MATERIAL AND METHODS
Cell Culture
Rat thyroid epithelial cells FRTL-5 and their derivatives FER, FR and EV cells have
already been described (13, 14). Cells were maintained in Coon’s modified F12 medium
(EuroClone, MI, Italy) supplemented with 5% newborn bovine serum (HyClone, Logan,
UT), penicillin and streptomycin 100X (EuroClone, MI, Italy), 20ng/ml Glycyl-histydyllysine (Sigma-Aldrich, St. Louis, MO), 3.6ng/ml hydrocortisone (Sigma-Aldrich, St.
Louis, MO), 10μg/ml bovine pancreas insulin (Sigma-Aldrich, St. Louis, MO, USA),
5μg/ml Apo-Transferrin Human, 10ng/ml Somatostatin (Sigma-Aldrich, St. Louis, MO,
USA) and 0.5mU/ml thyroid stimulating hormone (TSH). Tamoxifen treatments, where
indicated, were performed by addition of 100nM 4-hydroxy-tamoxifen (4OHT) (SigmaAldrich, St. Louis, MO, USA) to the culture medium.
Cells were treated with kinase inhibitors for 24h at the following concentrations: U0126
(Calbiochem, San Diego, CA) 25μM and LY294002 (Calbiochem, San Diego, CA)
50μM.
Expression and Reporter vectors
Wnt4 cDNA (NCBI Reference Sequence NM_005923) was obtained by PCR from
mouse
thyroid
cDNA
using
CGGAATTCCGGGAGCCTTGCGGCCGCTG
the
3'
forward
and
the
primer
reverse
primer
5'
5'
GCTCTAGATCACCGGCACGTGTGCATCT 3'. Wnt4 cDNA was digested with EcoRI
and XbaI restriction enzymes and cloned in both pCEFL Puro vector and pCEFL Neo
1
vector, carrying puromycin and neomycin resistance, respectively.
Wnt4 was identified as a potential target of rno-miR-24 by TargetScan Human 5.2
(http://www.targetscan.org/vert_50/). The program identified one well-conserved and
three poorly-conserved rno-miR-24 target sites in rat Wnt4 3’UTR. We cloned a
concatamer of three tandem well-conserved predicted miR-24 target sequence
(CCCCTTCAGAGAATGCTGAGCCA)x3 or a mutant concatamer lacking the
complementarity with miR-24 seed sequence (CCCCTTCAGAGAATGGACTATA)x3 in
the XbaI site of pGL3 Control vector (Promega Corporation, Madison, WI, USA)
generating Luc-Wnt4 and Luc-mtWnt4 vectors, respectively. We also amplified a 420bp
fragment of the Wnt4 3’UTR centered on the rno-miR-24 target site by PCR from FRTL5 cDNA using 5'CGATATCTAGATGGAACCGCATTCAAATGCA3' as forward
primer and 5'CGATATCTAGAACAAGTCCAGTGAAGCCTTT3' as reverse primer.
The amplified fragment was then cloned in the XbaI site of pGL3 Control vector
(Promega Corporation, Madison, WI, USA) in order to generate the Luc-Wnt4UTR
reporter vector.
Cell Transfection
Rat Wnt4 siRNA (Ambion, Life Technologies Ltd, UK) and rat pre-miR-24 (Ambion,
Life Technologies Ltd, UK) were transfected at a final concentration of 50nM using the
Lipofectamine 2000 reagent (Invitrogen, Life Technologies Ltd, UK) following the
manufacturer's instruction. Expression and reporter vectors transfections were all carried
out with FuGene 6 (Roche Applied Science, Penzberg, Germany) following the
manufacturer's instruction. Wnt4 expressing FER1 cells (FERW) were obtained by
2
transfection of FER1 cells with pCEFL Puro Wnt4. Wnt4 expressing FR1 cells (FRW)
were obtained by transfection of FR1 cells with pCEFL Neo Wnt4. Cells were cultured in
100mm plates and transfected with 5μg of DNA. 48h after transfection selection with
either 1μg/ml Puromycin (Sigma-Aldrich, St. Louis, MO, USA) or 0.5g/ml G418
(GIBCO, Life Technologies Ltd, UK), respectively, was started. Single colonies from
each transfection were picked-up and expanded for further analysis.
