MASSACHUSETTS INSTITUTE OF TECHNOLOGY
Department of Biology
31 Ames Street, Cambridge, MA
Molecular Biology Techniques
IAP 2007
Course 7.391
Jan 8-12, 16-19, & 22
12:30 PM - 4:30 PM
Building 68-230
3 U credits
Prepared & Taught by
MANDANA SASSANFAR, Ph.D.
&
PETER WEIGELE, Ph.D.
Funded by the Howard Hughes Medical Institute
Synopsis of the methods
taught in this course:
Laboratory safety
Pipetting
Sterile techniques
Bacteriophage plating and propagation
Measurement of viral titer by serial dilution
Column chromatography: anion exchange and affinity based
CsCl density gradient ultracentrifugation
Plasmid and genomic DNA purification
Agaraose gel electrophoresis of DNA
SDS-polyacrylamide gel electrophoresis of proteins
Oligonucleotide design and polymerase chain reaction (PCR)
Gene cloning using PCR, restriction digest, and ligation
Analysis of DNA sequences: sequencing, restriction digests
and database searching
Transmission electron microscopy (TEM)
IAP 2007 Biology 7.391
2
TABLE OF CONTENTS
Synopsis of methods ...................................................................................................................................... i
Summary.......................................................................................................................................................ii
About the course instuctors ............................................................................................................................
Laboratory safety ............................................................................................................................................
Techniques .....................................................................................................................................................
Oveview of laboratory and experimental schedule .....................................................................................iii
Introduction and backround .......................................................................................................................... 1
Day 1: Concentration and purification of freshwater phage communities .....................................................
Day 2: Isolation of phages on bacterial hosts .................................................................................................
Day 3: Determining phage titers .....................................................................................................................
Day 4:Large scale purification of phages .......................................................................................................
Day 5: .............................................................................................................................................................
Day 6: .............................................................................................................................................................
Day 7: .............................................................................................................................................................
Day 8: .............................................................................................................................................................
Day 9: .............................................................................................................................................................
Day 10: ...........................................................................................................................................................
Appendix 1: ....................................................................................................................................................
Appendix 2: ....................................................................................................................................................
Appendix 3: Plasmid maps .............................................................................................................................
Appendix 4: Reading a Scientific Paper .........................................................................................................
Tables .............................................................................................................................................................
Acknowledgements ........................................................................................................................................
Finding out More!...........................................................................................................................................
IAP 2007 Biology 7.391
3
Summary
In this short, but intense, two week laboratory course, we will learn and use a collection of
laboratory techniques to accomplish a single research goal: the isolation, characterization and
molecular dissection of a virus (which you will isolate). The techniqes learned in this course will
provide a repertoire of methods you will be able to use in any lab practicing traditional
microbiology.
You will begin by concentrating whole virus communities out of water samples using anion
exchange chromotography. Different bacterial strains will be incubated together with these virus
concentrates on the suface bacterial medium solidified with agar in a Petri dish. If any of the
bacteria are susceptible to the viruses in the concentrate, a clear spot (plaque) caused by a zone of
killing by the virus will be seen. The viruses in this plaque will be subsequently propagated in
large liquid cultures and purified using a series of biochemical techniques. The proteins and DNA
of these viruses will be extracted and examined by gel electrophoresis. The morphology of your
virus will be observed directly using a transmission electron microscope. At this stage, your virus
would be ready for genomic sequencing. However, due to time limitations, we will subsequently
use gene sequences from viruses that have already been sequenced. You will learn how to go
from raw sequence data to annotated genome using a series of online tools that include
identificaiton of open reading frames (protein coding sequences) and identification of known
homologes in the sequence database.
A set of genes from our collection of aforementioned viruses whose genomes have been
sequenced will be the target of PCR cloning. This same set of protocols could be used to clone a
gene from the virus you isolated if you knew already the gene's nucleotide sequence. The genes
will be first amplified from the genomic DNA templates using sequence specific oligonucleotide
primers and the polymerase chain reaction. The resulting PCR product will have its ends cut with
restriction enzymes and be ligated to a plasmid vector similarly cut to yield cohesive compatible
(“sticky”) ends. This plasmid vector contains both promoter sequences to control the expression
of inserted gene, as well as a antibiotic resistance gene that serves as a selectable marker ensuring
that host bacterial cells maintain the plasmid through successive generations. The ligation mixture
containing successful as well as failed ligation events will be used to transform competent
bacterial cells to antibiotic resistance. Resulting transformants will be screened for plasmids that
successfully contain the inserted gene. Plasmids that appear to have the insert will be confirmed
by DNA sequencing.
IAP 2007 Biology 7.391
4
About your instructors
Dr. Mandana Sassanfar- Mandana has been an instructor in the biology department at MIT since July
2002. In the summer, she directs a summer research program for undergraduates from other college, and
organizes and teaches a workshop for AP biology and honors biology teachers from the Boston area. In
the spring she teaches an undergraduate seminar and organizes an MIT field trip for high cshool
students. In the fall she recruits students for the biology PhD program.
Mandana earned her B.S and M.S in Biochemistry from the University Pierre et Marie Curie in Paris
(she has indeed a French accent). She earned her Ph.D. degree in biochemistry from Cornell University
where she worked on DNA damage in E. coli. She really enjoyed leaving in Ithaca. She then came to
Boston where she first completed postdoctoral work at the Harvard School of Public Health on DNA
alkylation damage and DNA repair in yeast and human, and then in the Department of Molecular
Biology at MGH where she worked on RNA aptamer selection. She then did a 4-year stint in a start up
biotech company in Cambridge selecting for new bacterial drug targets associated with protein syntesis,
before returning to academia, first at Harvard and then at MIT.
Dr. Peter Weigele- Peter is a Research Scientist in the laboratory of Prof. Jonathan King. The King
Laboratory's main focus is protein folding and experiments using the P22 tailspike protein (a phage
protein) and the crystallins (components of the eye lens involved in transparency and cataract) provide
researchers insights into how the linear amino acid sequence of a protein governs its three-dimensional
shape. The King lab also has projects aimed at determining the structure of a phage in the act of injecting
its DNA as well understanding the physiology of cyanobacteria (bacteria which can do oxygenic
photosynthesis) infected by bacteriophage.
Peter started his scientific career doing undergraduate research in a fruit fly lab at the State
University of New York at Albany. After graduation and a two year stint as a laboratory technician, he
went to graduate school at the University of Utah. In 2001, he completed his doctoral dissertation on the
morphogenesis of viral capsids under the mentorship of Prof. Sherwood Casjens. Peter joined the
Department of Biology at MIT in January, 2002, as a post-doctoral associate. Currently, he is Research
Scientist and Microscope Manager for the Biological TEM Users Group. In addition to his research,
Peter volunteers at the Edgerton Center through the activities of the Biological Energy Interest Group
(BEInG) which he helped form in 2004. The BEInG has developed an algal fuel cell as a low-cost
platform for research and education in bioengineering for sustainability at the undergraduate level.
IAP 2007 Biology 7.391
5
WELCOME to 2007 IAP
The Labs will be held daily from 12:30 PM to 4:30 PM in room 68-246
Please arrive on time (as early as 12:15 PM if possible). We will begin at 12:30 PM each day with an
introduction and discussion of the agenda for the afternoon.
You will be working in teams of 3.
Each session will include:

Introduction to the afternoon's experiments

Setting up for the experiments

Reviewing the previous day's experiments

Analyzing the data obtained from the previous day's experiments

Preparing for next day's experiments; e.g., inoculating overnight cultures and properly putting
away/storing reagents and strains overnight.
LABORATORY SAFETY RULES

ABSOLUTELY NO EATING OR DRINKING IN THE LAB!

