Online Appendix for the following JACC article
TITLE: Interleukin-17A Contributes to Myocardial Ischemia/Reperfusion Injury by
Regulating Cardiomyocyte Apoptosis and Neutrophil Infiltration
AUTHORS: Yu-Hua Liao, MD, Ni Xia, MD, PhD, Su-Feng Zhou, MD, Ting-Ting
Tang, MD, PhD, Xin-Xin Yan, MD, Bing-Jie Lv, MD, Shao-Fang Nie, MD, PhD, Jing
Wang, MD, PhD, Yoichiro Iwakura, DSc, Hong Xiao, MD, Jing Yuan, MD, PhD,
Harish Jevallee, MD, Fen Wei, MD, PhD, Guo-Ping Shi, DSc, Xiang Cheng, MD, PhD
APPENDIX
SUPPLEMENTARY MATERIALS
IL-17A contributes to myocardial ischemia/reperfusion injury by
regulating cardiomyocyte apoptosis and neutrophil infiltration
Yu-Hua Liao, MD, Ni Xia, MD, PhD, Su-Feng Zhou, MD, Ting-Ting Tang, MD,
PhD, Xin-Xin Yan, MD, Bing-Jie Lv, MD, Shao-Fang Nie, MD, PhD, Jing
Wang, MD, PhD, Yoichiro Iwakura, DSc, Hong Xiao, MD, Jing Yuan, MD,
PhD, Harish Jevallee, MD, Fen Wei, MD, PhD, Guo-Ping Shi, DSc, Xiang
Cheng, MD, PhD
Supplementary Methods
Mice
Male C57BL/6 mice aged 8-10 weeks were purchased from Beijing University
(Beijing, China). Il17a–/– mice in a C57BL/6 background were generated as
previously described (1). The mice were maintained on a chow diet in a 12-hour
light/12-hour dark environment at 25 °C in the Tongji Medical School Animal Care
Facility, according to institutional guidelines. All animal studies were approved by the
Animal Care and Utilization Committee of Huazhong University of Science and
Technology.
In vivo myocardial I/R protocol
Surgical induction of myocardial I/R was performed as previously described (2).
Briefly, mice were anesthetized with ketamine (50 mg/kg) and pentobarbital sodium
(50 mg/kg), orally intubated, and connected to a rodent ventilator. A left thoracotomy
was performed. The left anterior descending (LAD) coronary artery was visualized
and ligated using 8-0 silk suture around fine PE-10 tubing with a slip knot. Mice were
subjected to 30 minutes of LAD ischemia followed by varying periods of reperfusion.
Sham-operated animals were subjected to the same surgical procedures, except that
the suture was passed under the LAD but not tied. Before sacrifice,
echocardiographic and hemodynamic analyses were performed. The infarct area was
determined by Evans blue and 2,3,5-triphenyltetrazolium chloride (TTC) staining. The
Evens blue-negative stained part (ischemic/reperfused tissue or area at risk [AAR])
was isolated and used for all assays including real-time PCR, Western blotting,
biochemical and immunohistological measurements (3).
Treatment and groups
For the measurement of IL-17A expression patterns, C57BL/6 mice were subject
to sham or 30 minutes ischemia followed by 1, 4, 12, 24, and 72 hours reperfusion
(n=10 per group at each time point, 5 mice used for flow cytometry and 5 for realtime PCR and western blotting).
To elucidate the causative role of IL-17A, C57BL/6 mice were randomly assigned
to 10 groups at two time points (n=8/group). For 1 day reperfusion: 1) anti-IL-17A
treatment group (Anti-IL-17A) and 2) isotype control antibody treatment group
(Isotype): mice were injected IV with 100 μg anti-IL-17A neutralized mAb
(eBioscience, clone eBioMM17F3, lgG1，San Diego, CA) or 100 μg mouse IgG1
isotype control mAb (eBioscience) 5 minutes prior to reperfusion; 3) recombinant
mouse-IL-17A treatment group (rIL-17A) (4) and 4) vehicle treatment group (Vehicle):
mice were injected IV with 1 μg recombinant mouse IL-17A diluted in PBS containing
0.1% albumin (R&D System, Minneapolis, MN) or PBS containing 0.1% albumin 5
minutes prior to reperfusion; 5) sham group (Sham). For 3 days reperfusion, besides
above treatment, the antibody or cytokine injection was repeated every 24 hours.
