Modifying Enzymes
Restriction Enzymes:







Biology and Activity of Restriction Endonucleases
Cutting DNA with Restriction Endonucleases
Restriction Mapping
Factors that Influence Restriction Enzyme Activity
DNA Ligation
Polymerases
o E. coli DNA Polymerase I
o Klenow Fragment of E. coli DNA Polymerase I
o T4 DNA Polymerase
o T7 DNA Polymerase
o Thermostable DNA Polymerases (Taq, Pfu, Vent,
etc.)
o Terminal Transferase
o Reverse Transcriptases
o Bacteriophage RNA Polymerases
Other DNA Modifying Enzymes
o Nucleases: DNase and RNase
o DNA Ligase
o Alkaline Phosphatase
o Polynucleotide Kinase
Biology and Activity of Restriction Endonucleases
Restriction endonucleases are enzymes that cleave the sugar-phosphate backbone of
DNA. In most practical settings, a given enzyme cuts both strands of duplex DNA
within a stretch of just a few bases. Several thousand different restriction
endonucleases have been isolated, which collectively exhibit a few hundred different
sequence (substrate) specificities.
Restriction-Modification Systems
A large majority of restriction enzymes have been isolated from bacteria, where
they appear to serve a host-defense role. The idea is that foreign DNA, for example
from an infecting virus, will be chopped up and inactivated ("restricted") within the
bacterium by the restriction enzyme.
The presence of restriction enzymes immediately begs the question of why they do not
chew up the genomic DNA of their host. In almost all cases, a bacterium that makes a
particular restriction endonuclease also synthesizes a companion DNA methyltransferase,
which methylates the DNA target sequence for that restriction enzyme, thereby protecting
it from cleavage. This combination of restriction endonuclease and methylase is referred
to as a restriction-modification system.
By convention, restriction enzymes are named after their host of origin. For example,
EcoRI was isolated from Escherichia coli (strain RY13), Hind II and Hind III from
Haemophilus influenzae, and XhoI from Xanthomonas holcicola.
Restriction Enzyme Recognition Sequences
The substrates for restriction enzymes are more-or-less specific sequences of doublestranded DNA called recognition sequences. Examining the following table will
illustrate some important points (recognition sites are shown as double stranded DNA).
The length of restriction recognition sites varies: The enzymes EcoRI, SacI and SstI
each recognize a 6 base-pair (bp) sequence of DNA, whereas NotI recognizes a sequence
8 bp in length, and the recognition site for Sau3AI is only 4 bp in length. Length of the
recognition sequence dictates how frequently the enzyme will cut in a random
sequence of DNA. Enzymes with a 6 bp recognition site will cut, on average, every 46 or
4096 bp; a 4 bp recognition site will occur roughly every 256 bp.
Different restriction enzymes can have the same recognition site - such enzymes are
called isoschizomers: Look at the recognition sites for SacI and SstI - they are identical.
In some cases isoschizomers cut identically within their recognition site, but sometimes
they do not. Isoschizomers often have different optimum reaction conditions, stabilities
and costs, which may influence the decision of which to purchase.
Restriction recognitions sites can be unambiguous or ambiguous: The enzyme
BamHI recognizes the sequence GGATCC and no others - this is what is meant by
unambiguous. In contrast, HinfI recognizes a 5 bp sequence starting with GA, ending in
TC, and having any base between (in the table, "N" stands for any nucleotide) - HinfI has
an ambiguous recognition site. XhoII also has an ambiguous recognition site: Py stands
for pyrimidine (T or C) and Pu for purine (A or G), so XhoII will recognize and cut
sequences of AGATCT, AGATCC, GGATCT and GGATCC.
The recognition site for one enzyme may contain the restriction site for another: For
example, note that a BamHI recognition site contains the recognition site for Sau3AI.
Consequently, all BamHI sites will cut with Sau3AI. Similarly, one of the four possible
XhoII sites will also be a recognition site for BamHI and all four will cut with Sau3AI.
One other point to notice from the table above is that most recognition sequences are
palindromes - they read the same forward (5' to 3' on the top strand) and backward (5' to
3' on the bottom strand). Most, but certainly not all recognition sites for commonly-used
restriction enzymes are palindromes. Most restriction enzymes bind to their
recognition site as dimers (pairs), as depicted for the enzyme PvuII in the figure to the
right.
One other point to notice from the table above is that most recognition sequences are
palindromes - they read the same forward (5' to 3' on the top strand) and backward (5' to
3' on the bottom strand). Most, but certainly not all recognition sites for commonly-used
restriction enzymes are palindromes. Most restriction enzymes bind to their
recognition site as dimers (pairs), as depicted for the enzyme PvuII in the figure to the
right.
Patterns of DNA Cutting by Restriction Enzymes
Restriction enzymes hydrolyze the backbone of DNA between deoxyribose and
phosphate groups. This leaves a phosphate group on the 5' ends and a hydroxyl on the 3'
ends of both strands. A few restriction enzymes will cleave single stranded DNA,
although usually at low efficiency.
The restriction enzymes most used in molecular biology labs cut within their
recognition sites and generate one of three different types of ends. In the diagrams
below, the recognition site is boxed in yellow and the cut sites indicated by red triangles.

5' overhangs: The enzyme cuts asymmetrically within the recognition site such
that a short single-stranded segment extends from the 5' ends. BamHI cuts in this
manner.