Wear a lab coat at all time in the lab. Do not wear open-toe shoes

Wear gloves when handling chemicals

Dispose of all bacterial culture and contaminated liquids in 10% bleach.

Rinse all flasks and beakers with water before putting in the wash

Seal used agar plates with parafilm and dispose in biohazard autoclavable orange bags

Dispose of all tips, and sharps in appropriate red containers

Keep benches clean and free of personal belongings at all time

Wipe bench with 70% ethanol before and after each experiments.

Wash hands with soap or alcohol-based hand sanitizers

Dispose of all pipettes and reagents in appropriate containers.

Keep written records of any observation and any deviation from protocols.

Record type of equipment used (name, brand, model) and name of supplier.

Avoid contamination of the plates and bacterial cultures by working under sterile conditions
IAP 2007 Biology 7.391
6

Store all plates, phage stocks and phage dilution at 4ºC
IAP 2007 Biology 7.391
7
TECHNIQUES
Overview
This 2-week class will introduce you to some basic laboratory skills such as keeping a laboratory
notebook, preparation of reagents and media, lab safety, how to correctly dispose of chemicals and lab
etiquette (cleaning up after yourself ) as well as basic laboratory techniques for handling bacteria, DNA
and proteins.
You will be working with four species of bacteria (E.coli, Vibrio, Corrynebacterium, and Salmonella)
and an unknown mixture of aquatic phages that you will concentrate from water samples collected from the
Charles River at the MIT boat house as well as the MWRA Deer Island sewage treatment facility. We will
use microbiology, sterile techniques, ion-exchange chromatography, SDS-PAGE, DNA restriction analysis,
DNA sequencing, electron microscopy, and bioinformatics tools to grow, purify, and characterize the phages
found in these samples. We will also use PCR to amplify and clone a specific phage gene into a protein
expression vector.
Microbiology
You will learn how to concentrate and isolate novel phages from water samples, how to maintain and
store bacterial strains, how to streak for single colonies on agar plates, inoculate liquid cultures with single
bacterial colonies -all under sterile conditions-, how to plate phage samples on bacterial host, how to perform
a plaque assay, how to prepare sterile solutions, how to determine the pfu ( plaque forming unit) of a phage
stock, and how to store phages for long periods of times. You will also pour your own agar plates and
prepare buffers from stock solutions.
Protein and DNA analysis
After preparing large quantities of the phage you will estimate how many types of proteins are
present in the phage capsids by preparing an SDS polyacrylamide gel and using it to separate the proteins of
the capsid by size. You will stain and destain the gel and analyze the results.
You will also isolate phage DNA from a single phage strain, digest the DNA with various restriction
enzymes and view the results on an agarose gel. You will use the results to determine the diversity of the
phage population and to estimate the size of the phage genome. You will learn how to visualize the
molecules of proteins or DNA, and how to record and analyze you data.
PCR and cloning
You will be given the sequence of a phage gene and learn how to design primers to clone the gene
into a given vector. You will first amplify the desired gene sequence by PCR using those primers, purify the
PCR fragment, digest it with restriction enzyme and clone it into a vector by ligation and bacterial
transformation. You will then again use PCR, this time to verify that you have the right size insert in the
vector.
Bioinformatics
You will also learn some basic bioinfomatics and sequence data analysis. These tool will help you in
the correct design of oligonucleotide primers for PCR, verification of DNA sequences, and database
homology searching.
IAP 2007 Biology 7.391
8
LABORATORY SCHEDULE
NOTE: It takes at least 4 to 5 days to start from a water sample to isolate, purify and amplify enough phages for further
characterization. Therefore most of the first week will be spent doing microbiology, and isolating enough phages for
the second week’s experiments. We will also do a protein purification and a PCR cloning in the first week. The second
week will mostly focus on the characterization of the phages that you isolated and amplified the first week.
Note: Several experiments will take place simultaneously. The color code allows you to follow one experiment across
several days.
The green color code is for bacterial culture. It is somewhat related to the purple-coded experiments in that you need
to use fresh cultures of bacteria whenever needed and therefore must make sure to remember to set up overnights
cultures every day before you leave.
Day 1:







Day 2:
Safety guidelines
Lab tour
Overview of the course
How to keep a notebook
Weigh DE-52 cellulose and mix with water sample, set up column, pack cellulose into
column, wash, let stand in cold overnight
Aseptic techniques
Inoculate overnight liquid cultures form bacterial plates (4 strains in total). Re-streak
bacteria on solid medium (agar plate) for single colonies






Elute phages of Column and collect fractions
Determine protein concentration of fractions by the Bradford assay
Pool fractions containing phages together
Plate phages on each bacterial strain using low salt LB and top agar
PCR part I. Oligonucleotide primer design for cloning
Inoculate overnight liquid cultures from single bacterial colonies


Look for the presence of plaques on Bacterial lawn. Record number and shape
Purify phages from well-isolated single plaques (using a sterile Pasteur pipette). Treat
with chloroform, let sit in cold room for couple hours
Prepare 10-fold serial dilutions tubes for phage titering
Plate phage dilutions 103, 104,105 and 106 using top agar and O/N bacterial cultures.
Incubate overnight at 30 ºC
PCR part 2: Set up the PCR reactions
Set up overnight cultures from single bacterial colonies
Day 3:




Day 4:



Record number of phage plaques for the various dilutions and strains
Pick 2 to 4 well isolated plaques from the high dilution plates and place in 1 ml of phage
buffer; add a few drops of chloroform, mix and let sit in cold for a few hours to elute
phage.
PCR: Analysis of PCR products by agarose gel electrophoresis
IAP 2007 Biology 7.391
9

Set up overnight cultures of bacterial hosts (for large scale preparation of virus)

at 9 AM: set up 1/50 or 1/100 dilutions in LB of overnight bacterial culture and incubate
at 37ºC with vigorous shaking. Monitor growth at OD600. using a spectrophotometer and
disposable cuvettes.
When OD600 of liquid cultures reaches between 0.25 and 0.3, infect cultures with phages
eluted from the plaques.
PCR part 3: Digest PCR products, ligate into vector, transform competent E. coli cells,
plate and incubate O/N
When the bacterial culture clears (most of the bacteria have been infected and lysed), add
chloroform, mix, and centrifuge. Collect supernatant. Add solid NaCl and PEG. Incubate
in cold room for at least 30 minutes (or until ready to set up the CsCl gradient
ultracentrifugation).
Day 5:



(Monday PM:) This will be done by the instructors
Day 6:
Day 7:
Day 8:
Day 9:
Day 10:



Centrifuge PEG solution to pellet and collect phage
Resuspend phage in buffer and add solid CsCl.
Set up ultracentrifugation over night





Plate out serial dilutions of each phages on all 4 strains of bacteria hosts (plaque assay)
Collect phage bands from O/N CsCl equilibrium gradient tubes.
Set up dialysis casettes. Change dialysis buffer twice
(in the morning) Pick transformants and set up 1.5 ml liquid cultures.
DNA Mini prep transformants and set up digest to verify size of insert





Collect concentrated and purified phage particles from dialysis casettes.
Analyse restriction digets by agarose gel electrophoresis.
Submit positives for sequencing
Isolate phage DNA from purified phage particles
Record results of plaque assay and determine host specificity




Digest Phage DNA with restriction enzymes
Analyse restriction digest by agarose gel electrophoresis
Take picture of agarose gel
Prepare SDS-polyacrylamide gel, run protein gel of phage particles, stain with Coomassie
blue



Destain and scan protein gel
BIOINFORMATICS: identifying DNA sequences, findings ORFs, Determining
restriction map, sequence homology search
HOMEWORK: Analyze sequence of cloned gene and prepare oral presentation




Data Analysis
Oral presentations
Clean up
Electron microscopy
IAP 2007 Biology 7.391
10

Course evaluation
IAP 2007 Biology 7.391
11
BACKGROUND AND INTRODUCTION
Viruses are acellular organisms. Yet they are alive: they can reproduce inside a host, and they evolve.
Viruses are categorized based on their host (bacteria, plants, human), their genome ( RNA, DNA single
stranded, double- stranded), the shape of their capsid, and the presence of absence of a tail and filaments (as
observed by Electron Microscopy (EM)).
Viruses that infect bacteria are called bacteriophages (or phage). Their genome is composed of DNA.
Like all other viruses they can only be seen with an electron microscope. They are made of a protective
protein capsid that enclose their genome, and a tail or pod that mediates host recognition, attachment and
injection of the genome into the bacterial host cell. For some bacteriophages such as lambda, the receptor on
the surface of the host’s cell is known (the maltose transporter). For many other phages, the manner in which
they recognize and attach to their host is still unknown.
Some phages contain a lipid membrane. These phages were more difficult to discover because they
are sensitive to chloroform which is typically used in phage purification.
Phages are ubiquitous organisms. They are
the smallest and most abundant biological entities
on the planet. The total number of phages in a water
sample can be estimated by epifluorescence
microscopy or by transmission electron microscopy
(TEM) (the phages in the water sample must first be
concentrated).
Results of epifluorescence measurements
suggest that coastal ocean and freshwater bodies
can contain up to 108 viruses per ml. This indicates
that phages are at least 10 fold more abundant than
bacteria and are indeed the most abundant organism
in the biosphere with a global estimate of 1030 total
phage particles
Figure 1. Electron micrographs of some
bacteriophages (from Dennis Kunkel).
www.mun.ca/biology/scarr/MGA2-10-24.jpg
Figure 2. Schematic diagram of a generic
contractile-tailed phage infecting a cell.
IAP 2007 Biology 7.391
12
Figure 3. Electron micrographs of phages collected from the Charles River using
anion exchange chromatography.
IAP 2007 Biology 7.391
13
Because of their sheer numbers and their ubiquitous distribution, phages play an important part in
cycling of biological material, horizontal gene transfer, and defining microbial community composition.
They also impact various industries:
 Phages of Lactobacillus are a serious problem for the dairy industry.
 Biotechnology industry:
a) phage  and filamentous phage M13 have been used as recombinant DNA cloning vectors
b) Phages proteins are a very important source of enzymes for molecular biologyT4 DNA ligase is used in genetic engineering. T7 RNA polymerase is used to drive mRNA
synthesis during protein expression in E. coli DE3 strains (hosts for pET vectors).
c) Phage display is a very powerful technology for the evolution and selection of novel
proteins, antibodies, and binding sequences.
Medical applications:
a) Phage typing- Since many phages have a very restricted host recognition, they can be used to
rapidly identify a strain of bacteria (e.g. Staphylococcus);
b) Anti-bacterials- Phages kill their bacterial host by lysis and could be used to prevent or treat
infections. Treating infections with phages, or “phage therapy,” was used during the Stalin era to combat
wound infections. With the emergence of antibiotic resistance and the alarming increase in Methicillin and
possibly Vancomycin resistance among Staphylococcus aureus strains, the idea of using phages to control
bacterial infections is receiving renewed attention. However most of the research on phage therapy is still
conducted in labs in Eastern Europe.
Despite the fact that phages are the most ubiquitous and numerous organism on earth, relatively little
is known about the diversity, distribution, and dynamics of phages in natural envirionments!
The focus of this IAP course is two fold:
1) Attempt to isolate and characterize new species of phages from local ponds and rivers
2) Clone a phage gene by PCR and confirm the recombinant clone by sequencing it.
In the process, you will learn many of the basic laboratory techniques and bioinformatics tools
currently used in many biological research labs.
IAP 2007 Biology 7.391
14
DAY 1
1) Concentrate of phage communities by ion exchange chromatography
(Adapted from a protocol developed by Roger Hendrix at the University of Pittsburgh)
Overview:
This is a method for concentrating and purifying whole communities of bacteriophages from environmental
freshwater sources. The method can be used on 1 to 100 L of water sample. The main steps are:
• collect water and pump through coarse filtration
• bind phage by adding DEAE-cellulose to water, stirring, and letting settle out
• decant excess water
• transfer anion exchange resin to column
• wash column and elute phage from the DEAE-cellulose with high salt
• further purify phage by CsCl equilibrium density gradient ultracentrifugation
Each group will receive a 4-liter environmental water sample of their choice: Charles River, Spy Pond, or
final effluent from the Deer Island Wastewater Treatment Facility (yum!).
Materials:
4 L of water sample in a large beaker or flask
4 grams of Whatman DE-52 (DEAE-cellulose anion exchange resin) (1 g per liter)
Column wash buffer (10 mM Tris HCl, pH 7.5, 5 mM MgCl2, 25 mM NaCl) kept at 4 ºC
Column elute buffer (Column wash buffer containing 0.5 M NaCl) kept at 4 ºC
Luer stopcock and fittings
Chromatography column (BioRad)
Small glass tubes and holder
Ice Buckets
Large beaker
Magnetic stir plate and stir bar
Binding phage and packing the column:
 Add 1g of DEAE-cellulose (Whatman DE-52) per liter of river water. Keep at 4°C by incubating the
flask in an ice bucket or by working in the cold room. Add a magnetic Stir bar, and stir gently and
continuously for 30 minutes on a magnetic stir plate. The phage particles will bind to the DEAEcellulose resin. Turn on the stir plate and let the resin settle. (note: you can also stir manually every
10-15 minutes for one hour)
 Let the DEAE-cellulose settle out by gravity. (takes 20-30 min).
 Decant as much of the water as you can by siphoning or pouring out the water. If necessary resuspend
the DEAE-cellulose in the remaining water and transfer the slurry to a smaller container, such as a
beaker. Allow to settle again, and decant water (Remove enough water to still maintain a free-flowing
slurry).
 Set up a small column fitted with a stopcock at the bottom (Bio-Rad Econocolumn) on a stand. Place
a funnel or reservoir at the top and a beaker or flask under the column to collect buffer.
 Pour the DEAE-cellulose slurry into the column. Open stopcock to drain out water and to pack the
resin into the column.
 Close the stopcock once the top of the liquid reaches 2-3 cm above the resin. Remove funnel and
replace with a cap attached to a small flexible tubing.
IAP 2007 Biology 7.391
15