For transient transfections with reporter vectors, 4*105 cells were seeded on 60-mm
dishes 24h before transfection. Transfections were performed with 1.5g/dish of total
DNA consisting of 1g of reporter vector encoding firefly luciferase and 0.5g of TKRenilla vector (Promega Corporation, Madison, WI, USA.) to follow transfection
efficiency. 48h after transfection cells were lysed in Passive lysis buffer (Promega
Corporation, Madison, WI, USA) supplemented with 100X protease inhibitors (SigmaAldrich, St. Louis, MO, USA). Firefly and renilla luciferase activity were assayed,
respectively, with the Luciferase Assay System (Promega Corporation, Madison, WI,
USA) and the Renilla Assay System (Promega Corporation, Madison, WI, USA)
following manufacturer’s instructions.
Luminescence was measured with LUMAT LB 9507 luminometer (Berthold
Technologies, Bad Wildbad, Germany). Firefly luciferase activity was normalized on the
activity of TK-Renilla vector to correct each sample for transfection efficiency. Data
were confirmed in at least two independent experiments with triplicate samples.
Protein Studies
Total protein extraction was carried out using the following lysis buffer: 50mM Tris HCl
3
pH 8, 5mM MgCl2, 150mM NaCl, 0.5% Deoxycholic Acid, 01% SDS, 1% Triton, 1X
protease inhibitor cocktail, 0.5mM PMSF, 5mM sodium orthovanadate (Na3VO4), 10mM
sodium fluoride (NaF), 0.5mM sodium pyrophosphate (Na4P2O7) and 1mM dithiothreitol
(DTT) (all provided by Sigma-Aldrich, St. Louis, MO, USA). For phosphoprotein
analysis cell lysis was performed using the following buffer: HEPES 50mM pH 7.5,
150mM NaCl, 10% glycerol, 1% Triton X-100, 1mM EGTA, 1.5mM MgCl2, 10mM
NaF, 10mM sodium pyrophosphate, 1mM Na3VO4, protease inhibitor cocktail 1X (all
provided by Sigma-Aldrich, St. Louis, MO, USA). Cell lysates were incubated 15min on
ice and centrifuged at full speed at 4°C for 25min. Protein concentration was estimated
using the BCA Protein Assay Kit (Thermo Fisher Scientific Inc., Rockford, USA).
For medium protein concentration 4*105 cells were plated on 60mm dishes, and 24h later
the culture medium was collected and centrifuged in Amicon Ultra 15 Centrifugal Filter
Devices (Millipore, Billerica, MA, USA) for 50 min at 3500 rcf at 4°C.
Immunoblot
For Western blot analysis 50µg of total protein cell lysate were loaded on precasted
NuPAGE 4-12% Bis-Tris gels (Invitrogen, Life Technologies Ltd, UK). For medium
protein analysis equal volumes of each sample were used. Gels were elettroblotted on
Immobilion-P PVDF membranes (Millipore, Billerica, MA, USA) and screened for
different antibodies. Primary antibodies against GAPDH (clone 6C5) (Advanced
ImmunoChemical, CA, USA), RAS (clone Ras10) (Millipore, Billerica, MA, USA),
phospho-Akt Ser473 (Cell Signaling Technology, MA, USA), Akt (Cell Signaling
Technology, MA, USA), pERK1/2 and total ERK1/2 (Cell Signaling Technology, MA,
4
USA), α1 tubulin (Sigma-Aldrich, St. Louis, MO, USA), βactin (Sigma-Aldrich, St.