3' overhangs: Again, we see asymmetrical cutting within the recognition site, but
the result is a single-stranded overhang from the two 3' ends. KpnI cuts in this
manner.

Blunts: Enzymes that cut at precisely opposite sites in the two strands of DNA
generate blunt ends without overhangs. SmaI is an example of an enzyme that
generates blunt ends.
The 5' or 3' overhangs generated by enzymes that cut asymmetrically are called sticky
ends or cohesive ends, because they will readily stick or anneal with their partner by base
pairing.
Cutting DNA With Restriction Endonucleases
A large number of restriction enzymes are commercially available, and one of the best
sources of information about their characteristics and conditions of use is to be
found in the reference sections of supplier's catalogs or on their web sites.
For a first-time user, at least three items deserve emphasis regarding restriction
digestions:

Restriction enzymes are expensive (some much more than others)

Restriction enzymes are, in general, heat labile: Enzymes should be kept at 20C except for brief periods of time on ice or in a small freezer box. It is
distressingly easy to leave a little box of enzymes on the lab bench overnight and
lose several hundred dollars.

Contaminating one enzyme with small quantities of another can cause
massive confusion and loss of time to yourself and your coworkers: Never
pipet an enzyme with anything other than a new pipet tip!
Setting up a simple restriction digestion is easy - there are three mandatory
ingredients that need to end up in the same tube:

DNA: Reliable cleavage by restriction enzymes requires DNA that is free from
contaminants such as phenol or ethanol. Excessive salt will also interfere with
digestion by many enzymes, although some are more tolerant of that problem.

An appropriate buffer: Different enzymes cut optimally in different buffer
systems, due to differing preferences for ionic strength and major cation. When
you purchase an enzyme, the company almost invariably sends along the
matching buffer as a 10X concentrate.

The restriction enzyme! Don't laugh - at some point in your career, you'll set up
a group of digests, forget to add the enzyme, and wonder why nothing cut.
The amount of DNA to be used depends on the task at hand, but for the sake of example,
consider a typical diagnostic digestion to confirm the identity of a plasmid:
In this case, 1 microgram (ug) of DNA should suffice and 20 ul would be a convenient
volume for the reaction.
After deciding which enzyme to use, look in the supplier's catalog to determine which
buffer and incubation temperature is recommended. Into a microcentrifuge centrifuge
pipet 2 ul of 10X buffer, the DNA and enough water to bring the total volume to 20 ul.
Add the enzyme last - most are provided at a concentration of 10 to 20 units per ul, and 12 units would suffice for this type of digestion.
It is important to mix the reaction, which is easily done by "flicking" the tube and then
shaking down its contents. Incubate the reaction at the recommended temperature for 30
to 60 minutes, then analyze by gel electrophoresis.
The senario described above is meant as an overview of a typical reaction. There are
many variations on the theme and factors that influence enzyme activity. Another
common practice is to include in the reaction a small quantity of a protein like bovine
serum albumin, which often enhances the reaction, particularly when the DNA is not
exceptionally pure.
Restriction Mapping
A restriction map is a description of restriction endonuclease cleavage sites within a
piece of DNA. Generating such a map is usually the first step in characterizing an
unknown DNA, and a prerequisite to manipulating it for other purposes. Typically,
restriction enzymes that cleave DNA infrequently (e.g. those with 6 bp recognition sites)
and are relatively inexpensive are used to produce at a map.
The DNA to be restriction mapped it usually contained within a well-characterized
plasmid or bacteriophage vector for which the sequence is known. In fact, there are
usually multiple known restriction sites immediately flanking the uncharacterized DNA,
which facilitates making the map. In the following discussion, it is assumed that the
unknown DNA has been inserted into a plasmid vector, but the principles can readily be
applied to other situations.
Creating a Map by Digesting DNA with Multiple Restriction Enzymes
The most straightforward method for restriction mapping is to digest samples of the
plasmid with a set of individual enzymes, and with pairs of those enzymes. The
digests are then "run out" on an agarose gel to determine sizes of the fragments
generated. If you know the fragment sizes, it is usually a fairly easy task to deduce where
each enzyme cuts, which is what mapping is all about.
To illustrate these idea, consider a plasmid that contains a 3000 base pair (bp)
fragment of unknown DNA. Within the vector, immediately flanking the unknown
DNA are unique recognition sites for the enzymes Kpn I and BamH I. As illustrated in
the figure below, consider first seperate digestions with Kpn I and BamH I:
Digestion with Kpn I yields two fragments: 1000 bp and "big". Since there is a single
Kpn I site in the vector, the presence of a 1000 bp fragment tells you that there is also a
single Kpn I site in the unknown DNA and that it is 1000 bp from the Kpn I in the vector.
The "big" fragment consist of the vector plus the remaining 2000 bp of the unknown.
Digestion with BamH I yields 3 fragments: 600, 2200 and "big". The "big" fragment is
again the vector plus a little bit (200 bp in this case) of unknown DNA. The presence of
600 and 2200 bp fragments indicate that there are two BamH I sites in the unknown. You
can deduce immediately that one BamH I site is 2800 bp (600 + 2200) from the BamH I
in the vector. The second BamH I site can be in one of two positions: 600 or 2200 bp
from the BamH I site in the vector. At this point, there is no way to know which of these
alternative positions is correct.
The trick to determining where the second BamH I site is located is to digest the plasmid
with Kpn I and BamH I together (click the diagram below with your mouse to see this
effect). This so-called double digest yields fragments of 600, 1000 and 1200 bp (plus the
"big" fragment). The 600 bp fragment is the same as obtained by digestion with BamH I
alone. The 1000 and 1200 bp fragments tell you that Kpn I cut within the 2200 bp BamH
I fragment observed when the plasmid was cut with BamH I alone. You already know
where Kpn I cuts in the unknown DNA, and you therefore now know the location of the
second BamH I site!
If the process outlined above were conducted with a larger let of
enzymes, a much more complete map would result. In essense,
single digests are used to determine which fragments are in
the unknown DNA, and double digests to order and orient
the fragments correctly.
Success in using this technique depends upon obtaining
complete digestion of the DNA with each of the enzymes
used! Partial digestion will yield fragments that are ultimately a
great source of confusion. One way to avoid this problem is to add up the estimated sizes
of all the fragments in each lane - if they don't sum to roughly that of the intact DNA, it is
likely that digestion was not complete. One other thing to watch for is the presence of
two fragments of roughly the same size, that may appear to be one fragment on an
agarose gel. This situation is often suspected by observing an abnormally bright fragment
on an ethidium-stained gel, or by a fragment being broader than expected.
Creating a Map by Partial Digests of End-Labeled DNA
If a fragment of DNA is labeled with a radioisotope on only one end, it can be
partially digested with restriction enzymes to generate labeled fragments that
directly reveal where the cleavage sites are located. Partial digestion, which is usually
something to be avoided, is performed by using very small amounts of enzyme or short
periods of time.
As an example of how this procedure is applied, consider the diagram to the right.
The fragment of DNA to be mapped for Pst I sites is contained within a plasmid and
flanked by restriction recognition sites that are not present in the fragment itself - in this
case, Not I and EcoR I. The steps that might be taken to map this fragment by partial
digestion are:
1. Digest the plasmid to completion with EcoR I, then label the ends of the
linearized plasmid with radioactive nucleotides.
2. Digest the labeled DNA with Not I, run the digest on an agarose gel, and isolate
the fragment of interest, which now is labeled on only one end. This DNA is the
substrate to be used for partial digestion.
3. Perform a partial digest the end-labeled fragment with Pst I - in addition to the
full length fragment, this will generate 4 additional radiolabeled fragments.
4. Seperate the labeled partial digestion products on an agarose gel, and expose the
gel to Xray film (autoradiography) to visualize the sizes of the labeled fragments.
By incorporating labeled molecular weight markers (not shown in diagram), the
sizes of the partial digestion fragments can be deduced, and hence the positions of
all the Pst I recognition sites.
A single preparation of end-labeled DNA can be used for mapping recognition sites for
several different restriction enzymes, making this an efficient means of generating
comprehensive maps. There are, however, at least two potential problems that can cause
problems in interpretation:


For a given enzyme, some recognition sites can be cleaved much less efficiently
than others. The cause of this problem is usually not known, but it can lead one to
miss mapping of certain sites.
If is difficult to map sites near the ends of the fragment. For this reason, it is often
best to perform the procedure twice, with preparations of fragment labeled at
opposite ends (e.g. in the example, one preparation labeled at the EcoR I end and
one labeled at the Not I end).
Using a Computer to Generate Restriction Maps
All of the techniques described above for generating a restriction map assume that you
don't have the sequence of the DNA. If the sequence is known, it is a simple matter to
feed that sequence into any number of computer programs, which will search the
sequence for dozens of restriction enzyme recognition sites and build a map for you.
One such program you can use is Mapper, available as part of the Molecular Toolkit.
Factors that Influence Restriction Enzyme Activity
It is not uncommon to have difficulties in digesting DNA with restriction enzymes. At
times, the DNA does not appear to cut at all and sometimes it cuts only partially. If the
sequence is known, restriction sites can be predicted with accuracy, but in the lab, an
enzyme may cut more often than it should or at the wrong sites. In some cases, these
unexpected results point to a problem not related to technique - for example, the sequence
you have may be incorrect, or a restriction map provided by a colleague could be in error.
However, there are a number of commonly-encountered situtions that influence how well
restriction enzymes cut, and it is important to be aware of these for troubleshooting.
Buffer Composition
Different restriction enzymes have differing preferences for ionic strength (salt
concentration) and major cation (sodium or potassium). A battery of 3 to 4 different
buffers will handle a large number of available enzymes, although there are a few that
require a unique buffer environment. In all cases, a major function of the buffer is to
maintain pH of the reaction (usually at 8.0). Additionally, some enzymes are more fussy
about having their optimal buffer than other enzymes. Clearly, use of the wrong buffer
can lead to poor cleavage rates.
Incubation Temperature
Most restriction enzymes cut best at 37C, but there are many exceptions. Enzymes
isolated from thermophilic bacteria cut best at temperatures ranging from 50 to 65C.
Some other enzymes have a very short half life at 37C and its recommended that they be
incubated at 25C.
Influence of DNA Methylation
Almost all strains of E. coli bacteria used for propagating cloned DNA contain two sitespecific DNA methylases:

Dam methylase adds a methyl group to the adenine in the sequence GATC,
yielding a sequence symbolized as GmATC.