In addition, Il17a–/– mice were divided into two groups (n=8/group): 1) sham group
(Sham) and 2) myocardial I/R group (I/R) (30 minutes ischemia followed by 1 day
reperfusion). In this set of experiments, C57BL/6 mice were also assigned to the
sham group (Sham) and the myocardial I/R group (I/R) (n=8/group) as wild-type
controls.
To investigate the mechanism of IL-17A function, C57BL/6 mice were randomly
assigned to 4 groups: 1) sham group (Sham); 2) myocardial I/R group (Control); 3)
anti-IL-17A treatment group (Anti-IL-17A) and 4) recombinant mouse-IL-17A
treatment group (rIL-17A) (n=20 per group). At 3 hours post reperfusion, mice were
used to analyze apoptosis (TUNEL staining, caspase-3 activity and Bcl-2 and Bax
mRNA expression), chemokines and adhesion molecules expression and neutrophil
infiltration (myeloperoxidase (MPO) activity and flow cytometry).
Echocardiographic and hemodynamic analysis of cardiac function
A Vevo 2100 high-resolution microimaging system with a 30 MHz transducer was
used (Visualsonic, Toronto, Ontario, Canada). Mice were anesthetized with 1.5%
isoflurane and two-dimensional echocardiographic views of the mid-ventricular short
axis and parasternal long axes were obtained. Left ventricular (LV) fractional
shortening (FS) and LV ejection fraction (EF) were calculated from digital images
using a standard formula as previously described (5, 6). Echocardiographic
acquisition and analysis were performed by a technician who was blinded to
treatment groups.
For hemodynamic performance measurements, a 1.4 French micromanometertipped catheter (SPR-671, Millar Instruments, Houston, TX) was inserted into the
right carotid artery and then advanced into the LV. LV end-diastolic pressure
(LVEDP) was measured, and maximal (LV +dp/dtmax.) and minimal (LV -dp/dtmin.) first
derivative of LV pressure rise and fall were calculated.
Infarct area assessment
Infarct size after I/R injury was determined as previously described (7). Briefly, at
the end of a 1-day or 3-day reperfusion period, mice were anesthetized, the LAD was
re-occluded at the previous ligation, and 1 ml of 2.0% Evans blue (Sigma-Aldrich, St.
Louis, MO) was injected. The heart was quickly excised, immediately frozen, and
sliced. Sections were then incubated in a 1% 2,3,5-triphenyltetrazolium chloride
(TTC, Sigma-Aldrich, St. Louis, MO) solution and digitally photographed. Left
ventricular area, area at risk (AAR) and infarct area were determined by
computerized planimetry using Image-Pro Plus software (Media Cybernetics Inc.,
Bethesda, Maryland).
Serum troponin T
Blood concentrations of troponin T were measured as an index of cardiac cellular
damage using the quantitative rapid assay kit (Roche Diagnostics GmbH, Mannheim,
Germany) as previously described (8, 9).
Myocardial apoptosis
For Terminal deoxynucleotidyl-transferase mediated dUTP nick-end labeling
(TUNEL) staining, hearts were fixed in 4% paraformaldehyde, embedded in paraffin,
cut into 5-µm thickness sections and treated as instructed in the In Situ Cell Death
Detection kit (Roche Diagnostics GmbH, Mannheim, Germany). Following this,
sections were co-stained with anti-sarcomeric actin antibody (Sigma-Aldrich, St.
Louis, MO) to specifically mark cardiomyocyte. TRITC goat anti-mouse antibody was
applied as secondary antibody. Total nuclei were stained with DAPI. More than 5
fields in >3 different sections/animals were examined by a technician who was not
informed about treatment groups, in a blinded fashion.
