E Michalak et al. Supplementary Material
Supplementary Materials and Methods
Real time qRT-PCR analysis primer sequences.
qRTPCR was performed using the following forward and reverse primers (a kind gift
from Drs DCS Huang and KJ Campbell)
gene
sense (5’ – 3’)
antisense (5’ – 3’)
a1
GTCATACTTGGATGACTTTCACGTG
ATTCTCCTGTGTTATTCATTATGAATTCTG
bad
AGTATGTTCCAGATCCCAGAGTTTG
CCTTGAAGGAACCCTCAAACTCATC
bcl-2
TTATAAGCTGTCACAGAGGGGCTAC
GAACTCAAAGAAGGCCACAATCCTC
bcl-xl
TGGAGTCAGTTTAGTGATGTCGAAG
AGTTTACTCCATCCCGAAAGAGTTC
bim
GAGTTGTGACAAGTCAACACAAACC
GAAGATAAAGCGTAACAGTTGTAAGATA
mcl-1
GAGGAGGAAGAGGACGACCTATACC
AGTTTCTGCTAATGGTTCGATGAAG
puma
ATGCCTGCCTCACCTTCATCT
AGCACAGGATTCACAGTCTGGA
noxa
ACTGTGGTTCTGGCGCAGAT
TTGAGCACACTCGTCCTTCAA
c-myc
CAAATCCTGTACCTCGTCCGATTC
CTTCTTGCTCTTCTTCAGAGTCGC
Supplementary Figure Legends
Supplementary Figure 1 Loss of Puma affects some B lymphoid cell subsets in the
lymph nodes and spleen of E-myc mice. Total cellularity and cell subset composition
of pre-neoplastic 5-6 week old mice of the indicated genotypes. (A) Numbers of preB, virgin and mature B cells in the lymph nodes (axillary, brachial, inguinal pairs)
were determined by immunofluorescent staining with surface marker-specific
monoclonal antibodies and flow cytometric analysis. Differences between E-myc
Michalak et al
transgenic and non-transgenic mice were significant for all puma genotypes for pre-B
cells, as were comparisons of virgin B cells for wt vs E-myc/puma-/- mice and for the
decrease in mature B cells for wt vs E-myc/puma+/- and wt vs E-myc/puma-/- mice
(P < 0.005). For comparisons of E-myc transgenic mice of the different puma
genotypes, all statistically significant differences are indicated. (B) Similar analysis of
the spleen revealed differences between E-myc and non-transgenic mice of all puma
genotypes (P < 0.005) for pre-B cells and mature B cells and for total cells and virgin
B cells for wt vs E-myc/puma-/- mice. For comparisons of E-myc transgenic mice of
the different puma genotypes, all statistically significant differences are shown.
Values represent means ± SEM from 5-8 mice of each genotype. * P < 0.05, ***
P < 0.005.
Supplementary Figure 2 Impact of Puma loss on survival of E-myc pro-B cells and
sIg+ B cells in culture. (A) Pro-B cells or (B) virgin/mature B cells sorted from the
bone marrow of 5-6 week old healthy wt mice or E-myc mice of the indicated puma
genotypes were cultured in simple medium (no cytokines) or treated with etoposide (1
g/mL) for the indicated times. For all experiments cell viability was determined by
FACS analysis as the percentage of Annexin V-PI- cells. Values represent means ± SD
of cells from 3-6 mice of each genotype. No statistically significant differences were
noted between transgenic genotypes. Similar results were obtained with virgin
(sIgMhisIgDlo) and mature (sIgMlosIgDhi) B cells from the spleen (data not shown).
Supplementary Figure 3 Representative immunophenotyping FACS plots of
lymphomas from E-myc and E-myc/puma-/- mice. Cell suspensions were prepared
from primary lymphomas and flow cytometric analyses performed after
2
Michalak et al
immunofluorescent staining with surface marker-specific monoclonal antibodies.
Lymphomas were classified as (A) B220+sIg- pro-B/pre-B, (B) B220+sIgM+sIgDlo B
cell or (C) “mixed” pre-B/B cell if distinct sIg- and sIg+ B lymphoma populations
were present.