Dcm methylase methylates the internal cytosine in CC(A/T)GG, generating the
sequence CmC(A/T)GG.
The practical importance of this phenomenon is that a number of restriction
endonucleases will not cleave methylated DNA. A few examples relative to Dam
methylation should illustrate this concept:
MboI and Sau3AI are isoschizomers that recognize and cleave the sequence GATC,
which is precisely the sequence recognized by Dam methylase. Digestion of GmATC by
MboI is completely inhibited, while digestion by Sau3AI is unaffected by methylation.
The recognition site for ClaI is ATCGAT, which is not a substrate for Dam methylase.
However, if that sequence is followed by a C or preceeded by a G, a Dam recognition site
is generated and cleavage by ClaI is inhibited. Thus, a random sequence of DNA
propagated in most strains of E. coli, half of the ClaI recognition sites will not cut.
The take-home message here is that if DNA unexpectedly does not cut or cuts only
partially, check that the enzyme in question is not methylation-sensitive.
Star Activity
When DNA is digested with certain restriction enzymes under non-standard conditions,
cleavage can occur at sites different from the normal recognition sequence - such aberrent
cutting is called "star activity". An example of an enzyme that can exhibit star activity is
EcoRI; in this case, cleavage can occur within a number of sequences that differ from the
canonical GAATTC by a single base substitutions.
So what constitutes non-standard conditions? Examples that may induce star activity
include:




High pH (>8.0) or low ionic strength (e.g. if you forget to add the buffer)
Glycerol concentrations > 5% (enzymes are usually sold as concentrates in 50%
glycerol)
Extremely high concentration of enzyme (>100 U/ug of DNA)
Presence of organic solvents in the reaction (e.g. ethanol, DMSO)
Digestion with Multiple Enzymes
Digesting DNA with two enzymes is a commonplace task, and oftentimes the two
enzymes have different buffer requirements. There are at least three ways to handle this
situation:

Digest with both enzymes in the same buffer. In many cases, even those a given
buffer is not optimal for an enzyme, you can still get quite good cleavage rates.
Enzyme manufacturer catalogs usually contain a reference table recommended the
best single buffer for conducting specific double digests.

Cut with one enzyme, then alter the buffer composition and cut with the second
enzyme. This usually applies to situations where one enzyme like a low salt buffer
and the other a high salt buffer, in which case you can digest with the first enzyme
for a time, add a calculated amount of concentrated NaCl and cut with the second
enzyme.

Change buffers between digestion with two enzymes. In some cases, two enzymes
will have totally incompatible buffers. In that case, perform one digestion, recover
the DNA (usually by precipitation) and resuspend in the buffer appropriate for the
second enzyme.
Variability In Digestion of Different DNA Substrates
The efficiency with which a restriction enzyme cuts it's recognition sequence at different
locations in a piece of DNA can vary 10 to 50-fold. This is apparently due to influences
of sequences bordering the recognition site, which perhaps can either enhance or inhibit
enzyme binding or activity.
A related situation is seen when restriction recognition sites are located at or very close to
the ends of linear fragments of DNA. Most enzymes require a few bases on either side of
their recognition site in order to bind and cleave. Many of the companies that sell
enzymes provide a table in their catalog that presents "end requirements" for a variety of
enzymes.
DNA Ligation
The term recombinant DNA encapsulates the concept of recombining fragments of DNA
from different sources into a new, and hopefully useful DNA molecule. Joining linear
DNA fragments together with covalent bonds is called ligation. More specifically,
DNA ligation involves creating a phosphodiester bond between the 3' hydroxyl of one
nucleotide and the 5' phosphate of another.
The enzyme used to ligate DNA fragments is T4 DNA ligase, which originates from
the T4 bacteriophage. This enzyme will ligate DNA fragments having overhanging,
cohesive ends that are annealed together, as in the EcoRI example below - this is
equivalent to repairing "nicks" in duplex DNA. T4 DNA ligase will also ligate fragments
with blunt ends, although higher concentrations of the enzyme are usually recommended
for this purpose.
A ligation reaction requires three ingredients in addition to water:

Two or more fragments of DNA that have either blunt or compatible cohesive
("sticky") ends.

A buffer which contains ATP. The buffer is usually provided or prepared as a
10X concentrate which, after dilution, yields an ATP concentration of roughly
0.25 to 1 mM. Most restriction enzyme buffers will work if supplemented with
ATP.