Cardiac caspase-3 activity was measured as previously described (10, 11) using
a caspase colorimetric assay kit following the manufacturer’s instructions (Chemicon,
Temecula, CA). The absorbance of the p-nitroaniline cleaved by caspase was
measured at 405 nm using a microplate reader (ELx800, Bio-Tek Instruments, USA).
Results were standardized to the sham group for comparison of the fold change in
caspase-3 activity.
Cultured cardiomyocytes were exposed to H2O2 (Sigma-Aldrich, St. Louis, MO)
and/or mouse rIL-17A (R&D System, Minneapolis, MN), as indicated, for 4 hours
and apoptosis was detected by TUNEL staining according to the manufacturer’s
directions. Nuclei were identified by staining with hematoxylin. 5 randomly chosen
fields from each dish were counted for the percentage of apoptotic nuclei.
Myeloperoxidase assay
After 3 hours of reperfusion, tissue samples were assessed for MPO activity (10).
Samples were homogenized in hexadecyltrimethyl ammonium bromide (HTAB,
Sigma-Aldrich, St. Louis, MO) and dissolved in potassium phosphate. After
centrifugation, supernatants were collected and mixed with o-dianisidine
dihydrochloride (Sigma-Aldrich, St. Louis, MO) and H2O2 in phosphate buffer. The
activity of MPO was measured spectrophotometrically at 470 nm using microplate
Reader (ELx800, Bio-Tek Instruments, USA) and expressed as units per 100 mg
tissue. Myeloperoxidase standards (Sigma-Aldrich, St. Louis, MO) were measured
concurrently with the tissue samples.
Heart infiltrating cell isolation and flow cytometry analysis
Hearts were minced into very small pieces and then digested in 0.1%
collagenase B solution (Roche Diagnostics GmbH, Mannheim, Germany) for 7
minutes, 4 times, at 37C (12). Single cell suspensions were prepared by filtering
through a cell strainer (40 µm size, BD Falcon, Franklin Lakes, NJ). The cells were
enriched and isolated cells were counted after lysis of erythrocytes. For
measurement of cardiac IL-17A-producing leukocytes, CD45+ cells were isolated
using anti-CD45 microbeads (Miltenyi Biotec, Bergisch-Gladbach, Germany) and
then stained with intracellular cytokine combined with various surface markers as
previously described (13). Briefly, the harvested cells were labeled with the following
surface markers: PerCP-cy5.5 anti-mouse CD45, PE-cy7 anti-mouse CD3, FITC antimouse CD4, PE anti-mouse TCR, PE-cy7 anti-mouse CD11b, PE anti-mouse Ly6G/Gr-1 or FITC anti-mouse NK1.1 (eBioscience, San Diego, CA). After being
washed, fixed, and permeabilized according to the manufacturer’s instructions, cells
were stained with APC anti-mouse IL-17A antibody or isotype control antibody (every
sample was tested twice: one was labeled with CD45/CD3/CD4/TCR/IL-17A and
the other was labled with CD45/CD11b/Gr-1/NK1.1/IL-17A, eBioscience, San Diego,
CA). Stained cells were measured by FACScalibur flow cytometry (BD Biosciences),
and data were analyzed using CellQuest software (BD Biosciences). For detection
the number of cardiac infiltrating neutrophils, cells were stained with PerCP-cy5.5
anti-mouse CD45, PE-cy7 anti-mouse CD11b, PE anti-mouse Ly-6G/Gr-1, and
measured by FACScalibur flow cytometry. Caltag Counting Beads (Invitrogen Life
Technologies, USA) were used to normalize for differences in cell recovery among
samples.
Cell culture
Neonatal cardiomyocytes were isolated and cultured using previously described
methods with some modifications (14). Briefly, after cervical dislocation, the hearts
from 1-day-old C57BL/6 mice were removed, cut into small chunks and washed with
Hanks’ balanced salt solution (HBSS). Then, the tissue was incubated in 4 ml
trypsin/EDTA solution (GIBCO, Carlsbad, CA) at 4C for 30 minutes with rotation.
