BIO 535
Wong
Minisatellite Analysis
MINISATELLITE ANALYSIS OF HUMAN D1S80 VNTR LOCUS
Several types of repetitive DNA have found utility in DNA fingerprinting: Variable Number of
Tandem Repeats (VNTRs) or minisatellites, and Short Tandem Repeats (STRs) or
microsatellites. VNTR core sequences can range from 7-100 bps in length, while STR core
sequences are less than 5 bps long. The number of repeats vary considerably.
The D1S80 locus on human Chromosome 1 contains a 16 bp VNTR (consensus:
AGGACCACCAGGAAGG). The smallest allele contains 14 repeats, while the largest alleles
contain up to 72 repeats. In a 1992 analysis of almost 3000 randomly-chosen individuals, the
most common alleles contained 18 and 24 repeats, while the rarest contained 14 and 38.
We will be using a thermocycler to carry out the Polymerase Chain Reaction (PCR) as a way of
specifically amplifying the D1S80 locus from our isolated human genomic DNA.
The primers used in this experiment anneal to sequences flanking the VNTR, and generate a
PCR product that is 145 bp larger than the size of the actual repeat region.
D1S80 Forward primer:
5’–GAAACTGGCCTCCAAACACTGCCCGCCG
D1S80 Reverse primer:
5’–GTCTTGTTGGAGATGCACGTGCCCCTTGC
D1S80
References:
http://www.ncbi.nlm.nih.gov:80/books/bv.fcgi?rid=genomes.section.5545
http://www.ncbi.nlm.nih.gov/gquery/gquery.fcgi?term=D1S80
Budowle, B. et al. (1992) J. Forensic Science 40:38
1
BIO 535
Wong
Minisatellite Analysis
D1S80 PCR Amplification Protocol
1. Wear gloves, and use only PCR-certified sterile tubes, tips, and solutions.
Be very conscious of human contamination.
2. Set up a PCR reaction in a 200 µL PCR tube (thin-walled tube can collapse if
squeezed too hard). Keep tubes on ice until ready to place into thermocycler.
3. Use 1 µL of your buccal genomic DNA per 10 µL PCR reaction.
4. Keeping tubes on ice, add 9 µL of ice-cold PCR Master Mix.
Master Mix contains the following:
•
•
•
•
•
•
•
1 µL
0.8 µL
0.2 µL
0.4 µL
1 µL
0.05 µL
5.55 µL
10x PCR Buffer (Tris-HCl, KCl, [NH4]2SO4, 15 mM MgCl2, pH 8.7)
Bovine Serum Albumin, non-acetylated (stock = 1 mg/mL)
dNTP Mix (stock = 10 mM each dATP, dTTP, dCTP, dGTP)
MgCl2 (stock = 25 mM)
Primer Mix (5 pmol each D1S80Forward and Reverse)
Taq DNA Polymerase (stock = 5 Units/µL)
water
5. Turn on the thermocycler.
Your instructor will tell you which link files to use to conduct PCR under the
following conditions:
• 95°C 4 min initial denaturation step
30 cycles of
• 95°C 30 sec denaturation
• 65°C 30 sec annealing
• 72°C 2 min elongation
• 72°C 7 min final elongation step
6. Load tubes into thermocycler (note the rack number of your tube).
Push “Run” button.
7. When PCR runs are complete, quickly place tubes on ice to stop reactions.
Add 1 µL 6x Dyes + SYBR Green to the reaction, and load sample onto a 2% NuSieve
agarose midi-gel.
Instructor will load a 100-bp DNA Ladder in adjacent lanes.
8. Run the gel at 5 V/cm (distance between electrodes) until the orange dye front is 75% to
the end (100 bp band is at Orange G dye front).
9. View stained gel on appropriate transilluminator.
Photograph gel with the appropriate camera filter.
Measure migration distance for 100-bp Ladder bands.
Measure migration distance for your D1S80 bands.
Plot standard curve for 100-bp Ladder on semilog graph paper
(log bp vs. migration distance).
Calculate size (bp) of your D1S80 bands (subtracting flanking sequence).
Determine number of VNTR repeats in each allele.
2