Supplementary Methods
Northern blotting
For Northern blots, 30 g of total RNA was resolved on 15% urea/polyacrylamide
gels and transferred to Hybond N+ membrane (Amersham). RNA was
immobilized by UV cross-linking (1000 J) followed by baking for 30 min at 80°
C. Membranes were prehybridized in hybridization buffer (5xSSC, 20 mM
Na2HPO4 pH 7.2, 7% SDS, 2x Denhardt’s solution) for at least 2 h at 50° C.
Small RNAs were detected using P32 end-labeled antisense DNA
oligonucleotides in hybridization buffer overnight. Membranes were washed 4x in
non-stringent wash solution (3x SSC, 25 mM NaH2PO4 pH 7.5, 5%SDS, 10x
Denhardt’s solution) followed by one wash in stringent wash solution (1xSSC,
1%SDS). Sealed blots were exposed to phosphorimager plates.
Spine analysis
Neurons were selected in a blinded manner based on eGFP staining at a low
resolution at which spines were not visible. Seven consecutive optical sections of
dendrites were taken at 0.45m interval, 1024x1024 pixel resolution, averaged
four times, scan speed 15s per section on a Zeiss LSM510 Meta confocal
microscope. Projection images were constructed from individual z-stacks and
used for spine analysis by MetaMorph software. All dendritic protrusions longer
than 0.4m (“spines” and “filopodia”) were considered for this analysis. Spine
length was determined manually by measuring the maximal length of a line from
the dendritic shaft to the outermost part of the spine head. For the determination
of spine width, a line was drawn across the widest part of the dendritic protrusion
(“spine head”) and the average pixel intensity of the GFP channel was derived
along this line. Spine width was defined as the length of the line where pixel
intensities were above an arbitrarily chosen threshold equal to double the
background fluorescence. Spine volume was measured in principal as reported
previously, assuming free diffusion of eGFP throughout the dendritic tree 40.
Briefly, regions of interest (ROIs) were drawn around spines in the projection
image and nearby dendrites. The average fluorescence of pixels within this
region was measured and corrected for background fluorescence. Finally, a s/d
ratio was calculated for each spine by dividing the corrected pixel intensity of the
spine (s) ROI by that of the dendrite (d) ROI, thereby correcting for possible
fluctuations in the filling of individual dendrites. The calculated s/d ratio
represents a relative measure of spine volume. For each experimental condition,
at least 600 individual spines from 15 neurons of three independent experiments
were analyzed. For the calculation of standard errors, measurements from
experiments performed on different days were treated as independent
measurements. Statistical significance, if not otherwise stated, was assessed
with paired Student’s t-test.
Co-localization studies
For the determination of co-localization coefficients, ROIs were drawn around
randomly chosen dendrites and the degree of co-localization between red and
green channel was calculated using the LSM510 co-localization tool. Data was
analyzed from three independent experiments, five neurons per condition and at
least three individual dendrites per neuron.
MicroRNA sensor assay
Cortical neurons (4DIV) were transfected with eGFP reporter constructs that
contain either a perfect miR-134 binding site (“wt sensor’) or a mismatch
sequence (“mut sensor”) in the 3’UTR, together with miR-134 expression vector
or 2’O-Me-oligonucleotides where indicated. DsRed was co-transfected to
visualize transfected neurons. 48 h after transfection, samples were processed
for fluorescence microscopy. High miR-134 activity within neurons is indicated by
cleavage of the wt sensor resulting in the disappearance of the GFP signal.
Conversely, inhibition of miR-134 activity results in the reappearance of the GFP
signal.
Gelshift assay
In vitro transcribed Limk1 RNA (100 ng) was incubated with 32P end-labeled
microRNAs (30.000 dpm/l) as described46, and the complexes were resolved on
a native 15% polyacrylamide/ 0.5x TBE gel.
RNA and DNA oligonucleotides
In situ hybridization:
Mmu-miR-134 (LNA): cccctctggtcaaccagtcaca
Mmu-miR-134 MISMATCH (LNA): tccctctggtcaaggattccga
Limk1-SP6 (sense): atttaggtgacactatagaataggccctcttttgtaaagctgg
Limk1-T7 (antisense): taatacgactcactatagggagagaactcagagggcagatgcac
GFP-SP6: atttaggtgacactatagaataccatggtgagcaagggcgag
GFP-T7: aatacgactcactatagggagatacttgtacagctcgtccatgcc
Synthetic RNA oligos:
MiR-134 sense: 5’Phospho-ugugacugguugaccagaggga
MiR-134 as: 5’Phospho-ccucuggucaaccaguuauacu
Let-7c sense: 5’Phospho-ugagguaguagguuguaugguu
Let-7c as: 5’-Phospho-ccauacaaccuacuacuuuaaa
2’O-methylated oligos:
2’OMe134: ucucucccucuggucaaccagucacaaggcu
2’OMe-control: caucacguacgcggaauacuucgaaaugacc
2’OMe-let7: ucuucacuauacaaccuacuaccucaaccuu
Real-time PCR:
MiR134 precursor fw: gggtgtgtgactggttgacca
MiR134 precursor bw: gggttggtgactaggtggcc
Firefly Luc fw: tgaccgcctgaagtctctga
Firefly Luc bw: tggagcaagatggattccaat
Renilla fw: ggtgaagttcgtcgtccaaca
Renilla bw: tgtacaacgtcaggtttaccacct
Limk1 fw: cctccgagtggtttgtcga
Limk1 bw: caacacctccccatggatg
Beta3tubulin fw: ccccagggctcaagatgtc
Beta3tubulin bw: cgcttgaacagctcctggat
Cloning and Mutagenesis:
MiR134 precursor fw: cagtgaattcccaaccttggtgaggcagctg
MiR134 precursor bw: cagtgaattctcctggtccactgagcaggc
Limk1UTR-fw: gtatccatcgatactctggagaatagaccctcaccag
Limk1UTR-bw: atgctctagagggagcacagaattgattttattgag
Limk1UTR miR134site-fw: tgcctctggcccccatctagaaaggctgcacacac
Limk1UTR miR134site-bw: gtgtgtgcagcctttctagatgggggccagaggca
MiR134 sensor fw: ggcctccctctggtcaaccagtcacaggtacct
MiR134 sensor bw: cgccaggtacctgtgactggttgaccagaggga
Northern probes:
U6: gcaggggccatgctaatcttctctgtatcg
MiR134: tcccctctggtcaaccagtcaca
MiR124a: tggcattcaccgcgtgccaatt