Place the free end of the tubing into a bottle of column wash buffer kept on the shelf so that it is
higher than the column. The higher the buffer, the higher the pressure and the faster the flow.
Open the stopcock. The buffer will siphon down and drip onto the top of the column bed. Do not
allow the top of the column to go dry. There should always be several millimeters of water on top
of the resin.
Allow 4 to 5 column volumes of buffer to flow through the column. (you need to determine the
volume of your column)
Close the stopcock. Remove tubing from wash buffer and hold up to drain into column.
Store column into cold room until ready to elute (next day)
Inoculate bacterial cultures
 Obtain 4 plates each containing one type of bacteria. Label the plates (on the bottom) with your
initials. These plates are now yours and should not be contaminated. Always store plates upside down
and parafilmed.
 Distribute 1.5 ml of sterile LB into four 18 mm sterile glass tubes.
 Use a long sterile tooth pick to transfer one individual bacterial colonie into each tube. Label each
tube with the name of the bacterial strain ( E. coli, CRB5, Vibrio, Salmonella). (Always use tape or
sticky dots. Do not write directly on the tube)
 Place the tubes in the roller drum in the warm room, Always balance the tubes. Turn ON the roller.
IAP 2007 Biology 7.391
16
DAY 2
(#1 Continued)
Elute phage:
 Open stopcock and let buffer drain until there is just one mm of buffer at the top of the resin.
 Close stopcock. Remove cap and add gently about one ml of elution buffer with a Pasteur pipette to
avoid disturbing the top of the resin. Place back the cap and place the end of the tubing into the
elution buffer (this buffer contain high salt which detaches [elutes] the phage particles from the
resin).
 Remove waste beaker from under column and place glass tube holder under column.
 Open stopcock and start eluting phages. Make sure that the elution buffer is siphoned into the tubing
by vacuum and that the resin does not go dry.
 Collect 1.5 ml fractions into the glass tubes.
Determine relative protein concentration
 Determine protein concentration with the Bradford assay (Bio-Rad reagents). The Bradford assay is a
colorimetric assay which measures the binding of a dye (Coomassie blue) to protein at low pH.
Binding is measured spectrophotometrically observing absorbance at 595 nm. NOTE: If the water
sample has tannins or other colored compounds, they may interfere with the protein assay. However
the bulk of these colored compounds typically elute with the phages and can be used as a rough
indication of where the phages are.
 You will need a 96-well plate, buffer, Bradford reagent, a protein solution for the standard curve
(BSA), and 160 µl of each column fraction to be tested
 Add 160 µl of sample to the microtiter plate, add 40 µl of Bradford reagent and allow 5 minutes for
color change to fully develop.
 Compare the fraction samples to the BSA standard curve to determine the location of the protein peak
 Pool the fractions that contain proteins together into a sterile 30 ml centrifuge tube. Label the tube
with your initials, sample name and date. Store tube in the refrigerator!
2) Screen concentrates for phages infecting selected bacterial hosts
In order to better characterize the phages from the water samples, we first need to grow and
amplify the phage on its host cells. This requires us to identify a proper bacterial host that the phage
can infect and replicate in. Since we are working with novel phages we can try to grow the phages on
known bacterial strains or from a bacterial strain that was isolated from the Charles River
(Corynebacteria aquaticum).
Your choice of potential hosts:
Esherichia coli C122
Esherischia coli BL21
Salmonella anatum
Salmonella typhimurium
Vibrio splendidus
Vibrio harveyii ssp B-392
Corynebacterium aquaticum ssp. CRB5
Corynebacterium aquaticum ssp. CRB7
Ralstonia eutropha H16
IAP 2007 Biology 7.391
17
Materials:
Top agar
LB plates that have been kept at room temperature or 30ºC for several hours
Microwave
Heat block at 48 ºC
Small sterile glass tubes
Phage solution
Overnight liquid culture of Bacteria
Pipetman and sterile tips







Melt the soft top agar in the microwave.
Distribute 3 ml aliquots in glass sterile test tubes and incubate in a heat block set at 48 ºC. (each team
will need 4 tubes).
Retrieve the overnight bacterial culture from the warm room. Retrieve your phage sample from the
refrigerator
Label 4 sterile test tubes with the name of the bacterial host ( E. coli, CRB5, Vibrio, sal).
Add 300 µl of bacterial stain into the corresponding tube. Add 100 µl of the phage concentrate into
each tube. Let sit for 10 minutes at 30ºc (use a small heat block).
Label 4 LB agar plates with your initials, date and bacterial strain (label the bottom of the plates)
To plate each sample, add 3 ml of top agar into the glass tube containing the bacteria and phage
concentrate and immediately pour the tube onto the corresponding LB agar plate. Rotate plate gently
to spread the agar evenly. Let sit for 10 minutes to allow for the agar to solidify and then incubate
upside down at 30ºC over night.
IAP 2007 Biology 7.391
18
DAY 3
(#2 continued)
 Retrieve plates from warm room. Record the number of plaques on the bacterial lawn. Try to
determine how many different phage types you may have on the plate by carefully looking at the
shape and size of the plaque, its relative transparency, and the edges of the plaque. How many
different type of plaques to do see? Record your observations and describe the plaques morphology.
You may take a picture of the plaques with a digital camera.
3) Isolate phage from single plaques
To characterize a particular phage (protein components, DNA restriction pattern, DNA
sequence, etc..) it is imperative that we work with a homogenous phage sample containing only
one type of phage (pure strain). A plaque on a bacterial lawn is the result of several successive
cycles of infection and lysis of neighboring bacterial cells by the progeny of a single phage and
contains identical phage particles. Therefore before scaling up the production of the phages we
need to purify and amplify phages from a single isolated plaque.