The digestion was stopped by addition of 6 ml DMEM containing 20% fetal calf
serum (FCS, GIBCO, Carlsbad, CA). After centrifugation at 1000 rpm for 5 min, the
supernatant was removed, and the tissues were incubated in 4 ml Liberase TH (0.1
U/ml in HBSS, Roche Diagnostics GmbH, Mannheim, Germany) at 37C for 15 min.
The supernatant containing the released cells to DMEM-20% FCS was removed, and
fresh Liberase TH was added to the undigested tissues, which were then incubated
for a further 15 minutes. This digestion procedure was repeated until most of the cells
had been released from ventricular tissue and the obtained cells were resuspended
in DMEM. All collected cells were filtered through a nylon cell strainer (70 µm size,
BD Falcon, Franklin Lakes, NJ) and seeded into fibronectin-coated 12-well tissue
culture plates (Costar; Corning, NY). After 1 hour of incubation with 5% CO2 at 37°C,
the attached fibroblasts were discarded and cardiomyocytes in the supernatant were
enriched and seeded into fibronectin-coated tissue culture plates after cell
concentration was adjusted. Cardiomyocytes were used in experiments when they
had formed a confluent monolayer and beat in synchrony at 72 hours.
Myocardial endothelial cells were isolated from 7-day-old C57BL/6 hearts using a
modification of published protocols (14–16). Briefly, hearts were explanted, rinsed,
and digested for 40 min at 37°C in 0.1% collagenase B solution (Roche Diagnostics
GmbH, Mannheim, Germany). The digested material was applied to a cell strainer
(70 µm size, BD Falcon, Franklin Lakes, NJ) to separate released cells. Then, the
dissociated cells were stained with rat anti-mouse CD31 (BD Pharmingen, San
Diego, CA), followed by goat anti-rat IgG microbeads (Miltenyi Biotec, BergischGladbach, Germany). CD31+ endothelial cells were immuno-magnetically isolated
according to the manufacturer’s instructions (Miltenyi Biotec, Bergisch-Gladbach,
Germany). Endothelial cells were then cultured in endothelial cell medium containing
endothelial cell growth supplement (1%, ScienCell, Carlsbad, CA). When the cells
reached 70 to 80% confluence, they were sorted a second time with rat anti-mouse
ICAM-2 (BD Pharmingen) and goat anti-rat IgG microbeads (Miltenyi Biotec). Purity
of the cells was >85%, as determined by staining for PE anti-mouse CD31 (BD
Pharmingen) and FITC anti-mouse ICAM-2 (BD Pharmingen) and flow cytometry
analysis. Cells from passages 1 to 3 were used in this experiment.
Neutrophils were isolated from the marrow of femurs and tibias from adult
C57BL/6 mice as previously described (14). Briefly, after cervical dislocation, the long
bones of the hind legs were removed, and the ends were clipped. The bone marrow
cells were flushed from the tibias and femurs with HBSS supplemented with 0.1%
bovine serum albumin. The pooled bone marrow elutes were resuspended and
filtered through a cell strainer (40 µm size, BD Falcon) to remove cell clumps and
bone particles. The suspension was subject to a Percoll (GE Healthcare, Sweden)
step gradient. Cells were collected from the neutrophil-enriched fraction, followed by
a further isolation with Histopaque 1119 (Sigma-Aldrich, St. Louis, MO). This
procedure yielded 6 million total cells, and neutrophils accounted for 90% as
identified by PerCP-cy5.5 anti-mouse CD45, PE-cy7 anti-mouse CD11b, PE antimouse Ly-6G/Gr-1 (eBioscience, San Diego, CA) staining and flow cytometry
analysis.
Neutrophil migration assays
Confluent beating mouse cardiomyocyte monolayers were exposed to rIL-17A
(50 ng/ml), which was preincubated with either anti-IL-17A-neutralizing mAb or
isotype IgG for 1 hour (5 mg/ml, clone 50104, rat IgG2A, R&D System) as well as/or
H2O2 (100 µmol/L). After 24 hours of treatment, KC, MIP-2, and LIX in the
supernatant were quantified using commercial ELISA kit (R&D System) according to
the manufacturer’s instructions. In the dose-dependent experiment, increasing doses
of rIL-17A (10 ng/ml, 50 ng/ml, 100 ng/ml) were used. The isolated neutrophils
(6×104) were added to the upper chambers of Transwell inserts in 24-well tissue
culture plates (5 μm pore, Corning, New York, USA), and conditioned supernatants
from cardiomyocytes were added to the lower well. After 30 min of incubation,
neutrophils that had migrated to the lower chamber were counted in five randomly
chosen fields using an inverted microscope (17).