T4 DNA ligase. A typical reaction for inserting a fragment into a plasmid vector
(subcloning) would utilize about 0.01 (sticky ends) to 1 (blunt ends) units of
ligase.
The optimal incubation temperature for T4 DNA ligase is 16C and when very high
efficiency ligation is desired (e.g. making libraries) this temperature is recommended.
However, ligase is active at a broad range of temperatures, and for routine purposes such
as subcloning, convenience often dictates incubation time and temperature - ligations
performed at 4C overnight or at room temperature for 30 minutes to a couple of hours
usually work well.
The figure to the right depicts the effects of T4 DNA ligase. DNA fragments generated
by digestion of a plasmid with two restriction enzymes were incubated with different
amounts of ligase for varying periods of time, then electrophoresed in 1% agarose. Note
that even after 5 minutes with ligase, essentially all the fragments have been ligated to
one another, and shifted to higher molecular weights. Click on the image for details. This
simple test is sometimes useful to check a tube of ligase suspected of being "dead".
E. coli DNA Polymerase IThe E. coli DNA polymerase I is a DNA-dependent DNA
polymerase that possesses both 3' -> 5' and 5' -> 3' exonuclease activities. It is a
single-chain protein with a mass of about 109,000 Da that requires magnesium as a
cofactor. Each of its three enzymatic activities are encapsulated into distinct domains of
the holoenzyme, such that proteolytic deletions can be generated that lack one or more of
the activities. The so-called Klenow fragment is one such molecule that is widely used in
recombinant DNA work.
DNA polymerase I was used frequently in the early days of recombinant DNA
technology for radiolabeling DNA and synthesizing cDNA. However, other enzymes
have proven to be more effective for these purposes, including a proteolytic fragment of
DNA polymerase I called Klenow fragment and T4 DNA polymerase. The holoenzyme
DNA polymerase I is no longer frequently used.
Large (Klenow) Fragment of E. coli DNA Polymerase IThe 5' -> 3' exonuclease
activity of E. coli's DNA polymerase I makes it unsuitable for many applications.
However, this pesky enzymatic activity can readily be removed from the holoenzyme.
Exposure of DNA polymerase I to the protease subtilisin cleaves the molecule into a
small fragment, which retains the 5' -> 3' exonuclease activity, and a large piece called
Klenow fragment. The large or Klenow fragment of DNA polymerase I has DNA
polymerase and 3' -> 5' exonuclease activities, and is widely used in molecular
biology.
In addition to generating Klenow fragment by proteolysis, it can be expressed in bacteria
from a truncated form of the DNA polymerase I gene. The enzyme you purchase is
almost certainly produced in this manner.
Klenow fragment is useful for several tasks:
Synthesis of double-stranded DNA from single-stranded templates: The function of
DNA polymerases is to synthesize complementary strands during DNA replication.
Performing that task in the lab is integral to such processes as synthesizing the second
strand DNA in cDNA cloning and generating radioactive probes for hybridization
reactions.
DNA polymerases require a primer to provide a free 3' hydroxyl group for initiation of
synthesis. The primers used for most in vitro polymerization reactions are single-stranded
DNAs, typically 6 to 20 bases in length, called oligonucleotides. The oligonucleotides
must be complemenary to some section of template DNA. To use Klenow to synthesize a
complementary strand of DNA, one simply mixes single-stranded template (usually
denatured double-standed DNA), primers and the enzyme in the presence of an
appropriate buffer (most restriction enzyme buffers work well). The reaction proceeds are
depicted below:
One item of some significance in the above reaction is that as Klenow proceeds, it can
displace primers downstream and continue synthesizing new DNA.
Filling in recessed 3' ends of DNA fragments: A "fill-in" reaction is used to create
blunt ends on fragments created by cleavage with restriction enzymes that leave 5'
overhangs. This reaction is conceptually identical to the one described above, but with a
huge primer and a very short segment of single-stranded template.
Digesting away protruding 3' overhangs: This is another method for producing blunt
ends on DNA, in this with ends generated from restriction enzymes that cleave to
produce 3' overhangs. The 3' -> 5' exonuclease activity of Klenow will digest away the
protruding overhang. Removal of nucleotides from the 3' ends will continue, but, in the
presence of nucleotides, the polymerase activity will balance the exonuclease activity,
yielding blunt ends. This reaction is more efficienty conducted with T4 DNA polymerase,
which has much more potent exonuclease activity.
Preparation of radioactive DNA probes: Examine each of the reactions depicted above.
What if the nucleotides used were in the reaction were radioactive? That's correct - the
radioactive nucletides would be incorporated into the DNA fragment. Klenow fragment is
used frequently to prepare DNA that is labeled with radionuclides or other markers.
In some situations, the 3' -> 5' exonuclease activity of Klenow fragment is either
undesirable or not necessary. By introducing mutations in the gene that encodes
Klenow, forms of the enzyme can be expressed that retain polymerase activity, but lack
any exonuclease activity. These forms are the enzyme are usually called exo- Klenow
fragment.
T7 DNA Polymerase
The DNA polymerase of T7 bacteriophage has DNA polymerase and 3' -> 5'
exonuclease activities, but lacks a 5' -> 3' exonuclease domain. It is thus very similar
in activity to Klenow fragment and T4 DNA polymerase.
The claim to fame for T7 DNA polymerase is it's processivity. That is to say, the
average length of DNA synthesized before the enzyme dissociates from the template is
considerably greater than for other enzymes. Due to this talent, the principle use of T7
DNA polymerase is in DNA sequencing by the chain termination technique.
T7 DNA polymerase can be chemically-treated or genetically engineered to abolish it's 3'
-> 5' exonuclease activity. These forms of the enzyme are marketed under the name
Sequenase and Sequenase 2.0, and are widely used for DNA sequencing reactions.
T4 DNA Polymerase
T4 is a bacteriophage of E. coli. The activities of T4 DNA polymerase are very similar
to Klenow fragment of DNA polymerase I - it functions as a 5' -> 3' DNA polymerase
and a 3' -> 5' exonuclease, but does not have 5' -> 3' exonuclease activity.
In general, T4 DNA polymerase is used for the same types of reactions as Klenow
fragment, particularly in blunting the ends of DNA with 5' or 3' overhangs. There are
however, two differences between the two enzymes that have practical signficance:

The 3' -> 5' exonuclease activity of T4 DNA polymerase is roughly 200 times that
of Klenow fragment, making it preferred by many investigators for blunting
DNAs with 3' overhangs.
While Klenow fragment will displace downstream oligonucleotides as it polymerizes, T4
DNA polymerase will not. This attribute makes T4 DNA polymerase the more efficient
choice for certain types of oligonucleotide mutagenesis reactions.
Thermostable DNA Polymerases
It is interesting how some seemingly esoteric or obscure
discoveries can, years later, be catapulted to something of
immense practical importance. Such is the history of Taq
DNA polymerase. The original report of this enzyme,
purified from the hot springs bacterium Thermus aquaticus,
was
published in 1976. Roughly 10 years later, the polymerase chain reaction was developed
and shortly thereafter "Taq" became a household word in molecular biology circles.
Currently, the world market for Taq polymerase is in the hundreds of millions of dollars
each year.
The thermophilic DNA polymerases, like other DNA polymerases, catalyze
template-directed synthesis of DNA from nucleotide triphosphates. A primer having
a free 3' hydroxyl is required to initiate synthesis and magnesium ion is necessary. In
general, they have maximal catalytic activity at 75 to 80C, and substantially reduced
activites at lower temperatures. At 37C, Taq polymerase has only about 10% of its
maximal activity.
In addition to Taq DNA polymerase, several other thermostable DNA polymerases have
been isolated and expressed from cloned genes. Three of the most-used polymerases are
described in the following table:
Polymerase
3'->5'
Exonuclease
Source and Properties
Taq
No
From Thermus aquaticus. Halflife at 95C
is 1.6 hours.
Pfu
Yes
From Pyrococcus furiosus. Appears to
have the lowest error rate of known
thermophilic DNA polymerases.
Vent
Yes
From Thermococcus litoralis; also
known as Tli polymerase. Halflife at 95
C is approximately 7 hours.
In addition to the native polymerases listed in the table above, a number of mutants have
been generated and are available, for example, a form of Vent polymerase that lacks the
3'->5' exonuclease and is thereby more similar to Taq.
One of the most discussed characteristics of thermostable polymerases is their error
rate. Error rates are measured using several different assays, and as a result, estimates of
error rate vary, particularly when the assays are performed by different labs. As would be
expected from first principles, polymerases lacking 3'->5' exonuclease activity
generally have higher error rates than the polymerases with exonuclease activity.
The total error rate of Taq polymerase has been variously reported between 1 x 10-4 to 2 x
10-5 errors per base pair. Pfu polymerase appears to have the lowest error rate at roughly
1.5 x 10-6 error per base pair, and Vent is probably intermediate between Taq and Pfu.
Error rate is not the only consideration in chosing a polymerase for PCR, otherwise
Taq polymerase would not continue to be the most widely used enzyme by far for the
myriad of PCR applications. Other considerations, including reliability and what might
be called "fussiness" enter into the choice, as discussed further in the section on
Polymerase Chain Reaction Technology.
Terminal Transferase
Terminal transferase catalyzes the addition of nucleotides to the 3' terminus of
DNA. Interestingly, it works on single-stranded DNA, including 3' overhangs of
double-stranded DNA, and is thus an example of a DNA polymerase that does not
require a primer. It can also add homopolymers of ribonucleotides to the 3' end of
DNA.
The much preferred substrate for this enzyme is protruding 3' ends, but it will also, less
efficiently, add nucleotides to blunt and 3'-recessed ends of DNA fragments. Cobalt is a
necessary cofactor for activity of this enzyme.
Terminal transferase is useful for at least two procedures:
Labeling the 3' ends of DNA: Most commonly, the substrate for this reaction is a
fragment of DNA generated by digestion with a restriction enzyme that leaves a 3'
overhang, but oligodeoxynucleotides can also be used. When such DNA is incubated
with tagged nucleotides and terminal transferase, a string of the tagged nucleotides will
be added to the 3' overhang or to the 3' end of the oligonucleotide.
Adding complementary homopolymeric tails to DNA: This clever procedure was
commonly used in the past to clone cDNAs into plasmid vectors, but has largely been
replaced by other, much more efficient techniques. The principles of this technique are
depicted in the figure below. Basically, terminal transferase is used to tail a linearized
plasmid vector with G's and the cDNA with C's. When incubated together, the
compementary G's and C's anneal to "insert" the cDNA into the vector, which is then
transformed into E. coli.
Terminal transferase is a mammalian enzyme, expressed in lymphocytes. The
enzyme purchased commercially is usually produced by expression of the bovine gene in
E. coli.
Reverse Transcriptases
Reverse transcriptase is a common name for an enzyme that
functions as a RNA-dependent DNA polymerase. They are encoded
by retroviruses, where they copy the viral RNA genome into DNA
prior to its integration into host cells.
Reverse transcriptases have two activities:

DNA polymerase activity: In the retroviral life cycle, reverse transcriptase
copies only RNA, but, as used in the laboratory, it will transcribe both singlestranded RNA and single-stranded DNA templates with essentially equivalent
efficiency. In both cases, an RNA or DNA primer is required to initiate synthesis.