Label 3 small plastic microfuge tubes with the bacterial strains and your initials.
Add 500 µl of phage buffer to each tube and keep on ice
Choose a well-isolated healthy-looking plaque on the plate.
Use a sterile glass Pasteur pipette with a small bulb at the end to pluck the plaque out by suction.
Expel the plaque into the buffer. Siphon up the buffer up and down several times if necessary.
Add 3 drops of chloroform, close the cap. Hold the tube between the index and thumb and invert
back and forth to mix the chloroform. Avoid violent shaking or vortexing. It could damage the phage
tail and the phage will not be infective anymore.
Let sit for at least 20 minutes to allow the phage to diffuse out of the agar and for the chloroform to
settle at the bottom of the tube.
Microcentrifuge for 10 sec. Transfer the supernatant to a new labeled tube. This is your purified
phage stock originating from a single plaque and corresponding to a single phage strain. Give your
phage a name.
The chloroform is used to kill the bacterial cells and complete lysis. It does not destroy most virus particles
unless they are filamentous phages or contain a lipid membrane.
You can use small aliquots of this stock to view under the microscope or for PCR analysis, or to propagate
the phage and produce more phage.
4) Determine titer of phage stock
To make a large scale preparation of your phage you need to first know accurately how
many infective phage particles or plaque forming units (pfu) there are per ml of phage stock. In
other words you need to determine the pfu of your phage stock. This is important because the
initial ratio of bacterial cell to phage or multiplicity of infection (MOI) is very important for a
successful large-scale phage preparation.
Note: you always need to know the proper bacterial host for your phage. So from now on you have to keep
track of what phages you are working with and on what bacteria they grow. Similarly you need to always
IAP 2007 Biology 7.391
19
properly label all tubes and plates with the name of the bacterial strains, the date, your initials, and any other
pertinent information (dilution fold, phage strain ..)
Material:
For each phage stock you want to titer you will need:
6 small sterile glass test tubes (for 10 fold serial dilution up to 1,000,000 fold or 106)
3 tubes of 3 ml melted top agar (in heat block)
3 LB plates (labeled with the phage stock, date, your initial and the fold dilution)
3 sterile glass tubes (labeled with phage stock and dilution)
P 1000 pipettman
P 200 pipettman
Sterile tips
Vortexer




Add 900 µl of sterile phage buffer into 6 sterile glass tubes labeled 101 to 106 to indicate the fold
dilution. (you can use the same tip).
Add 100 µl of phage stock into tube # 1 ( 101 fold dilution) ( use sterile tips)
Vortex. Change tip. Transfer 100 µl from the 101 dilution tube to the next tube ( 102 fold dilution)
Vortex, change tip and repeat until you transfer 100 µl from tube 105 to 106.
10-fold serial dilutions






Add 100 µl of an overnight culture of the host bacteria into 4 new tubes labeled 103, 104, 105 and 106
(use same tip)
And 100 µl of the 103 fold phage dilution to the 100 µl bacteria in tube labeled 103. Mix gently.
Repeat the procedure for the 104 ,105 and 106 fold dilutions
Let sit for 10 minutes to allow the phage to adsorb to the bacterial cell.
Plate the mixtures on labeled LB plates with 3 ml of top agar as described in section 2
Incubate the plates upside down in the warm room overnight.
IAP 2007 Biology 7.391
20
5) Amplify a phage gene by PCR
The Polymerase Chain Reaction (PCR) is used to make millions of copies of a template DNA sequence
in just a couple of hours. Kary Mullis of Cetus Corporation, received the Nobel Prize for developing
this revolutionary DNA amplification technique.
A PCR reaction contains
 DNA to be amplified (in our case the source of DNA will be from single plaques or our large
phage prep)- this is the the template
 Short DNA primers (oligonucleotides) which bind to complementary sequences on the template
DNA
 The 4 deoxy nucleotide (dNTPs) which are the building blocks of DNA (dATP, dTTP, dGTP,
dCTP) used by the polymerase to synthesize the complementary strand on the template DNA
 DNA polymerase; Taq DNA polymerase isolated from organisms living in hot springs is heat
resistant (30 minutes at 95 °C) and works best at 72 °C.
The steps of the PCR reaction:
 Denaturation- DNA is heated to 95° C to separate the two DNA strands of the DNA template
= melting step.
 Annealing- The reaction is cooled to a temperature (which can vary from 37 to 70 ºC
depending length and base composition of the primers) where the two DNA primers can
anneal or bind to their complementary sequences on the DNA template.
 Elongation- The temperature is raised to 72 °C, the temperature optimum for synthesis of
DNA by the thermostable DNA polymerase (this step also known as “extension”)
These three steps are cycled, typically 25-30 times, to make billions of copies of the DNA sequence that lies
between the two DNA primers- shown schematically on the next page.
Set up PCR reaction
• Each of you will be assigned a gene to clone (12 genes alltogether)
• Obtain your forward and reverse primers, as well as your template DNA
from the TAs
• Keep all components and mixtures on wet ice
• Add enzyme last, mix up and down with a pipette set to 45 µl
• Be careful not to warm tube with fingertips, nor introduce bubbles while mixing
50 µl PCR reaction
(calculate your volume of water and add first)
5 µl buffer (10X stock)
2 µl dNTP mix
2 µl forward primer
2 µl reverse primer
20 ng of phage gDNA template
1 µl of Pfu turbo
(H2O to make 50 µl total)
Mix the reaction components and add to a hot PCR block. Use the program “7_391” on the thermocycler.
IAP 2007 Biology 7.391
21
PCR reaction
Downloaded January 6, 2007 from http://commons.wikimedia.org/wiki/Image:Pcr.png
IAP 2007 Biology 7.391
22
DAY 4
(#4- Titer phage stock, continued)
 Retrieve plates from warm room.
 Count the plaques for each dilution and record the number in the table below.
 Determine the titer of the phage stock in pfu/ml.
Dilution
fold
10 3
10 4
10 5
10 6
# of plaques in
# of
100 µl of 10 1
PFU/ ml
Phage
______
Phage
_______
Phage
_______
Phage
______
6) Scale up phage lysate
In order to have enough material for protein gels, DNA extraction, electron microscopy,
sequencing, or to distribute to your friends or family you need to prepare a large-scale culture of
bacteria and infect them with phages in the appropriate ratio (1 phage for every 10 to 100 bacteria). It
is therefore very important to infect with a phage that was isolated from a single plaque to insure strain
purity. It is also essential to accurately determine the titer of the phage.
There are two ways to obtain large amount of phages. The bacterial cells can be infected with phages
in liquid culture or grown on agar plate using top agar to plate the infected cells.
We will use the liquid culture method because you need less material (agar is expensive) and it is easier to
scale up to large volumes. However if the phage forms small plaques and grow slow or can lysogenize the
bacteria it is easier to get the right conditions with the LB agar plate method.





