Supplementary Materials and Methods
Brain tissue processing. Rats were euthanized by i.p injection of an overdose of sodium
pentobarbitone. For immunohistochemistry and other histological analyses, rats were
transcardially perfused with 100mL saline (0.9% w/v NaCl), followed by 50mL of 10%
v/v buffered neutral formalin (Sigma Aldrich, St Louis, MO). Brains were removed and
post-fixed overnight in 10% formalin, followed by cryoprotection in 30% sucrose in
1xPBS for 72 hours. Forty micron coronal sections from the entire striatum, globus
pallidus and substantia nigra were cut using a cryostat (Leica Microsystems, Wetzlar,
Germany) and collected in 1x PBS containing 0.4mg/mL methiolate and stored at 4C.
For quantitative real-time PCR analysis, brains were removed rapidly and coronal brain
tissue blocks including the striatum were immersed in RNALater solution (Qiagen,
Germantown, MD) overnight at 4C and then stored at -20C until use. For western blot
or AAV vector genomic PCR analyses, brains were removed rapidly and were snapfrozen and stored at -80C until use.
Immunohistochemistry. Immunohistochemistry was performed on free-floating brain
sections as described previously [48]. Antibodies were diluted in 1x PBS containing 4%
horse serum, 0.2% Triton-X100 and 0.4mg/mL methiolate. Ab1 rabbit anti-htt [49]
(1:600, kind gift from Dr. Marian DiFiglia, Mass. General Hospital) or EM48 mouse
anti-htt (1:1,000, MAB5374, Chemicon, Temecula, CA) were used to detect expression
of AAV-HD70, -HD20 and -Hdh8. Antibodies used to detect markers for striatal
neuronal cell populations were mouse anti-NeuN (1:1,000, MAB377, Chemicon), rabbit
anti-calbindin-D28k (1:20,000, CB38, Swant, Bellinzona, Switzerland), rabbit anti-ChAT
(1:1,000, AB143, Chemicon), rabbit anti-NPY (1:5,000, N9528, Sigma), mouse antiparvalbumin (1:2,000, MAB1572, Chemicon) and rabbit anti-DARPP-32 (1:750,
AB1656, Chemicon). Other antibodies used were mouse anti-GFAP (1:2,000, G3893,
Sigma), mouse anti-enkephalin (1:1,000, MAB350, Chemicon), mouse anti-TH (1:1,000,
MAB5280, Chemicon), and mouse anti-HuC/D (1:1,000, 16A11, Invitrogen). Sections
were incubated overnight with primary antibodies. Sections were then incubated for 3
hours with biotinylated secondary antibodies (goat anti-mouse or goat anti-rabbit, 1:250,
Sigma) followed by a 2-hour incubation with ExtrAvidin peroxidase (1:250, Sigma).
Antibodies were visualized using 0.2mg/mL diaminobenzidine, 0.01% hydrogen
peroxide in 0.1 M phosphate buffer. Negative controls were conducted for each antibody
by omitting the primary antibody.
Anti-enkephalin immunostaining density analysis. Brains were analyzed from rats
unilaterally injected with AAV-HD70, -HD20, -Hdh8, or -Empty vector (n=6), killed at 5
weeks post-injection. Four sections were selected from each brain, throughout the rostralcaudal extent of the globus pallidus and stained for enkephalin using DAB
immunohistochemistry. Staining density was analyzed using Image-Pro Plus 5 (Media
Cybernetics, Bethesda, MD). An estimate of enkephalin-positive projections to the
globus pallidus in the injected hemisphere was calculated by dividing the density
measured in the ipsilateral hemisphere by the density measured in the contralateral
hemisphere.
