Supplemental TABLE 1: Table 1 Primers For ChIP forward reverse
advertisement
Supplemental TABLE 1: Table 1 Primers For ChIP forward reverse GAPDH TAGCTCAGGCCTCAAGACC ATGCGGCTGACTGTCGAAC GLUT1 CACCGAAGTCACCCAG TCGTTCTCTCTGCGTTG CCND1 CCGGGCTTTGATCTTTGCT TGCTACTGCGCCGACA IGFBP3 CTGGGCCACCCCGGCTTC GCGACAGTACACGGCGCGAA COL6A1 TCTGGATTGGAAACTACCGAA GCAGCTGAATCAAACGTCT DNAJC12 AAAAGCTCCCATTATCCTT AACTTGCCACATTAGCC GDF15 CAGCCACCTCTTAAACTCT CTGGGCCTCAGTATCCTC IGFBP3 GLUT1 CCND1 VEGF ACTIN RBP2 PLU-1 JARID1C COL6A1 DANJC12 GDF15 DEP-1 SGK2 CASP1 HIF2α Table 2 Primers For Real time PCR forward reverse CAGAGCACAGATACCCAGAAC AGCACATTGAGGAACTTCAGG TCATCGTGGCTGAACTCTTC GATGAAGACGTAGGGACCAC CATCTACACCGACAACTCCATC TCTGGCATTTTGGAGAGGAAG GGCAGCTTGAGTTAAACGAAC AGCGTGGTTTCTGTATCGATC ATCGTCCACCGCAAATGCTTCTA AGCCATGCCAATCTCATCTTGTT AGACTCAACACATATGGCGG CTAGCTTCCGTTTCCGTTTCT GGAACTTTACCAGACTTTACTTGC AGGCGTCTCTTCAGTTTTCTC GGCTTACTGGAGAATGGAGAC TCAGGCAGTTCCAACACAG CTTCGTCGTCAAGGTCATCG CTGCACCACACCCGCGTA TCTTCGGTTGAACAAATCCTG GTCAGAATCTCCTTTGCCTTC AGTCCGGATACTCACGCCAGA CGGAACAGAGCCCGGTGAAG CTCCAGCACCTTCTACAACA CCATGCTAAGCCGATCTCC ATTGGCTACCTGCACTCCC AGAGGCCAAAATCCGTCAGCA CAAGAATATGCCTGTTCCT CATCTGCGCTCTACCAT CCCATGTCTCCACCTTCAAG CCCATGTCTCCACCTTCAAG Supplemental Materials and Methods: Immunoprecipitation: 293T cells were seeded 100 mm dish and were transfected with 1 µg of constructs encoding pCDNA3-HA-HIF2α-DPA or 1µg of constructs encoding p3xFlagCMVJARID1C separately or together. One day after transfection, the cells were extracted with high salt lysis buffer (1% NP-40, 20mM Tris-HCl, pH 8.1, 420mM NaCl). To immunoprecipitate HIF-2α, cell extracts were diluted with EBC Lysis buffer first, then incubated with 1 μg anti-HIF-2α antibody (Novus, NB-100-480) for six hours and protein A–Sepharose beads (Roche) for two hours at 4°C. To immunoprecipitate Flag-JARID1C, ANTI-FLAG M2 Affinity Gel (Sigma-Aldrich, A2220) was used. The immunoprecipitated proteins were analyzed with anti-HA and Monoclonal ANTI-FLAG M2-Peroxidase Clone M2 (Sigma-Aldrich). In vitro H3K4Me3 demethylation assay: 786-O VHL+/+ and VHL-/- cells were harvested with EBC Lysis buffer. 2mg of 786-O VHL+/+ proteins and 1.5 mg of 786-O VHL-/- proteins were used to immunoprecipitate JARID1C. 1 µg of JARID1C antibody (Bethyl laboratories, A301-034A) or control antibody was added to each lysate, and bound proteins were captured and eluted with native elution buffer to preserve the enzymatic activity according to the instruction of the Catch and Release Reversible Immunoprecipitation System (Millipore, 17-500). The native eluates were dialyzed in slide-a-lyzer mini dialysis units (Thermo Scientific, 69570) against 1 liter demethylation buffer overnight at 4°C (20 mM Tris-HCl, pH 7.5; 150 mM NaCl; 50 µM [NH4]2Fe[SO4]2·6H2O; 1 mM α-ketoglutarate; 2 mM ascorbic acid). After dialysis, 10µg histone from calf thymus (Sigma, H9250-100mg) was mixed with each of the dialyzed native eluate. The demethylation reaction was incubated at 37°C for 0, 0.5, 1, and 3 hours, and the samples were boiled with samples buffer and analyzed with Western blotting. Supplemental Figure 1: Figure S1. Stable HIF2α induces JARID1C and reduces H3K4Me3 level. ACHN cells stably expressing an empty vector, a stable and functional HIF2 mutant (HIF2-dPA), and a stable but non-functional HIF2 mutant (HIF2-dPA-dTA) were analyzed with indicated antibodies. Supplemental Figure 2: Figure S2. pVHL does not affect the stability of JARID1C. A. 786-O VHL+/+, 786-O VHL-/- cells were treated with 10g/ml cycloheximide (CHX) for the indicated times. The lysates were analyzed with the indicated antibodies. B. 786-O VHL+/+, 786-O VHL-/- cells were treated with 10M proteasome inhibitor MG132 for the indicated times. The lysates were analyzed with the indicated antibodies. Supplemental Figure 3: Figure S3. JARID1C binds to HIF2. A. Flag-JARID1C and HA-HIF2 were expressed in 293T cells as indicated. Anti-Flag immunoprecipitates were analyzed with the indicated antibodies. B. Flag-JARID1C and HA-HIF2 were expressed in 293T cells as indicated. Anti-HIF2 immunoprecipitates were analyzed with the indicated antibodies. Supplemental Figure 4: Figure S4. In vitro H3K4Me3 demethylation assay with JARID1C purified from 786O VHL+/+ and 786-O VHL-/- cells. A. Control IP or Anti-JARID1C IP of 786-O VHL+/+ and 786-O VHL-/- lysates were eluted with non-denaturing elution buffer and analyzed with anti-JARID1C antibody. Similar amount of JARID1C proteins were purified from both cell lines. B. The proteins eluted with non-denaturing elution buffer were mixed with histones and assayed for the HeK4Me3 demethylase activity. The mixtures were analyzed with the indicated antibodies.