Supplementary Figure 4 Loss of Puma affects the numbers of B lymphoid cells in
E-myc mice in the absence of Noxa. (A) White blood cell counts (means ± SEM) of
pre-neoplastic 4 week-old mice of the indicated noxa genotypes. Cell counts for Emyc mice of each of the noxa genotypes did not differ significantly, but the
differences from their non-transgenic counterparts were highly significant
(P < 0.0001). (B) Spleen weights (means ± SEM) of pre-neoplastic 5-6 week-old mice
of the indicated noxa genotypes. Differences between non-transgenic and E-myc or
E-myc/noxa-/- mice were significant (P < 0.001). Spleen weights of E-myc and Emyc/noxa-/- mice were similar (P = 0.76). (C) B lymphoid cell subset composition of
lymph nodes, peripheral blood and spleen from pre-neoplastic 5-6 week-old mice of
the indicated genotypes. Total cellularity and cell subset composition were
determined as described in Supplementary Figure 1. For lymph nodes, statistically
significant differences in addition to those indicated were noted for total cells and preB cells for E-myc vs E-myc/noxa-/-puma+/- mice. For peripheral blood, statistically
significant differences in addition to those indicated were noted for all comparisons
except between E-myc vs E-myc/noxa-/- mice. For spleen, statistically significant
differences in addition to those indicated were noted for total cells, virgin B cells and
mature B cells for E-myc vs E-myc/noxa-/-puma+/- mice and for total cells, pre-B
cells and virgin B cells for E-myc/noxa-/- and E-myc/noxa-/-puma-/- mice
3
Michalak et al
(P < 0.005). Values in (C) represent means ± SEM from 3-7 mice of each genotype. *
P < 0.05, ** P < 0.01, *** P < 0.005.
Supplementary Figure 5 Loss of Noxa does not enhance the survival of E-myc
transgenic B lymphoid cells in culture. Pro-B cells (A), pre-B cells (B) or virgin and
mature B cells (C) were sorted from the bone marrow of 5-6 week old healthy wt
mice or E-myc mice of the indicated noxa genotypes and cultured in simple medium
(no added cytokines) or treated with etoposide (1 g/mL) for the indicated times. Cell
viability was determined by FACS analysis as the percentage of Annexin V-PI- cells.
Data points represent means ± SEM of cells from 3-6 mice of each genotype.
Statistically significant differences noted: E-myc vs E-myc/noxa-/-puma-/- and Emyc/noxa-/- vs E-myc/noxa-/-puma-/-, P < 0.5 for pro-B cells and virgin/mature B cells
at 4 hours post etoposide only.
Supplementary Figure 6 Loss of Noxa does not accelerate lymphomagenesis in Emyc mice. Kaplan-Meier analysis of tumour-free survival of mice of the indicated
genotypes. Differences in tumour onset between E-myc and E-myc/noxa+/- or Emyc/noxa-/- mice were not significant (P = 0.18 and P = 0.13, respectively).
Supplementary Figure 7 Western blot analysis of p19Arf expression levels in
lymphomas from E-myc mice of the various puma and noxa genotypes. Western blot
analysis of p19Arf and -actin (loading control) on protein isolated from lymphoma
suspensions from E-myc mice of the indicated puma and noxa genotype. Lysates
from p53-/- mouse embryonic fibroblasts (MEF) or a tumour (E-myc tumours known
4
Michalak et al
to be positive for p19Arf) were included as positive controls for p19Arf overexpression. Protein size standards in kDa are indicated on the left-hand side.
Supplementary Figure 8 Assessment of p53 status and function in E-myc
lymphomas. (A) Genomic PCR of the Ink4A/arf locus revealed that no E-myc/puma/-
lymphoma was observed to have a deletion of this gene. Controls: E-myc
lymphoma cell line known to contain a deletion in the Ink4A/arf locus; spleen from an
Ink4A/arf deficient mouse; E-myc/p53-/- lymphoma known to retain the Ink4A/arf
locus; E-myc lymphoma known to retain the Ink4A/arf locus. (B) Assessment of p53
status and function in cohorts of E-myc lymphomas with or without Puma.
*Lymphoma cell lines displayed p53 deficiency-like resistance following in vitro
exposure to etoposide. ND = Not Done.
5