Neutrophil-endothelial cell adhesion assays
Confluent mouse myocardial endothelial cell monolayers were treated with rIL17A, anti-IL-17A-neutralizing mAb, isotype IgG or H2O2 as described above for
cardiomyocytes. After 4 hours of treatment, the expression of ICAM-1 and E-selectin
on the surface of endothelial cells was quantified by cell-based ELISA. In the dosedependent experiment, an increasing dose of rIL-17A was used. Isolated neutrophils
were labeled with PKH-2 fluorescent green dye according to the manufacturer’s
instructions (Sigma-Aldrich, St. Louis, MO) and added to endothelial cell monolayers
at a neutrophil-to-endothelial ratio of 10:1. After 1 hour of incubation at 37 °C, nonadherent cells were removed by three gentle washes with PBS. Cells were fixed with
4% paraformaldehyde, and adherent cells were counted in five randomly chosen
fields using fluorescence microscopy (18).
Western blotting
IL-17RA and IL-17RC expression in cultured cells were measured by western
blotting (19) using anti-mouse IL-17RA and anti-mouse IL-17RC (R&D System,
Minneapolis, MN). The protein levels of IL-17A, chemokines and adhesion molecules
in ischemic myocardium were determined by Western blotting using primary
antibodies: anti-mouse IL-17A, KC, MIP-2, LIX, ICAM-1 and E-selectin (R&D
System, Minneapolis, MN). Protein extracted from cells or tissue was separated on
10% SDS-polyacrylamide electrophoresis gels and transferred to nitrocellulose
membranes (Pierce, Rockford, IL). After being blocked with 5% non-fat milk in TBS
for 3 hours, the membranes were incubated with indicated primary antibodies (0.2
µg/ml) at 4°C overnight, followed by incubation with HRP-conjugated secondary
antibody (1:5000) for 3 hours. The specific bands were detected by super ECL
reagent (Pierce, Rockford, IL). The intensity of the -actin (1:1000; Abcam,
Cambridge, MA) band was used as a loading control for comparison between
samples.
Real-time PCR
Total RNA was extracted from cultured cells or tissues using Trizol (Invitrogen,
Carlsbad, CA) and reverse transcribed into cDNA using the PrimeScript RT reagent
kit (Takara Biotechnology, Dalian, China) according to the manufacturer’s
instructions. mRNA levels of target genes were quantified using SYBR Green Master
Mix (Takara Biotechnology, Dalian, China) with ABI PRISM 7900 Sequence Detector
system (Applied Biosystems, Foster City, CA). Each reaction was performed in
duplicate, and changes in relative gene expression normalized to -actin levels were
determined using the relative threshold cycle method. Primer sequences were shown
in Supplementary Table 4.
Cell-based ELISA
The expression of ICAM-1 and E-selectin on the surface of endothelial cells was
quantified by cell-based ELISA with primary antibodies for either ICAM-1 or Eselectin as previously described. In brief, treated myocardial endothelial cells in 96-
well micro-plates (Costar; Corning, NY) were incubated with primary antibodies for
either ICAM-1 or E-selectin (R&D System, Minneapolis, MN) for 2 hours. Next, cells
were washed and incubated with secondary antibody conjugated to peroxidase for 1
hour. Finally, the TMB substrate (Bender MedSystems, Vienna, Austria) was added,
and color was developed for 5 to 10 minutes. After addition of stop solution, the
absorbance was read at 450 nm (ELx800, Bio-Tek Instruments, USA) (10, 14).
Statistics
Data are presented as means ± SEM. Differences were evaluated using unpaired
Student’s t test between two groups and one-way ANOVA for multiple comparisons,
followed by a post hoc Student-Newmann-Keuls test when necessary. All analyses
were done using SPSS 13.0 (SPSS, Chicago, IL), and statistical significance was set
at P <0.05.