Louis, MO), Wnt4 (Zymed Laboratories Incorporated, CA, USA), anti Rac1 clone 23A8
(Millipore, Billerica, MA, USA), Rho (-A,-B,-C) clone 55 (Millipore, Billerica, MA,
USA) were used as indicated by manufacturers. Rabbit polyclonal antibodies against Tg,
Pax8, NIS, Foxe1 and Nkx2.1, have been previously described (12). Secondary
antibodies Mouse IgG Horseradish peroxidase linked whole antibody (GE Healthcare),
Rabbit IgG Horseradish peroxidase linked whole antibody (GE Healthcare, UK) were
used as indicated by manufacturers. Chemiluminescence was detected using either Pierce
ECL Western Blotting Substrate (Thermo Fisher Scientific Inc., Rockford, USA) or
ECLplus Western Blotting Detection system (GE Healthcare, UK). Densitometric
quantization of western blots, where shown, were performed using ImageMeter.
Ras, Rac and Rho activation assays
Ras, Rac and Rho pulldown assay were performed using the Ras Activation Assay Kit,
Rac1 Activation Assay Kit and Rho Activation Assay kit, respectively, all provided by
Millipore, Billerica, MA, USA. Pulldown assays were performed accordingly to
manufacturers instructions. Ras and Rac pulldown assay was performed using 1mg of
total protein extract and respectively 20 µg of Raf1-RBD agarose and 20 µg of PAKIPBD agarose. Rho pulldown was performed using 2.5 mg of total protein extract and 20
µg of Rhotekin-RBD agarose. (Millipore, Billerica, MA, USA)
RNA extraction and Q-RT-PCR
RNA was extracted using TRIZOL Reagent (Invitrogen, Life Technologies Ltd, UK)
5
following the manufacturers instructions. Total RNAs from each cell line were used as
template for the synthesis of the first strand cDNA, starting from random hexamers, using
the Superscript II Reverse Transcriptase kit (Invitrogen, Life Technologies Ltd, UK)
according to manufacturer’s instructions. Quantitative Real Time PCR (Q-RT-PCRs)
were conducted on iCycler iQ TM Multi-Color Real Time PCR Detection System
(Biorad Laboratories, CA, USA) using the iQ SYBR Green Supermix (Biorad
Laboratories, CA, USA). Each reaction was carried out in triplicate, using cDNA
obtained from 100 ng of total RNA as template. Primer pairs for each gene analysed were
used at 300nM. Results were analyzed using α-1 tubulin as reference gene. Q-RT-PCR
primers were designed using the Universal Probe Library Assay Design Center from
Roche
Applied
Science
(https://www.roche-applied-
science.com/sis/rtpcr/upl/index.jsp?id=UP030000). Rat Wnt4 expression was measured
using
5'GGCGCTGGAACTGTTCCA3'
as
forward
primer
and
5'CTGAAGAGATGGCGTATACAAAGG3' as reverse primer. Human Wnt4 expression
was
measured
using
5'CATGAGTCCCCGCTCGT3'
as
forward
primer
and
5'CGAGTCCATGACTTCCAGGT3' as reverse primer. Rat -1 tubulin expression was
measured using 5'CAACACCTTCTTCAGTGAGACAGG3' as forward primer and
5'TCAATGATCTCCTTGCCAATGGT3' as reverse primer. All Q-RT-PCR were
performed in triplicates, -1 tubulin was used as reference and all data were analyzed
using the 2-Ct method.
For miR-24 expression, single stranded cDNA synthesis was performed using the
TaqMan MiRNA Reverse transcription kit (Applied Biosystem, Life Technologies Ltd,
UK) according to manufacturers instructions. Q-RT-PCR were performed with a specific
6
TaqMan probe for rno-miR-24 supplied by Applied Biosystem Life Technologies Ltd,
UK. Q-RT-PCR for miRNA were performed in duplicate and carried on Applied
Biosystem 7900HT Fast Real-Time PCR system (Applied Biosystem, Life Technologies
Ltd, UK). Let-7a was used to normalize miR-24 expression.
