGTTAGAAAATTCTGGCATTATTATAGATCTGATCCCAACACACTAAACTTCTAATCAGT
CTACAATAAGTATGCTGTTGTATATGGTCTAGAAGCAAGACTAATTAATGCTCCTATAATAGAATAAGCC
TAATACAGCTAATGGATCTATACAAAATGA
Figure 2: TTHERM_00433390 Gene sequence. Introns are highlighted in red and primers are
highlighted in yellow.
RT-PCR
Figure 3: RT-PCR analyses. Lane 1 = DNA MW Marker. Lane 2 = CU428 genomic DNA template (contains
RT-PCR Intensity Graph
intron). Lanes 3,4 = CU427 and CU428 vegetative. Lanes 5,6 = CU427 and CU428 starved 24 hours.
Lanes 7-25 = conjugating (0-18 hours post-mixing).
Figure 4: Intensity graph of RT-PCR data.
There is no data point for C4. The reason for this is that there was a error in the collection and
treatment for the Tetrahymena at the given hour.
Microarray Expression data
Figure 5: Microarray expression profile for the gene TTHERM_00433390 from TGED. L = vegetative log phase
growth; S = hours under starved conditions; C = conjugation (hours post-mixing).
The microarray expression profile was obtained from the Tetrahymena Gene Expression Database.
Discussion
The RT-PCR data of Cyc10 (TTHERM_00433390) does not match the expected intensity that was
obtained from the Microarray Expression. The one area where the data is relatively close is at the hour
six and seven marks. Between this time period in both the RT-PCR and Microarray data, intensity
reaches a maximum. At all other time periods however the intensity gained by RT-PCR is much higher
then what was found in the Microarray. Due to these great differences it is very difficult to try and
make a hypothesis on for the putative function of each of cyclin TTHERM_00433390. If you look at just
the microarray data the cyclin seems to be involved somewhere in the G or S phase of mitosis. The
reasoning for this assumption is that at hour 2 the cells have paired together and are beginning to
undergo division, and a little after hour 6 the cell is beginning to undergo its first postzygotic division.
The RT-PCR data however, shows the cyclin to be almost constant throughout conjugation. The RT-PCR
experiment should be repeated at least one time to see if better results can be obtained. New primers
may have to be created for the experiment as well.
References
1. Orias E. Toward sequencing the Tetrahymena genome: exploiting the gift of nuclear
dimorphism. J Eukaryot Microbiol. 2000;47:328–333.
2. Miao W, Xiong J, Bowen J, Wang W, Liu Y, Braguinets O, Grigull J, Pearlman RE, Orias E, Gorovsky
MA. Microarray analyses of gene expression during the Tetrahymena thermophila life
cycle. PLoS ONE. 2009;4:e4429
3. Cole ES, Cassidy-Hanley D, Hemish J, Tuan J, Bruns PJ. A mutational analysis of conjugation in
Tetrahymena thermophila. 1. Phenotypes affecting early development: meiosis to
nuclear selection. Dev Biol. 1997;189:215–232.
4. Steve Rozen and Helen J. Skaletsky (2000) Primer3 on the WWW for general users and for
biologist programmers. In: Krawetz S, Misener S (eds) Bioinformatics Methods and
Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386
5. Abramoff, M.D., Magelhaes, P.J., Ram, S.J. "Image Processing with ImageJ".
Biophotonics International, volume 11, issue 7, pp. 36-42, 2004.