Start an overnight culture of the host bacteria in 5 ml of liquid LB right before leaving for the day:
use a long sterile wooden stick to pick a single bacterial colony from a plate and inoculate the liquid
LB. Cap the tube and incubate at 30ºC overnight (at least 8 hours) in a roller to provide aeration.
Transfer 250 ml of sterile LB into a 1-liter baffled sterile flask and keep at 30ºC.
Use a sterile glass Pasteur pipette to siphon up 3 to 5 plaques from a plate.
Expel the plaques into a microfuge tube containing1 ml of phage buffer. Add a few drop of
chloroform. Mix well and let sit in the cold to allow for the phages to diffuse out of the agar. Label
the tube so that you know what it is. It is best to transfer the phages into a new tube (but can wait
until the next day):
THIS SECTION CONTINUES ON DAY 5 in the AM!
IAP 2007 Biology 7.391
23
7) Analyze PCR products by agarose gel electrophoresis:
1.
Prepare 50 ml of 1% agarose in 1X TAE.
Weigh 1 g of agarose per 100 ml of TAE
Add to an Erlenmeyer flask
Microwave 1.5 to 2 minutes to completely dissolve the agarose. Use thick protective gloves to
remove the flask from the oven. Swirl around to mix. Avoid creating bubbles while mixing. If the
agarose is fully dissolved the solution should be clear. Let stand on the bench while you are taping
the tray.
2.
Insert the gel tray side ways in the chamber to seal the side. Insert the comb.
3.
When the agarose solution is around 55°C, add 10 µl of SYBR safe solution, mix gently and pour the
solution into the tray until it reaches 3/4 of the teeth height. Make sure the tray is on a flat surface.
Let solidify for at least 15 minutes. The solidified gel will be white and solid to the touch. Set the tray
correctly in the electrophoresis chamber by takignit out of the chamber and turning it 90 ºC. Pour 1X
TAE buffer in the chamber until all the wells are covered.
4.
Add 6 µl of 5X DNA loading dye into each PCR tube. Mix briefly and centrifuge.
All samples will be loaded on the same gel. We will run duplicate gels.
Load 8 µl of Mw standards ( 1 Kb and 100 bp ladders) in the end lanes.
Load the positive control on the second well from the left.
Load 20 µl of each sample into the wells starting with the negative control.
5.
Close the lid. Connect with leads to the power source. Turn on the power and set the voltage at 90 V.
Run for 35 minutes.
6.
Turn the power supply off. Disconnect the leads. Take the tray out. Hold the open sides of the tray to
prevent the gel from slipping away. Put the gel on the UV box.
7.
Turn the UV light on. Set the camera on top of the box and squeeze trigger. Pull out picture and let
develop for 45 seconds before peeling apart the print.
If you get a decent band from your PCR reaction, clean up the reaction using the qiagen PCR cleanup
kit. This product removes nucleotides, primers, enzymes, and small fragments of DNA. Additionally, the
buffer is replaced by 10 mM Tris, pH 8, making the DNA easy to add to subsequent enzymatic reactions,
such as restriction digests.
Then, quantitate your DNA on the spectrophotometer:
A280 x 50 x dilution factor = [DNA] in µg/ml
IAP 2007 Biology 7.391
24
DAY 5
(#6 Large scale prep, continued)
In the morning: (~10 AM)
 Transfer 4 ml of the overnight into 250 ml of pre-warmed LB (50 fold dilution) and incubate in a
shaker at 30 ºC.
 Monitor the growth of the bacteria at OD600 every 30 minutes by transferring 1 ml of the culture into
a plastic cuvette and recording the OD in the spectrophotometer (use sterile pipette).
 Retrieve the tube containing the phage plaques from the refrigerator and centrifuge the tube for 30
sec to pellet the agar and the bacterial debris and transfer the supernatant into a new tube. Add one or
2 drops of chloroform and store at 4 ºC until needed.
 As soon as the bacteria reach an OD600 between 0.25 and 0.3 (1 to 3 hours) add the phages at a MOI
of 0.1 to 0.01. The bacterial culture should have a density of ~ 108 cells per ml. To reach an MOI of
0.01 we need to infect the bacteria with about 106 phages per ml or with about 2 X 108 phages for a
200 ml culture. From the results of day 4 we know how many phages are in a plaque. Therefore we
can calculate how many microliters of the phage suspension we need to add to the flask to reach an
MOI of 0.01. (typically 2 to 4 plaques will provide enough phages to infect 250 ml of the bacterial
culture)
 Continue the incubation at 30ºC with shaking until the OD600 drops (the LB becomes clear). This
indicates that most of the bacteria have been infected and lysed releasing phages.
 Add 5 ml of chloroform, swirl around, let sit for 5 minutes so that the chloroform settles down at the
bottom.
 Transfer the supernatant into a large centrifuge tube. Be careful NOT to transfer any of the
chloroform
 Centrifuge at 5000 to 8000 rpm for 10 to 15 minutes to pellet the cells and debris
 Transfer the supernatant into a new centrifuge tube. Add 7.3 g of NaCl (0.5 M) and 25 g of PEG 8000
(10% w/v). Swirl to dissolve and incubate at 4 ºC for at least one hour.
#8 Digest and ligate PCR product with plasmid vector
In this step you will ligate the PCR product with a plasmid vector containing an inducible promoter
upstream of the cloning site. This will allow you to subsequently express the protein encoded by the DNA
sequence you have amplified and cloned into the plasmid. In the first part of this step, you will cut both the
PCR product and the plasmid with restriction enzymes to generate «sticky» or compatible cohesive ends.
These compatible ends are the substrates of the ligase in the second part of this section. The DNA ligase will
join compatible ends (ends which share 4 bp of complementary sequence).
Digestion, (50 µl volume)
To a tube add in the following order
(calculate µl H2O added to make 50 µl total, and add first)
5µl buffer
1 µl BSA
1 µg DNA
10 U of each restriction enzyme.
Note: You will perform digests of the inserts and the plasmid separately. The enzymes you will use will
depend on the sequence of your primers. See appendix eight for the enzymes needed to digest your PCR
product and your plasmid. The appendices have plasmid maps showing where the inserts will be ligated into.
IAP 2007 Biology 7.391
25
For today’s cloning, you will be using two enzymes, NdeI and BamHI, that use different restriction buffers.
Therefore, you will digest in stages. Add NdeI and NEBuffer2 and let digest for 1 hour. Add NaCl from a
5M stock to bring the final concentration in the reaction up to 150 mM. Now add BamHI.
Remove endonuclease and small DNA fragments
Use the Qiagen PCR cleanup kit to remove the restriction enzymes and small cleavage products from
the digestions. Follow the instructions in the kit. Assume 80% recovery of material for calculating DNA
concentration in the ligation step.
Ligation
To a tube add in the following order:
Calculate how many µl H2O, if any, to make 20 µl total
150 ng digested plasmid
200 ng digested PCR product
10 µl T4 “Quick” ligase buffer
1µl T4 “Quick” ligase
• add enzyme and mix gently
• incubate at room temperature for 5 minutes
• place on ice
9) Transform E. coli with ligation mixture
In this step, you will transform chemically competent E. coli cells with your ligation mixture. The
cells have been treated with CaCl2. While on ice, changes to the membranes of the cells (in a process that is
poorly understood), allow the cells to take up exogenously added DNA. In your ligation mixture will be a
range of products. Only circular, covalently closed DNA molecules bearing an resistance gene will transform
your cells to antibiotic resistance. This means that both vectors that have ligated their ends (single cuts and
self-ligations) as well as vectors that have obtained an insert will transform your cells.
• add 5 µl of ligation mixture to a falcon 2059 tube and place on ice
• add 100 µl of competent DH5 cells and mix gently by swirling
• leave on ice for 30 minutes
• heat shock cells by placing tube in 42°C water bath. Do not agitate
• place cells on ice for 2 minutes
• add 900 µl of prewarmed LB plus 0.8% glucose
• let recover at 37°C with shaking for 30 to 60 minutes
• plate on prewarmed LB agar plus ampicillin
• incubate overnight at 37°C
IAP 2007 Biology 7.391
26
Monday January 15 (holiday)
#10 Purify phage by PEG precipitation and CsCl gradient centrifugation