Supplementary References
1. Nakae S, Komiyama Y, Nambu A, et al. Antigen-specific T cell sensitization is
impaired in IL-17-deficient mice, resulting in the suppression of allergic cellular
and humoral responses. Immunity. 2002; 17: 375-387.
2. Tarnavski O, McMullen JR, Schinke M, Nie Q, Kong S, Izumo S. Mouse cardiac
surgery: comprehensive techniques for the generation of mouse models of
human diseases and their application for genomic studies. Physiol Genomics.
2004; 16: 349-60.
3. Wang Y, Gao E, Tao L, et al. AMP-activated protein kinase deficiency enhances
myocardial ischemia/reperfusion injury but has minimal effect on the
antioxidant/antinitrative protection of adiponectin. Circulation. 2009;119:835-44.
4. Arslan F, Smeets MB, O'Neill LA, et al. Myocardial ischemia/reperfusion injury is
mediated by leukocytic toll-like receptor-2 and reduced by systemic
administration of a novel anti-toll-like receptor-2 antibody. Circulation. 2010;
121:80-90.
5. Most P, Seifert H, Gao E, et al. Cardiac S100A1 protein levels determine
contractile performance and propensity toward heart failure after myocardial
infarction. Circulation. 2006; 114: 1258-68.
6. Li Y, Garson CD, Xu Y, et al. Quantification and MRI validation of regional
contractile dysfunction in mice post myocardial infarction using high resolution
ultrasound. Ultrasound Med Biol. 2007; 33: 894-904.
7. Shibata R, Sato K, Pimentel DR, et al. Adiponectin protects against myocardial
ischemia-reperfusion injury through AMPK- and COX-2-dependent mechanisms.
Nat Med. 2005; 11: 1096-103.
8. Metzler B, Mair J, Lercher A, et al. Mouse model of myocardial remodelling after
ischemia: role of intercellular adhesion molecule-1. Cardiovasc Res. 2001; 49:
399-407.
9. Haubner BJ, Neely GG, Voelkl JG, et al. PI3Kgamma protects from myocardial
ischemia and reperfusion injury through a kinase-independent pathway. PLoS
One. 2010; 5: e9350.
10. Li J, Wu F, Zhang H, et al. Insulin inhibits leukocyte-endothelium adherence via
an Akt-NO-dependent mechanism in myocardial ischemia/reperfusion. J Mol Cell
Cardiol. 2009; 47: 512-9.
11. Brinks H, Boucher M, Gao E, et al. Level of G protein-coupled receptor kinase-2
determines myocardial ischemia/reperfusion injury via pro- and anti-apoptotic
mechanisms. Circ Res. 2010; 107: 1140-9.
12. Huber SA, Sartini D. Roles of tumor necrosis factor alpha (TNF-alpha) and the
p55 TNF receptor in CD1d induction and coxsackievirus B3-induced myocarditis.
J Virol. 2005; 79: 2659-65.
13. Xie JJ, Wang J, Tang TT, et al. The Th17/Treg functional imbalance during
atherogenesis in ApoE(-/-) mice. Cytokine. 2010; 49: 185-93.
14. Rui T, Cepinskas G, Feng Q, Ho YS, Kvietys PR. Cardiac myocytes exposed to
anoxia-reoxygenation promote neutrophil transendothelial migration. Am J
Physiol Heart Circ Physiol. 2001; 281: H440-7.
15. Bowden RA, Ding ZM, Donnachie EM, et al. Role of alpha4 integrin and VCAM-1
in CD18-independent neutrophil migration across mouse cardiac endothelium.
Circ Res. 2002; 90: 562-9.
16. Lim YC, Luscinskas FW. Isolation and culture of murine heart and lung
endothelial cells for in vitro model systems. Methods Mol Biol. 2006; 341: 141-54.
17. Ruddy MJ, Shen F, Smith JB, Sharma A, Gaffen SL. Interleukin-17 regulates
expression of the CXC chemokine LIX/CXCL5 in osteoblasts: implications for
inflammation and neutrophil recruitment. J Leukoc Biol. 2004; 76: 135-44.