RNase H activity: RNase H is a ribonuclease that degrades the RNA from RNADNA hybrids, such as are formed during reverse transcription of an RNA
template. This enzyme functions as both an endonuclease and exonuclease in
hydrolyzing its target.
All retroviruses have a reverse transcriptase, but the enzymes that are available
commercially are derived from one of two retroviruses, either by purification from the
virus or expression in E. coli:


Moloney murine leukemia virus: a single polypeptide
Avian myeloblastosis virus: composed of two peptide chains
Both enzymes have the same fundamental activities, but differ in a number of
characteristics, including temperature and pH optima. Most importantly, the murine
leukemia virus enzyme has very weak RNase H activity compared to the avian
myeloblastosis enzyme, which makes it the clear choice when trying to synthesize
complementary DNAs for long messenger RNAs.
Reverse transcriptase is used, as you might expect, to copy RNA into DNA. This task
is integral to cloning complementary DNAs (cDNAs), which are DNA copies of mature
messenger RNAs. Cloning cDNAs is discussed elsewhere in more depth, but the
technique is usually initiated by mixing short (12-18 base) polymers of thymidine (oligo
dT) with messenger RNA such that they anneal to the RNA's polyadenylate tail. Reverse
transcriptase is then added and uses the oligo dT as a primer to synthesize so-called firststrand cDNA.
Another common use for reverse transcriptase is to generate DNA copies of RNAs
prior to amplifying that DNA by polymerase chain reaction (PCR). Reverse
transcription PCR, usually called simply RTPCR, is a stupifyingly useful tool for such
things as cloning cDNAs, diagnosing microbial diseases rapidly and a myriad of other
applications. In most cases, standard preparations of reverse transcriptase are used for
RTPCR, but mutated forms with relatively high thermal stability have been developed to
facilitate the process.
Bacteriophage RNA Polymerases
Phage-encoded DNA-dependent RNA polymerases are used for in vitro
transcription to generate defined RNAs. Most commonly, the reaction utilizes
ribonucleotides that are labeled with radionuclides or some other tag, and the resulting
labeled RNA is used as a probe for hybridization. Other applications of in vitro
transcription including making RNAs for in vitro translation or to study RNA struction
and function.
Several bacteriophage RNA polymerases are commercially available. They are
named after the phage that encodes them, and either purified from phage-infected
bacteria or produced as recombinant proteins:
Polymerase
Name
Host of
Encoding
Phage
Promoter Sequence
T7 RNA
polymerase
E. coli
TAATACGACTCACTATAGGG
T3 RNA
polymerase
E. coli
AATTAACCCTCACTAAAGGG
Salmonella
SP6 RNA
AATTTAGGTGACACTATAGAA
polymerase typhimurium
Many of the plasmids used for carrying cloned DNA incorporate promoters for
bacteriophage RNA polymerases adjacent to the cloning site. This allows one to
readily obtain either mRNA-sense or antisense transcripts from the inserted DNA. The
process is often called run-off transcription, because the plasmid is cut with a restriction
enzyme downstream of the inserted DNA, which causes the polymerase to fall off the
template when it reaches that spot.
If we assume that the RNA transcribed in the figure above has the polarity of a mRNA
(e.g. sense), it is easy to modify the construct to express an antisense RNA - simply
reverse the orientation of the transcribed region. Indeed, most plasmids used for in vitro
transcription have two different phage polymerase promoters flanking the insertion site,
which allows transcription of sense RNA with one polymerase and antisense with the
other.ucleases: DNase and RNase
Most of the time nucleases are the enemy of the molecular biologist who is trying to
preserve the integrity of RNA or DNA samples. However, deoxyribonucleases
(DNases) and ribonucleases (RNases) have certain indispensible roles in molecular
biology laboratories.
Numerous types of DNase and RNase have been isolated and characterized. They differ
among other things in substrate specificity, cofactor requirements, and whether they
cleave nucleic acids internally (endonucleases), chew in from the ends (exonucleases) or
attack in both of these modes. In many cases, the substrate specificity of a nuclease
depends upon the concentration of enzyme used in the reaction, with high
concentrations promoting less specific cleavages.
The most widely used nucleases are DNase I and RNase A, both of which are purified
from bovine pancreas:
Deoxyribonuclease I cleaves double-stranded or single stranded DNA. Cleavage
preferentially occurs adjacent to pyrimidine (C or T) residues, and the enzyme is
therefore an endonuclease. Major products are 5'-phosphorylated di, tri and
tetranucleotides.
In the presence of magnesium ions, DNase I hydrolyzes each strand of duplex DNA
independently, generating random cleavages. In the presence of manganese ions, the
enzyme cleaves both strands of DNA at approximately the same site, producing blunt
ends or fragments with 1-2 base overhangs. DNase I does not cleave RNA, but crude
preparations of the enzyme are contaminated with RNase A; RNase-free DNase I is
readily available.
Some of the common applications of DNase I are:



Eliminating DNA (e.g. plasmid) from preparations of RNA.
Analyzing DNA-protein interactions via DNase footprinting.
Nicking DNA prior to radiolabeling by nick translation.
Ribonuclease A is an endoribonuclease that cleaves single-stranded RNA at the 3' end of
pyrimidine residues. It degrades the RNA into 3'-phosphorylated mononucleotides and
oligonucleotides.
Some of the major use of RNase A are:


Eliminating or reducing RNA contamination in preparations of plasmid DNA.
Mapping mutations in DNA or RNA by mismatch cleavage. RNase will cleave
the RNA in RNA:DNA hybrids at sites of single base mismatches, and the
cleavage products can be analyzed.
A number of other nucleases that are used to manipulate DNA and RNA are described in
the following table:
Nuclease and
Source
Substrates, Activity and Uses
Exonuclease
III
(E. coli)
Removes mononucleotides from the 3' termini of
duplex DNA. The preferred substrates are DNAs
with blunt or 5' protruding ends. It will also extend
nicks in duplex DNA to create single-stranded gaps.
In works inefficiently on DNA with 3' protruding
ends, and is inactive on single-stranded DNA.
Used most commonly to prepare a set of nested
deletions of the termini of linear DNA fragments.
Mung Bean
Nuclease
(Mung bean
sprouts)
Digests single-stranded DNA to 5'-phosphorylated
mono or oligonucleotides. High concentrations of
enzyme will also degrade double-stranded nucleic
acids.
Used to remove single-stranded extensions from
DNA to produce blunt ends.
Functions as an exonuclease to digest both 5' and 3'
ends of double-stranded DNA. It also acts as a
Nuclease BAL single-stranded endonuclease that cleaves DNA at
nicks, gaps and single stranded regions. Does not
31
(Alteromonas) cleave internally in duplex DNA.
Used for shortening fragments of DNA at both ends.
Nuclease S1
(Aspergillus)
The substrate depends on the amount of enzyme
used. Low concentrations of S1 nuclease digests
single-stranded DNAs or RNAs, while doublestranded nucleic acids (DNA:DNA, DNA:RNA and
RNA:RNA) are degraded by large concentrations of
enzyme. Moderate concentrations can be used to
digest double-stranded DNA at nicks or small gaps.
Used commonly to analyze the structure of
DNA:RNA hybrids (S1 nuclease mapping), and to
remove single-stranded extensions from DNA to
produce blunt ends.
An endonuclease that cleaves RNA at 3' phosphates
of guanine residues, producing oligonucleotides
Ribonuclease
terminal guanosine 3' phosphates.
T1
(Aspergillus)
Used to remove unannealed regions of RNA from
DNA:RNA hybrids.
DNA Ligase
DNA ligases catalyze formation of a phosphodiester bond between the 5' phosphate
of one strand of DNA and the 3' hydroxyl of the another. This enzyme is used to
covalently link or ligate fragments of DNA together. Most commonly, the reaction
involves ligating a fragment of DNA into a plasmid vector, which is a fundamental
technique in recombinant DNA work.
The most widely used DNA ligase is derived from the T4 bacteriophage. T4 DNA ligase
requires ATP as a cofactor. A DNA ligase from E. coli is also available, but is not
commonly used. The E. coli enzyme uses NAD as a cofactor.
Additional information on the use of T4 DNA ligase is presented in the section on DNA
ligation.
Alkaline Phosphatase
Alkaline phosphatase removes 5' phosphate groups from DNA and RNA. It will also
remove phosphates from nucleotides and proteins. These enzymes are most active at
alkaline pH - hence the name.
There are several sources of alkaline phosphatase that differ in how easily they can
be inactivated:



Bacterial alkaline phosphatase (BAP) is the most active of the enzymes, but
also the most difficult to destroy at the end of the dephosphorylation reaction.
Calf intestinal alkaline phosphatase (CIP) is purified from bovine intestine.
This is phosphatase most widely used in molecular biology labs because, although
less active than BAP, it can be effectively destroyed by protease digestion or heat
(75C for 10 minutes in the presence of 5 mM EDTA).
Shrimp alkaline phosphatase is derived from a cold-water shrimp and is
promoted for being readily destroyed by heat (65C for 15 minutes).
There are two primary uses for alkaline phosphatase in DNA manipulations:

Removing 5' phosphates from plasmid and bacteriophage vectors that have
been cut with a restriction enzyme. In subsequent ligation reactions, this treatment
prevents self-ligation of the vector and thereby greatly facilitates ligation of other
DNA fragments into the vector (e.g. subcloning).

Removing 5' phosphates from fragments of DNA prior to labeling with
radioactive phosphate. Polynucleotide kinase is much more effective in
phosphorylating DNA if the 5' phosphate has previously been removed.
It is usually recommended that dephosphorylation of DNAs with blunt or 5'-recessed
ends be conducted using a higher concentration alkaline phosphatase or at higher
temperatures than for DNAs with 5' overhangs.
Polynucleotide Kinase
Polynucleotide kinase (PNK) is an enzyme that catalyzes the transfer of a phosphate
from ATP to the 5' end of either DNA or RNA. It is a product of the T4 bacteriophage,
and commercial preparations are usually products of the cloned phage gene expressed in
E. coli.
The enzymatic activity of PNK is utilized in two types of reactions:

In the "forward reaction", PNK transfers the gamma phosphate from ATP to the
5' end of a polynucleotide (DNA or RNA). The target nucleotide is lacking a 5'
phosphate either because it has been dephosphorelated or has been synthesized
chemically.

In the "exchange reaction", target DNA or RNA that has a 5' phosphate is
incubated with an excess of ADP - in this setting, PNK will first transfer the
phosphate from the nucleic acid onto an ADP, forming ATP and leaving a
dephosphorylated target. PNK will then perform a forward reaction and transfer a
phosphate from ATP onto the target nucleic acid.
As you might expect, the efficiency of phosphorylating via the exchange reaction is
considerably less than for the forward reaction. In addition to its phosphorylating activity,
PNK also has 3' phosphatase activity, although this has little significance to molecular
tecnologists.
There are two major indications for phosphorylating nucleic acids and hence use of
PNK are:

Phosphorylating linkers and adaptors, or fragments of DNA as a prelude to
ligation, which requires a 5' phosphate. This includes products of polymerase
chain reaction, which are typically generated using non-phosphorylated primers.

Radiolabeling oligonucleotides, usually with 32P, for use as hybridization probes.
PNK is inhibited by small amounts of ammonium ions, so ammonium acetate should not
be used to precipitate nucleic acids prior to phosphorylation. Low conceptrations of
phosphate ions, or NaCl concentrations greater than about 50 mM, also inhibit this
enzyme.