Aklujkar, Muktak 1-3
Gene Gorging Mutagenesis for the Geobacteraceae





Gene gorging is one way to make a strain with multiple mutations without having
to insert a different antibiotic resistance marker into each mutant allele.
For gene deletions, Cre-lox mutagenesis also works in G. sulfurreducens, and has
the advantage of antibiotic selection at every step
Gene gorging requires PCR screening of numerous colonies for mutants, but it is
suited for alleles that do not have markers inserted into them.
Any kind of mutant allele (e.g. single amino acid substitution) can be introduced
by gene gorging as long as there is a way to distinguish it by the size or restriction
digestion pattern of the PCR product.
Cre-lox mutagenesis requires a second round of electroporation after each
mutation, to eliminate the marker associated with the mutant allele, whereas gene
gorging only requires PCR screening.
1. The gene gorging method requires two plasmids (available from Muktak):
a. pMA24 (gentamicin resistance)
b. pMA28 (kanamycin resistance)
2. The strain with which you start should be sensitive to these antibiotics.
3. You do NOT need to insert an antibiotic resistance marker into your mutant
allele; design your primers accordingly.
4. To make a deletion:
a. Use a proofreading polymerase such as LA Taq (from Takara Mirus
Bio)
b. Two pairs of primers to amplify the DNA sequences flanking the
deletion on the 5’ side and 3’ side
i. Design primers with one or two restriction sites where you can
cut, ligate, and cut again later.
c. Join them either by restriction/ligation or by two-piece crossover PCR.
i. Two-piece crossover PCR can introduce more undesirable
mutations, so if you try it, do no more than 30 cycles
d. Combine equal molar amounts of the two fragments and include the
two outer primers.
e. Gel-purify the ligation product
i. The gel-purification is necessary to prevent incompletely
digested PCR amplicons from inserting into the TOPO vector
in place of the ligation product.
f. TOPO-clone the ligation product
g. Sequence the ligation product with M13 primers, forward and reverse.
5. The mutant allele delivery plasmid pMA24 contains unique sites for the
following restriction enzymes: Avr II, BamH I, Nde I, Kpn I, Xho I, EcoR I,
BspE I, Cla I, Nsi I, and Xba I, in the sequence below.
a. 5’CCTAGGATCCATATGGTACCTCGAGAATTCCGGATCGATG
CATCTAGA3’
b. This sequence is flanked by 18 bp sites (ATTACCCTGTTATCCCTA)
recognized by the meganuclease I-Sce I.
Aklujkar, Muktak 2-3
c. Use these to insert your mutant allele into pMA24.
6. Make your initial Geobacteraceae strain electrocompetent
7. Electroporate with pMA28
a. Expresses I-Sce I under control of the IPTG-inducible taclacUV5
promoter
8. Select on plates containing kanamycin.
a. Do not include IPTG.
9. Streak for isolated colonies.
10. Make this strain electrocompetent with pMA28
11. Introduce plasmid pMA24 carrying your mutant allele.
12. Add kanamycin to every transfer, including the recovery tubes.
13. After at least 5 hours, transfer a 1% inoculum to a tube containing kanamycin
and gentamicin to select for both plasmids.
a. Do not include IPTG.
14. It will take about four days for the culture to grow.
15. Transfer to liquid medium without gentamicin and induce with 1 mM IPTG
during the exponential phase of growth (OD600 of 0.2 to 0.4)
a. It doesn’t hurt if gentamicin is present or the cells have entered early
stationary phase.
16. The multicopy pMA24-derived plasmid has to be cut into two pieces by I-Sce
I, of which one linear fragment is the mutant allele.
17. The multiple copies of this allele make it likely that it will replace the wild
type allele on the chromosome; hence the name “gene gorging.”
18. Linearization of the mutant allele with I-Sce I forces a double crossover within
the allele itself, and eliminates the gentamicin resistance marker from the cell.
19. To tubes of 10 ml BMW add:
a. 0.1 ml of 100 mM cysteine
b. 0.2 ml of 5% yeast extract to sufficient
20. With or without exposure to IPTG, dilute the culture to about 1000 cells/ml
a. Three serial 2% dilutions of a culture at an OD600 of 0.4 into BMW
21. Spread 100 ul on to plates containing kanamycin and IPTG (and NOT
gentamicin) to select for pMA28.
22. Prolonged exposure to IPTG in liquid delays the growth of colonies, but
exposure for more than 8 hours is required to eliminate pMA24, and does not
affect the efficiency of allelic replacement.
23. The day before you pick colonies, aliquot 1 ml of NBAF or phosphatebuffered NBAF containing kanamycin into a 96-well culture plate, cover with
an AirPore filter, and place in the glove bag to become anaerobic.
24. Aliquot PCR reactions into a 96-well PCR plate on ice.
25. Pick 96 colonies with sterile pipet tips
a. Transfer to the 96-well PCR plate first
b. Transfer to the 96-well culture plate second.
26. Screen by PCR
27. Preform a restriction digestion as well if necessary
28. Streak out those isolates that contain only the mutant allele without any trace
of the wild type.
Aklujkar, Muktak 3-3
a. The efficiency of allelic replacement should be at least 67% and can
reach 100%.
b. Include kanamycin if you wish to introduce further mutations.
29. Pick an isolated colony into liquid culture
30. Streak on gentamicin to ensure that the pMA24-derived plasmid has been lost.
31. Now the strain can be made competent and another mutant allele on a
pMA24-derived plasmid can be introduced.
Alternatives:
 Plasmid pMA29 is pMA28 with the Red recombinase genes co-expressed
with I-Sce I, potentially increasing the frequency of recombination.
 Plasmid pHT23 is pMA29 with spectinomycin resistance instead of
kanamycin.
 Plasmid pMA27 is the same as pMA28, except that the lac promoter for I-Sce
I is constitutively active; if your strain already contains a pMA24 derivative
plasmid, you can electroporate with pMA27, select on plates containing
kanamycin only, and then screen for the double crossover.
Reference:
Herring, C. D., J. D. Glasner, and F. R. Blattner. 2003. Gene replacement without
selection: regulated suppression of amber mutations in Escherichia coli. Gene
331:153-163.