18. Kokura S, Wolf RE, Yoshikawa T, Granger DN, Aw TY. T-lymphocyte-derived
tumor necrosis factor exacerbates anoxia-reoxygenation-induced neutrophilendothelial cell adhesion. Circ Res. 2000; 86: 205-13.
19. Cheng X, Chen Y, Xie JJ, et al. Suppressive oligodeoxynucleotides inhibit
atherosclerosis in ApoE(-/-) mice through modulation of Th1/Th2 balance. J Mol
Cell Cardiol. 2008; 45: 168-75.
Supplementary Tables
Supplementary Table 1: Flow cytometric quantification of heart-infiltrated leukocytes
in myocardial I/R mice after 24 hours of reperfusion.
Sham
IR
P value*
CD3+
1.69±0.33**
3.10±0.69
0.004
Total cell number
(×105/g heart tissue)
CD4+
 TCR+
0.71±0.17
0.19±0.03
1.36±0.39
0.39±0.09
0.009
0.007
*P < 0.05 was considered statistically significant, Student’s t test.
**Values are mean ± SEM, n=3-5.
CD11b+Gr-1+
1.33±0.32
12.90±1.45
<0.001
Supplementary Table 2: Flow cytometric quantification of heart-infiltrated IL-17Aexpressing leukocytes in myocardial I/R mice after 24 hours of reperfusion.
Total cell number
(×103/g heart tissue)
Sham
IR
P value*
CD3+IL-17+
CD4+IL-17+
1.77±0.48**
28.23±7.91
0.002
0.69±0.12
3.87±0.98
0.003
TCR+ IL17+
0.87±0.21
21.76±6.63
0.002
Proportion
(%)
CD3+IL-17+
(%CD3+)
1.05±0.25
9.06±0.81
<0.001
CD4+ IL-17+
(%CD4+)
1.01±0.22
2.92±0.73
0.003
*P < 0.05 was considered statistically significant, Student’s t test.
**Values are mean ± SEM, n=3-5.
TCR+ IL-17+
(%TCR+)
4.48±1.17
54.39±4.25
<0.001
Supplementary Table 3: Echocardiographic analysis of Il17a–/– mice at baseline.
Group
Age (week)
N
LVEDD (mm)
LVESD (mm)
EF
FS
HR (beat/min)
WT
8-10
6
3.18±0.05
1.66±0.06
77.52±4.25
47.69±1.35
478±34
Il17a–/–
8-10
6
3.17±0.04
1.64±0.08
78.43±3.96
49.37±1.99
482±37
Supplementary Table 4: Primers used for real-time PCR.
Gene
Forward (5’-3’)
Reverse (5’-3’)
IL-17A
IL-17B
IL-17C
IL-17D
IL-17E
IL-17F
IL-17RA
IL-17RC
KC
MIP-2
LIX
ICAM-1
E-selectin
Bcl-2
Bcl-xl
Bax
Bak
β-actin
TGTGAAGGTCAACCTCAAAGTCT
GAGTATGAGCGGAACCTTGG
CCTCTAGCTGGAACACAGTGC
TCCGGCCACCCACCAACCTG
TGGAGCTCTGCATCTGTGTC
GGACTTGCCATTCTGAGGGAGGTAGC
GAATGAATCCACCCCCTACC
GAGCTCAACCTCACACAGCA
GCTGGGATTCACCTCAAGAA
CGCCCAGACAGAAGTCATAG
GGTCCACAGTGCCCTACG
GACTGAGGAGTTCGACAGAACC
CAAATCCCAGTCTGCAAAGC
GTACCTGAACCGGCATCTG
CCTTGGATCCAGGAGAACG
TGCAGAGGATGATTGCTGAC
CGCTACGACACAGAGTTCCA
AAGGCCAACCGTGAAAAGAT
GAGGGATATCTATCAGGGTCTTCAT
CTGGGGTCGTGGTTGATG
GCGGTTCTCATCTGTGTCG
ACAGGCAGTAGGCTTCGGGCAGGTA
GATTCAAGTCCCTGTCCAACTC
CCGGTGGGGGTCTCGAGTGATGT
TCGCTGATGGAATTCTTCTTG
GGACGCAGGTACAGTAAGAAGC
CTTGGGGACACCTTTTAGCA
TCCTCCTTTCCAGGTCAGTTA
GCGAGTGCATTCCGCTTA
AGGACCGGAGCTGAAAAGTT
CAACTGGACCCATTTTGGAA
GCTGAGCAGGGTCTTCAGAG
CAGGAACCAGCGGTTGAA
GATCAGCTCGGGCACTTTAG
TCCATCTGGCGATGTAATGA
GTGGTACGACCAGAGGCATAC
Supplementary Figures
Supplementary Figure 1. Levels of IL-17A in hearts increased following myocardial
I/R. Levels of IL-17A were measured by real-time PCR (A) and western blotting (B) in
hearts after 30 minutes of ischemia and reperfusion for different times (n=5). *P <
0.05, **P < 0.01 versus sham group. C, The heart infiltrated IL-17A+ leukocytes in
myocardial I/R mice after 24 hours reperfusion were analyzed by flow cytometry.