Immunofluorescent double-labeling and confocal microscopy. Antibodies used to
detect expression of AAV-HD70, -HD20 or -Hdh8 were Ab1 rabbit anti-htt or EM48
mouse anti-htt. Antibodies used to detect endogenous rat brain proteins were mouse antiNeuN (1:1,000, Chemicon), goat anti-ChAT (1:1,000, AB144P, Chemicon), rabbit antiNPY (1:5,000, Sigma), mouse anti-parvalbumin (1:2,000, Chemicon) and rabbit antiDARRP-32 (1:750, Chemicon). For RNAi experiments, Ab1 rabbit anti-htt (1:600) was
used to detect expression of huntingtin protein and hrGFP reporter gene expression was
detected using native fluorescence. Four sections per brain were incubated overnight with
primary antibodies. Sections were then incubated for 3 hours with donkey anti-mouse,
anti-goat or anti-rabbit secondary antibodies conjugated to cy-2 or cy-3 (1:500, Jackson,
West Grove, PA). Sections were then mounted onto glass slides and cover-slipped with
anti-fade mounting medium (4% n-propyl gallate in 90% glycerol, 10% PBS). Also,
immunofluorescent staining of striatal sections from animals injected with AAV-EGFP
vector used antibodies against DARPP-32, NPY, parvalbumin and ChAT, combined with
EGFP native fluorescence. Confocal microscopy was performed using a Leica TCS-SP2,
with images collected at 63x magnification using FITC and TRITC filters.
Nissl staining. Sections were mounted onto glass slides in 1xPBS and dried overnight.
Slides were immersed in 0.025% cresyl violet in 90mM acetic acid, 10mM sodium
acetate for 3 hours, followed by dehydration in ascending ethanol and xylene, and coverslipped with Cytoseal-60 mounting medium (Richard-Allan Scientific, Kalamazoo, MI).
Fluoro-Jade B staining. The anionic fluorochrome Fluoro-Jade B was used to stain
degenerating neurons on brain sections. Briefly, brain sections were mounted onto glass
slides in water and dried overnight. Slides were then immersed briefly in descending
ethanol solutions followed by a 15-minute immersion in 0.06% potassium permanganate
solution. Slides were washed briefly in water and then immersed in 0.001% Fluoro-Jade
B solution (Chemicon) in 0.1% acetic acid for 30 minutes followed by dehydration and
coverslipping.
PCR detection of virus genome in tissue samples. DNA was isolated from brain tissue
samples from the striatum, substantia nigra and cerebellum according to the standard
protocol from a DNeasy Tissue Kit (Qiagen). PCR was performed using the following
primers that were designed to amplify a 120bp fragment in the WPRE region of the
recombinant AAV1/2 vector genome: GGCTGTTGGGCACTGACAAT (forward),
CCGAAGGGACGTAGCAGAA (reverse). The plasmid pAM/NSE-HD70-WPRE-BGH
was used as a positive control. PCR products were separated on a 3% agarose gel.
Quantitative real-time RT-PCR analysis. Striatal tissue was removed from storage in
RNAlater solution and RNA was prepared from 20-30mg striatal tissue using an RNeasy
Mini kit (Qiagen), as per the manufacturers protocol and stored at -80C. DNA was
removed from 500ng RNA aliquots using DNase I digestion. 100ng RNA was used for
cDNA synthesis using Superscript II First Strand Synthesis System (Invitrogen), with
random hexamer primers. RT- controls were prepared for every RNA sample by omitting
to add reverse transcriptase. cDNA was stored at -20C. Quantitative real-time PCR was
performed for RT+ and RT- cDNA samples using Platinum SYBR Green qPCR
Supermix UDG with ROX (Invitrogen) and 300nm forward and reverse oligonucleotide
DNA primers. No template controls were prepared by omitting to add cDNA template to
the reaction. 10L reactions were performed in 384-well plates using an ABI 7900HT
Sequence Detection System for Realtime PCR (Applied Biosystems). Oligonucleotide
DNA primers were designed using Primer Express software (Applied Biosystems) to
facilitate amplification of a 60bp amplicon from rat Hdh cDNA and human HD cDNA
templates. These primers were degenerate at sites that varied between the rat and human
sequence, two nucleotides within the forward primer and three within the reverse primer.
