Supplementary Information
Purine
biosynthesis-deficient
Burkholderia
mutants
are
incapable
of
symbiotic
accommodation in the stinkbug
Jiyeun Kate Kim, Ho Am Jang, Yeo Jin Won, Yoshitomo Kikuchi, Sang Heum Han, Chan-Hee Kim, Naruo
Nikoh, Takema Fukatsu, and Bok Luel Lee
SUPPLEMENTAL METHODS
Transposon mutagenesis
For transposon random mutagenesis, pRL27, a plasmid carrying a hyperactive Tn5 transposase gene (tnp),
was used (Table S1). The E. coli strain WM3064, a 2,6-diaminopimelic acid (DAP) auxotroph, was used
as a donor bacterium carrying pRL27 (Saltikov and Newman, 2003). The donor WM3064 and the
recipient Burkholderia symbiont strain RPE75 were mixed at a ratio of 1:4, spotted on a DAP-containing
YG agar plate, and cultured at 30°C for 12 h to allow conjugational transfer of the pRL27 plasmid to the
recipient cells. Burkholderia clones with the integrated Tn5 cassette were selected on YG agar plates
supplemented with kanamycin.
Identification of transposon insertion site
Total genomic DNA of the Burkholderia mutant was prepared from 1 ml of YG medium culture. By
making use of the origin of replication (oriR6K) within the Tn5 cassette, we cloned the inserted
transposon together with flanking genomic regions by a plasmid rescue procedure. The genomic DNA was
digested with the restriction enzyme NcoI, self-ligated, and transformed into the E. coli strain PIR1
(Invitrogen), and positive colonies were selected on LB agar plates supplemented with 100 μg/ml
kanamycin. Isolated positive colonies were individually subjected to plasmid extraction using the Ex
prepTM plasmid kit (Gene All). Nucleotide sequences of the flanking regions of the transposon insertion
were determined using the outward primers tpnRL17-1 (5′-AAC AAG CCA GGG ATG TAA CG-3’) and
tpnRL13-2 (5′-CAG CAA CAC CTT CTT CAC GA-3’) designed within the transposon region (Larsen et
al, 2002). The gene disrupted by the transposon was identified by BlastX search against public protein
sequence databases (Altschul et al, 1990).
Diagnostic PCR of Burkholderia symbiont
R. pedestris was sterilized with 70% ethanol and dissected under the dissection microscope in a glass Petri
1
dish filled with PBS using fine scissors and forceps. The dissected midgut M4 region was collected and
subjected to DNA extraction using QIAamp DNA Mini Kit (QIAgen). Diagnostic PCR was conducted
using ExTaq (Takara) with supplied buffer system under a temperature profile of 95 °C for 5 min followed
by 30 cycles of 95 °C for 30 sec, 55 °C for 30 sec, and 72 °C for 30 sec, and lastly 72 °C for 2 min with
the primers targeting Burkholderia specific 16s rRNA gene: Burk16SF (5’-TTT TGG ACA ATG GGG
GCA AC-3’) and Burk16SR (5’-GCT CTT GCG TAG CAA CTA AG-3’) (Kikuchi et al, 2011a). PCR
products were visualized on 1 % agarose gel with 100 bp DNA ladder to estimate the product size.