CD45+ cells were isolated and restimulated. The IL-17A+ CD45+ cells were further
analyzed for CD3, TCR, CD4, NK1.1 and Gr-1 expression to detect the cellular
source of IL-17A. The proportion of different IL-17A-secreting cells in the IL17A+CD45+cells were quantitative analysis (n=5). Representative contour plots of
IL17-expressing cells were shown to the left panels.
Supplementary Figure 2. IL-17A was the most prevalent cytokine of the IL-17
family in I/R myocardium. mRNA expression of IL-17B, IL-17C, IL-17D, IL-17E and
IL-17F was normalized to IL-17A (set at 100%) in hearts of myocardial I/R mice after
24 hours reperfusion (n=5). **P < 0.01 versus IL-17A.
Supplementary Figure 3. Anti-IL-17A mAb treatment or IL-17A knockout
decreased, whereas exogenous IL-17A treatment increased, serum cTnT following
myocardial I/R. A, Serum cTnT was measured in isotype, anti-IL-17A mAb, vehicle or
rIL-17A treated mice at 1 day after I/R (n=8). B, Serum cTnT was measured in wildtype and Il17a–/– mice at 1 day after I/R (n=8). *P < 0.05 versus isotype; ‡ P < 0.01
versus vehicle; §P < 0.05 versus wild-type.
Supplementary Figure 4. The expression of IL-17RA and IL-17RC in
cardiomyocyte. IL-17RA and IL-17RC expressions were detected in cultured
cardiomyocytes by RT-PCR (A) and Western blot (B), respectively. Splenocytes
were used as a positive control. Results are representative of three independent
assays.
Supplementary Figure 5. IL-17A regulated the mRNA expression of Bcl-2 family in
cultured cardiomyocytes. Mouse neonatal cardiomyocytes were treated with H2O2
(100 µmol/L) and/or IL-17A (50ng/ml) for 4 hours. The mRNA expression of Bcl-2,
Bcl-xl, Bax, Bak was measured by real-time PCR. *P < 0.05, **P < 0.01 versus
control. Results are representative of three independent assays.
Supplementary Figure 6. IL-17A regulated the expression of chemokines and
adhesion molecules in myocardium, cardiomyocytes, and endothelial cells. A,
Immunoblot analysis to detect protein levels of chemokines KC, MIP-2, and LIX in
myocardium following myocardial I/R. B, Cardiomyocytes were cultured in the
presence of H2O2 (100 µmol/L) with different doses of rIL-17A. Medium chemokines
were determined by ELISA (n=4–5). C, Immunoblot analysis determined adhesion
molecules ICAM-1 and E-selectin in myocardium following myocardial I/R. D,
Endothelial cells were cultured in the presence of H2O2 (100 µmol/L) and different
doses of rIL-17A. The surface expression of ICAM-1 and E-selectin was determined
by ELISA (n=4–5). Data in B and D are representative of three independent assays.