The sequences of these primers were as follows:
ATGGCRACCCTGGAAAARCTGATGA (forward) and
YTGCTGCTGCAASGACTTGAGSGACTCGAA (reverse). Primers were also designed
to amplify an 85bp amplicon from rat proenkephalin cDNA:
GCAGCTGCCTTCTTTCAAAATC (forward), GTCGATGTTATCCCAAGGGAACT
(reverse); and an 85bp amplicon from rat DARPP-32 cDNA:
AAGGCTGGTCTGTGTTTGCTTT (forward), TCCCACCGGGTAAATAGAAGAAT
(reverse). In addition, primers were designed to amplify four rat housekeeping gene
cDNA sequences to facilitate normalization of expression data: GAPDH,
CATGGCCTTCCGTGTTCCTA (forward), CCTGCTTCACCACCTTCTTGA (reverse);
18S rRNA, GGATCCATTGGAGGGCAAGT (forward),
ACGAGCTTTTTAACTGCAGCAA (reverse); RPLPO,
ATGGGCAAGAACACCATGATG (forward), CCTCCTTGGTGAACACAAAGC
(reverse); PPIA, AGCCATGGAGCGTTTTGG (forward),
GAGTTGTCCACAGTCGGAGATG (reverse). The sizes of amplicons generated using
these primers were 118bp (GAPDH), 91bp (18s rRNA), 118bp (RPLPO), and 73bp
(PPIA). Analysis of dissociation curves confirmed that single amplicon products were
generated. Relative mRNA expression levels of htt constructs were calculated using the
geNorm applet [50] for Microsoft Excel, normalized to the two most stable housekeeping
genes.
Western blot quantification of protein expression. Co-transfected HEK293 cells
harvested from 6-well plates or 20-30mg samples of fresh frozen striatal tissue were
homogenized by sonication on ice in 50mM Tris-HCl, pH7.5, 2mM EDTA, 0.05%
Triton-X100 with proteinase inhibitors (Complete Mini, Roche, Basel, Switzerland).
Samples were denatured in sample buffer (5% w/v SDS, 10% v/v glycerol, 0.01% w/v
bromophenol blue, 125mM Tris-HCl, pH6.8 and 10% v/v -mercaptoethanol) at 95C
and 20g protein separated by 10% SDS-PAGE before transfer to Hybond-ECL
nitrocellulose membranes (Amersham Biosciences, Piscataway, NJ). Membranes were
incubated for 3 hours in a blocking buffer of 5% non-fat milk powder in Tris-buffered
saline (Tris-HCl, 500mM NaCl, pH7.5) with 0.05% Tween 20 (TBST). After washing in
TBST, membranes were incubated overnight at 4C with Ab1 rabbit anti-htt (1:600) or
rabbit anti-GFP (1:5000, ab20, AbCam) in 1% non-fat milk powder in TBST.
Membranes were then washed in TBST before incubating for 1 hour at 4C with
peroxidase-conjugated goat anti-rabbit secondary antibody (1:5,000, sc-2004, Santa Cruz,
Santa Cruz, CA). Membranes were washed in TBST and peroxidase-based detection was
performed with enhanced chemiluminescence (ECL) detection reagent (Amersham
Biosciences, Piscataway, NJ) followed by imaging (LAS-3000, Fujifilm, Tokyo, Japan)
and quantification of protein bands (Multigauge V3.0, Fujifilm). To normalize protein
bands to a gel loading control, membranes were washed in TBST and re-probed with
mouse anti--actin (1:5,000, ab6276, AbCam) followed by incubation with peroxidaseconjugated goat anti-mouse (1:5,000, sc-2005, Santa Cruz) and ECL detection.
Statistical analysis. Data generated from stereological cell counts, immunostaining
density quantification, western blots, RT-PCR and behavioral testing were subjected
where appropriate to Student’s t-test or one-way ANOVA statistical analysis, with posthoc analysis and Bonferroni correction of the significance level set at p<0.05, using SPSS
v.11 (SPSS Inc., Chicago, IL). Data of experiment group meansSEM were graphed
using Microsoft Excel (Microsoft Corporation, Redmond, WA).