Human thyroid tissue samples
Neoplastic and normal human thyroid tissues were collected at the Service d’AnatomoPathologie, Centre Hospitalier Lyon Sud, Pierre Bénite, France. We declare that informed
consent for the scientific use of biological material was obtained from all patients.
Motility Assays
Scratch wound healing assays were performed on confluent cell monolayers scraped with
a p200 pipet tip, then the medium was replaced with fresh medium either supplemented
or not with 100nM 4OHT. Phase-contrast images were acquired immediately after
scratching and after 24 hours of incubation at 37°C.
Transwell assays were performed by using the Transwell Permeable Support 8 m
polycarbonate filter membrane 6.5mm insert provided by Corning, NY, USA. Briefly,
50.000 cells were seeded on the transwell insert and incubated at 37°C with the specific
medium. 24h later, unmigrated cells were gently removed from the top of the filter, then
migrated cells were fixed and stained using a crystal violet and methanol solution (0.5%
crystal violet, 20% methanol) for 30 min. Quantification of the migrated cells was
performed by cell de-staining with 1% SDS solution and reading the relative absorbance
at 570nm. Each experiment was performed in duplicate and repeated at least twice.
7
Immunofluorescence Assay
Immunofluorescence studies were performed on cells plated on 12mm diameter glass
coverslips. Cells were fixed with 3% paraformaldehyde in PBS for 20 min and
permeabilized in 0.5% Triton X-100 (Sigma-Aldrich, St. Louis, MO) for 3 min.
Coverslips were washed and incubated with PBS/0.1mg/ml BSA for 1h at room
temperature, then washed twice with PBS and incubated for 1h with mAb anti-paxillin
(Zymed Laboratories Incorporated, CA, USA) or 5% pre-immune serum in
PBS/0.1mg/ml BSA. Coverslips were then washed and incubated for 1h with the
fluorescein-tagged secondary antibody (Jackson Immunoresearch Laboratories, PA,
USA). Rhodaminated phalloidin (Sigma-Aldrich, St. Louis, MO) was used to stain actin
microfilaments. Coverslips were mounted in 50% glycerol in PBS. Immunofluorescence
was captured by confocal laser scanner microscope Zeiss LSM 510.
Proliferation Assay
Cell Proliferation rate was determined using the Cell Titer 96 AQueous One Solution
Cell Proliferation Assay (Promega Corporation, Madison, WI USA). 50.000 cells/well
were plated in a 96 well plate, the assay was performed adding 20μl of Cell Titer 96
AQueous One Solution directly to culture wells, incubating for 2h and then reading
absorbance at 490nm with a 96 well-plate reader ElX 800 Universal Microplate Reader
Biotek instruments. The 96 well plate reader was blanked using fresh culture medium.
Data were obtained from at least two independent experiments each with triplicate
samples.
8
RNA PolII Chromatin Immunoprecipitation
Wnt4 transcription rate measurement was performed through an RNA-polymerase IIbased Chromatin-IP assay as previously described (28). All immunoprecipitated DNA
samples were analysed in triplicates by Q-RT-PCR; 5µL of DNA were used as template
for each reaction. Immunoprecipitated DNA levels are reported as percent of INPUT
DNA. Q-RT-PCR primers were designed using the Universal Probe Library Assay
Design
Center
from
Roche
Applied
Science
science.com/sis/rtpcr/upl/index.jsp?id=UP030000).
For
(https://www.roche-appliedWnt4
transcription
rate
evaluation, 5'GTACCTGGCCAAGCTGTCAT3' was used as forward primer and
5'CTTTGAGCTTCTCGCACGTT3'
as
reverse
primer.
NIS
transcription
rate
measurement was used as a control of sample quality (28).
9