Generation of deletion mutant strains
Deletion of the chromosomal purM gene of the Burkholderia symbiont was accomplished by allelic
exchange, following homologous recombination, utilizing the suicide vector pK18mobsacB harboring 5’
region and 3’ regions of the gene of interest. 5’ and 3’ regions of purM gene were first amplified from the
Burkholderia symbiont by PCR using primers indicated in Table S2. After digestion of the amplified PCR
products and the pK18mobsacB vector with appropriate restriction enzymes, they were ligated and
transformed into E. coli DH5α cells. The transformed E. coli cells were selected on the LB agar plates
containing kanamycin. The positive colonies carrying vector with correct inserts were further selected by
colony PCR using the 5’ region primer (purM-L-P1, Table S2) and a vector primer aphII (5’-ATC CAT
CTT GTT CAA TCA TGC G-3’). These donor cells carrying pK18mobsacB containing 5’ and 3’ regions
of the gene of interest were then mixed with recipient Burkholderia RPE75 cells along with helper cells
HBL1 to transfer of the cloned vector to the Burkholderia RPE75. After allowing the first crossover
(single crossover) by culturing the cell mixture of triparental conjugation on YG-agar plates, RPE75 cells
with the first crossover were selected on YG-agar plates containing rifampicin and kanamycin. The
positive colonies with the genomic integration of vector DNA were confirmed by PCR using the upstream
5’ region primer (purM-up, 5’-GAA TGA GCG TGT GAT CGA GA-3’) and the vector primer aphII. The
second crossover was allowed by culturing the cells with single crossover in YG medium and then
selecting on YG agar plates containing rifampicin and sucrose (200 μg/ml). RPE75 with deletion of the
purM gene by double crossover was identified by PCR using primers purM-up and purM-R-P2 (Table S2).
Generation of complemented mutant strains
To complement the purM deletion mutant, we used broad host range vector pBBR122 to clone purM gene.
The blunt-end PCR inserts containing purM gene were prepared using the primers purM-com-P1 and
purM-com-P2 (Table S2). The amplified DNA fragments were cloned into the DraI site of pBBR122 and
transformed to E. coli DH5α cells. Using triparental conjugation with HBL1, pBBR122 carrying the purM
gene was transferred to the recipient ΔpurM mutant strain. The complemented clones were selected on YG
2
agar plates containing rifampicin and kanamycin.
REFERENCES
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. (1990). Basic local alignment search tool. J Mol
Biol 215: 403-410.
Kikuchi Y, Hosokawa T, Fukatsu T. (2011a). An ancient but promiscuous host-symbiont association
between Burkholderia gut symbionts and their heteropteran hosts. ISME J 5: 446-460.
Kikuchi Y, Hosokawa T, Fukatsu T. (2011b). Specific developmental window for establishment of an
insect-microbe gut symbiosis. Appl Environ Microbiol 77: 4075-4081.
Kim JK, Won YJ, Nikoh N, Nakayama H, Han SH, Kikuchi Y et al. (2013). Polyester synthesis genes
associated to stress resistance are involved in an insect-bacterium symbiosis. Proc Natl Acad Sci U S A In
press.
Larsen RA, Wilson MM, Guss AM, Metcalf WW. (2002). Genetic analysis of pigment biosynthesis in
Xanthobacter autotrophicus Py2 using a new, highly efficient transposon mutagenesis system that is
functional in a wide variety of bacteria. Arch Microbiol 178: 193-201.
Saltikov CW, Newman DK. (2003). Genetic identification of a respiratory arsenate reductase. Proc Natl
Acad Sci U S A 100: 10983-10988.
Schäfer A, Schwarzer A, Kalinowski J, Pühler A. (1994). Cloning and characterization of a DNA region
encoding a stress-sensitive restriction system from Corynebacterium glutamicum ATCC 13032 and
analysis of its role in intergeneric conjugation with Escherichia coli. J Bacteriol 176: 7309-7319.
Stabb EV, Ruby EG. (2002). RP4-based plasmids for conjugation between Escherichia coli and members
of the Vibrionaceae. Methods Enzymol 358: 413-426.
Szpirer CY, Faelen M, Couturier M. (2001). Mobilization function of the pBHR1 plasmid, a derivative of
the broad-host-range plasmid pBBR1. J Bacteriol 183: 2101-2110.
3
Table S1. Bacterial strains and plasmids used in this study.
