Name: _________________________________________ Date: __________________ Sec: _____ How Genes Work: Making a Protein Introduction: By the end of this activity, you will know how to read the genetic code to build proteins. You will recognize that the sequences of bases in a DNA molecule direct the formation of proteins. Genes usually code for a sequence of amino acids that make up a large part of a protein molecule. Procedure: 1. Study the table below; it shows the codons for each amino acid (the Genetic Code). 2. Below the table is the sequence of RNA bases that makes beef insulin, a hormone that controls the uptake of glucose from a cow’s blood. 3. Divide the RNA bases into groups of three. 3. Use the Genetic Code and the sequence of bases to write the three-letter abbreviations of the amino acids in the beef insulin molecule. 4. Answer the questions below the representation of the beef insulin molecule. 1 5 10 15 20 UUUGUCAAUCAGCAUCUGUGUGGGAGUCACCUAGUCCAGGCCCUAUAUUUGGUUUGCGGC 21 25 30 35 40 GAGAGAGGGUUCUUUUACUACCCCAAAGCAGGUAUUGUGGAACAGUGUUGUCGUUCUGUU 41 45 50 UGUUCGUUGUACCAAUUGGAGAAUUAUUGUAACUAG Beef Insulin Molecule Fill in the circles of the beef insulin molecule below with the three-letter abbreviation for each amino acid. 1. Disulfide bonds in proteins form between a pair of amino acids of a certain kind. Using the diagram you have just completed, look up the full name of those amino acids and write their names below: ________________________________________________________________ 2. Disulfide bonds are a major factor in determining the overall shape of a protein molecule. Why is this important? ________________________________________________________________ ________________________________________________________________ ________________________________________________________________