Bacterial strain or
Characteristics
plasmid
Burkholderia symbiont
RPE75
Burkholderia symbiont (RPE64); RifR
BBL004
RPE75 purL :: Tn5; RifR, KmR
BBL006
RPE75 ΔpurM; RifR
BBL006 / pBBR122 containing functional purM gene;
BBL106
RifR, KmR
Escherichia coli
F–Φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1
hsdR17 (rK–, mK+) phoA supE44 λ– thi-1 gyrA96 relA1
thrB1004 pro thi rpsL hsdS lacZΔM15 RP4-1360
WM3064
Δ(araBAD)567 ΔdapA1341::[erm pir(wt)]
PIR1
F- Δlac169 rpoS(am) robA1 creC510 hsdR514 endA
recA1 uidA(ΔMlu I)::pir-116
HBL1
PIR1 carrying pSTV28 and pEVS104; CmR, KmR
Plasmid
oriR6K transposon derivery vector containing tnp and Tn5
pRL27
element; KmR
pSTV28
p15Aori; CmR
pEVS104
oriR6K helper plasmid containing conjugal tra and trb;
KmR
pK18mobsacB
pMB1ori allelic exchange vector containing oriT; KmR
pBBR122
Broad host range vector: CmR, KmR
Referencea
(Kikuchi et al, 2011b)
This study
This study
This study
Invitrogen
(Saltikov and
Newman, 2003)
Invitrogen
(Kim et al, 2013)
(Larsen et al, 2002)
TAKARA
(Stabb and Ruby,
2002)
(Schäfer et al, 1994)
(Szpirer et al, 2001)
Table S2. PCR primers used in this study.
PCR target
Primer name
Sequence (5’-3’)
region
5’ region of
purM-L-P1
CGCGGATCCAAATGCGTGAGCAGATAGCC
purM
purM-L-P2
CGCTCTAGATCGCGATATGACAAACCTTG
3’ region of
purM-R-P1
CGCTCTAGATACGTCAAATCGCTGCTGTC
purM
purM-R-P2
CGCAAGCTTGCTCGAAATCTTCATGCTGAG
purM-com-P1
CGGCGAAGAAATTATCGAAG
purM
purM-com-P2
CGGACGTAGGCGTTAAAAAG
Restriction
site
BamHI
XbaI
XbaI
HindIII
4
Figure S1 The bacterial purine biosynthesis pathway. PurF, amidophosphoribosyltransferase; PurD, GAR
synthetase; PurN, GAR transformylase; PurT, FGAR synthetase; PurL, FGAM synthetase; PurM, AIR
synthetase; PurK, NCAIR synthetase; PurE, NCAIR mutase; PurC, SAICAR synthase; PurB,
adenylosuccinate lyase; PurH, AICAR transformylase; PurJ, IMP cyclohydrolase; PurA, adenylosuccinate
synthetase; PurB, adenylosuccinate lyase; GuaB, IMP dehydrogenase; GuaA, GMP synthetase.
5
Figure S2 Effects of supplementation with adenine and adenosine to infection density of the Burkholderia
symbiont and crypt development of the Riptortus host. Insects were infected with the wildtype strain (107
cells/ml), the purL mutant (109 cells/ml), the purL mutant with 0.5 mM adenine, or the purL mutant with
0.5 mM adenosine. Uninfected insect were fed with sterile water or water containing either 0.5 mM
adenine or 0.5 mM adenosine. (a) Symbiont titers in the midgut M4 region were measured at 48 h postinoculation by CFU assay. Horizontal bars in the graph represent mean values (n = 20, respectively).
Different letters (a, b, c) on the graph indicate statistically significant differences (P < 0.05; unpaired t-test
with Bonferroni’s correction). (b) The width of the M4 region was measured at 48 h post-inoculation.
Means and standard deviations are shown (n = 5, respectively). Different letters (a, b, c) on the graph
indicate statistically significant differences (P < 0.05; one-way ANOVA with Tukey’s correction). (c-h)
Light microscopic images of the dissected M4 regions at 48 h post-inoculation. Scale bars show 0.1 mm.
6