Centrifuge the PEG solution at 10 000 rpm for 20 minutes.
Discard the supernatant and resuspend the pellet in 5 ml of cold phage buffer. You can pipette the
buffer up and down to help resuspend the pellet but avoid creating bubbles.
Transfer the resuspended phage particles into a 10 ml sterile screw cap glass tube.
This is your large-scale purification of phage particles. You should have enough to do many experiments
and characterize the phage. However this preparation is not pure enough and contains many bacterial
contaminants that came down during the PEG precipitation. To obtain a very pure sample of phage particles
the sample will be subjected to CsCl equilibrium density ultra centrifugation (see appendix) to yield a very
pure and highly concentrated phage stock stable for a long time.
Purify phages by equilibrium density ultracentrifugation.
 Weight Xg of CsCl. Transfer 9 ml of the phage suspension to a 15 ml screw cap tube.
 Add the CsCl. Mix gently until all in solution.
 Weigh the centrifuge tube. IT IS VERY IMPORTANT TO HAVE PERFECTLY BALANCED
TUBES.
 Transfer to ultracentrifuge tube. Heat seal top of the tube
 Place tubes in Beckman SW60 fixed-angle rotor
 Pace rotor in ultracentrifuge.
 Close door and start vacuum. Set up speed at max RPM for at least 16 hours.
(#9 ligation transformation, continued)
Pick transformants for overnight cultures
 Add 1.5 ml of Super Broth plus ampicillin (100 µg/ml) to 13 mm test tubes
 Use a sterile toothpick to pick a colony
 Drop pick into broth
 Shake overnight at 37°C
IAP 2007 Biology 7.391
27
DAY 6
(#10 CsCl purification, continued)
During the run the CsCl solutions even out into a roughly linear density gradient and the phages band
around a density of 1.5. Unlike the case of a homogeneous phage stock, where one sees a single sharp phage
band, in this case we see a diffuse area of light-scattering material, sometimes punctuated with one or more
faint sharp bands. We collect a broad section of the gradient, encompassing most of the phage, by puncturing
the side of the tube with a hypodermic syringe.
Harvest and dialyze CsCl purified phage particles
Collect the phages by puncturing the side of the centrifuge tube, just below the phage band, with an
18 or 20 gauge hypodermic needle. Carefully draw up the band into the syringe by slowly pulling out the
plunger and sweeping the needle tip back and forth across the diameter of the tube.
Using the same needle and syringe, transfer the phage/CsCl mixture into a dialysis cassette, attach the
flotation buoy, and immerse in 2L of phage buffer with a stir bar in the cold room. Change the dialysis buffer
just before you leave for the day. Retrieve the dialyzed material the next day using a fresh needle and
syringe. Transfer to a sterile glass screw capped tube.
#11 Screen transformants for correct insert
• retrieve plasmids by mini-prepping overnight cultures
• digest with enzyme that cuts insert
• use empty vector as a control
• run digest on agarose gels with size standard
IAP 2007 Biology 7.391
28
DAY 7
12) Extract DNA from purified phage particles:
This protocol is designed to be done in 1.5ml microfuge tubes
For comparisons, you will purify the DNA from both the PEG precipitate and the CsCl purification

To each microfuge tube add:
400 µl purified phage particles
25 µl 10% SDS
50 µl 1 M Tris-Hcl pH 8.0
25 µl 0.5M EDTA, pH 8.0
Cap the tube and mix well by inverting the tube back and forth
Incubate in a heat block set at 70°C for 20 min to break down the phage particle
Add 500 µl phenol:chloroform:isoamyl alcohol (25:24:1) (available commercially) UNDER THE
HOOD
Mix well by holding the tube between index and thumb and shake for 2 minutes
Place tube in microfuge and spin for 2 min at top speed
Using a P1000 pipette Transfer carefully the top aqueous layer to a clean labeled tube. Discard the
phenol phase in the proper organic waste. If needed repeat the phenol:chloroform:isoamyl alcohol
step.
Incubate the tube on ice
Add 50 µl of 3M NaOAc (pH 5.2) and mix until there is only one homogenous phase (no visible little
wavy lines)
Incubate on ice for 5 min
Add 2 volumes (~ 900 µl) of 100% ice-cold EtOH (kept in the freezer) and mix back and forth until
wavy lines go away. A large cottony ball containing the DNA should appear
Flame the end of a glass Pasteur pipette to close the opening
Spool up the white DNA ball on the closed Pasteur pipette
Immerse the spooled DNA into a microfuge tube containing 70% EtOH, swirl around or up and down
to wash away the salt.
Let DNA air dry on Pasteur pipette on the bench for ~ 15 minutes by placing the end of the Pasteur
pipette into a tube holder point up! The DNA will switch from white to transparent as it dries.
Immerse Pasteur pipette into 200 µl TE; the DNA will dissolve into the TE (you may have to scrape a
little to get it all off the pipette)















ET VOILA!!


Store the Purified DNA in the refrigerator.
Determine the concentration of the DNA solution by taking an OD260 measurement.
An OD260 of 1 is equivalent to 50 µg/ml of DNA
IAP 2007 Biology 7.391
29
DAY 8
13) Enzyme restriction analysis of phage DNA
This is a very useful step to estimate roughly the size of the genome. It is also a very good
exercise to discuss the separation of DNA fragments in an electric field. In addition unless two phages
are identical they will probably yield different DNA restriction patterns. Therefore enzyme restriction
analysis is a quick method to look at genome diversity and determine if two phages isolated
independently are from the same strain or not.
Digestion with restriction enzymes :
Choose 2 or 3 restriction enzymes that are known to cut well and are cheap (EcoR I, BamH I, Hind
III). These enzymes are all recognizing 6-base palindromes (six cutters). The probability that a specific 6
bases sequence is found randomly is 1 in every 46 bases.
To set up a digest:
 For each DNA/enzyme pair label a microfuge tube with the restriction enzyme and the phage (and
date and initials)
 The DNA digest will be done in a total volume of 25 µl in a 1.5 ml microfuge tube
Add to a tube on ice:
19 µl of sterile water
3 µl of DNA sample
2.5 µl of 10X buffer (specific for each restriction enzyme)
0.5 µl of enzyme
Incubate in a heat block at 37 ºC for one to 3 hours .
 Add 3 µl of 10X loading dye to each tube
 Keep in freezer until ready to use
Agarose gel electrophoresis:
1. Prepare 50 ml of a 1% agarose in TAE:











Weigh 0.5g of agarose and pour into a 250 ml Erlenmeyer flask.
Add 50 ml of 1 X TAE (note that the TAE stock is 10X)
Mix well and heat in microwave oven on Hi for 1 to 2 min.
Use plastic holder to take the flask out and Swirl around. Avoid making air bubbles.
Microwave again if necessary to dissolve all the agarose but avoid boiling the solution.
While the melted agarose is cooling place the gel tray in the electrophoresis chamber at right angle to
form a seal between the tray and the chamber.
Insert a 12-teeth comb into the end of the tray.
Add 10 µl of 0.5 mg/ml ethidium bromide to the melted agarose, swirl around and pour into the tray.
(WEAR GLOVES! DISCARD EtBr contaminated tips into special container.)
Let agarose solidify.
Remove the tray, turn it 90 º and replace it in the chamber.
Add 1X TAE to cover the gel (about 200 ml)
2. Loading the gel
 Vortex DNA sample for a few second and centrifuge for a few second.
 Load 15 µl of each sample into the well

IAP 2007 Biology 7.391
30





Slide cover on and connect leads to power supply. Make sure the positive lead is toward the end of
the gel since the DNA is negatively charged and will be moving toward the anode.
Set voltage at 100 V and run for 45 min to1 hour.
Disconnect leads
Place gel on UV box and turn UV light on
Take Polaroid picture for record (Use yellow filter if necessary).
Data analysis
 Prepare a MW standard curve by measuring the distance of migration from the well to each band in
the MW standard lanes.
 Plot a curve with the molecular weight ( # of base pairs) on the X axis and the distance of migration
on the y axis.
 Count and record the number of bands for each enzyme digest of the phage DNA
 Estimate the size of each of each band using the Mw standard curve
 Estimate the size of the phage genome for each enzyme digest by adding the sizes (in bp) of all the
bands in the lane.
 Compare the results with the different enzymes. Are they different? Why? What would be the best
approximation of the size of the phage genome.
 Are the 3 phages from the same strain? Are they related? How can you tell?
 The phage stock may have contained some residual bacteria and the DNA prep may be contaminated
with bacterial DNA. How can you be sure that the bands you see come from phage DNA and not
bacterial DNA?
 What would be a proper control?
14) Resolve phage particle proteins by SDS-PAGE
The phage particles contains several type of proteins.
The proteins of the head: The head holds the phage genome and is the largest component of the phage
particle. There are several hundreds to several thousand copies of the head proteins per phage particles and
those will be the most abundant and prominent band on the gel.
The tail proteins and the portal proteins which play a major role in host recognition and attachment. Those
are present in smaller amounts
The portal proteins are the most interesting to study as they define host specificity and which bacteria
can be infected, and play an essential role in the movement of the DNA from the head into the bacterial cell
during infection and during the packaging of the DNA into the head of new phage particles. Together with
the terminases (a complex of phage proteins that hydrolyze ATP and can cut DNA after packaging), the
portal proteins form a molecular motor that pulls the DNA into the capsid during virus assembly.
It has been shown that the host specificity of a phage can be switched by switching tails. The first
step toward characterization of the capsid proteins is to run a simple 12% SDS polyacrylamide gel and
observe the number and size of the protein bands. The phage preparation should be free of bacteria as much
as possible or many of the protein bands will be coming from bacterial proteins.
The large scale production of phage described in step 5) yields a pure enough phage preparation for
this analysis. There is no need to lyse cells or to remove debris. The phage particles can be directly loaded
onto and SDS-PAGE gel after boiling the particles in protein sample buffer containing SDS and DTT.
MATERIAL FOR SDS-PAGE AND STAINING
IAP 2007 Biology 7.391
31























SDS running buffer for SDS-PAGE (10X stock solution)
3X Protein sample buffer (also called loading buffer or cracking buffer)
30 % acrylamide-bis solution (30: 0.8)
TEMED
Fresh10% Ammonium persulfate (we will use frozen aliquots of 10% APS for one time use)
bottom buffer (1.5 M Tris HCl pH 8.8, 10% SDS)
Top buffer (0.5 M Tris HCl pH 6.8, 10% SDS)
0.1% SDS (to layer on top of bottom gel)
Transfer pipette
Distilled water
Coomassie blue Staining solution
Destaining solution
Protein Molecular weight markers (Broad range from BioRad)
Ice bucket
Pipetteman and tips for 10 µl to 500 µl
Small glass tubes
1.5 ml microfuge tubes
Table top microcentrifuge (for up to 12 000 g)
Power supply, clamps and leads
Electrophoresis chamber for minigels (BioRad mini-protean 3 electrophoresis cell)
Set of clean dry glass plates (Long and short)
Casting chamber
Heat block with thermometer to boil samples
NOTE: acrylamide does not polymerize well or evenly when exposed to air. A layer of 0.1% SDS solution,
carefully applied to the top of the freshly poured monomer, will allow for complete polymerization of the gel
up to the polymer/liquid interface. Some folks use water saturated butanol or isopropanol for this step, but
we avoid their use as they tend to “scar” the plastics typically used in commercial acrylamide gel setups.
IAP 2007 Biology 7.391
32
To Prepare a 12% SDS-polyacrylamide gel using the BioRad casting system:
Set up glass plates
 Take a short back plate and a long front plate (with integrated spacers). The glass plates should be
CLEAN and dry!
 Align carefully and clamp together in casting frame.
 Insert comb between plates and label the plate 1 cm blow the teeth. Remove comb
 Set casting frame on casting stand to seal the bottom.
IAP 2007 Biology 7.391
33
Prepare 5 ml of 12% acrylamide gel
• components include water, lower buffer, acrylamide, and catalysts
• degass in a sidearm flask (optional)
WEAR GLOVES when handling acrylamide!
% gel
H2O
30% acrylamide bis
Buffer/SDS
__________________________________________________________________
5
2.9 ml
0.8 ml
1.3 ml (Stacking)
10
2 ml
1.7 ml
1.3 ml (separating)
12
1.7 ml
2 ml
1.3 ml (separating)
Degas briefly by hooking a vaccum tube to the side arm flask and capping the top of the flask.
Then, add
25 µl of 10 % APS and
3 µl of TEMED (smells very bad)
Mix immediately (but gently) by swirling around to avoid bubbles and pour quickly (but carefully) between
the plates using a disposable plastic transfer pipette until the solution reaches the line 1 cm below the teeth.
Add immediately a THIN layer of 0.1% SDS (1 mm) with a new disposable pipette and let polymerize (45
minutes).
Once the bottom gel has polymerized pour out the layer of SDS by tilting the plate and rinse with distilled
water. Let drain.
Prepare 5 ml of stacking gel (in a side arm flask) using the stacking buffer
Degas briefly
Add 25 µl of 10% APS and 5 µl of TEMED
Swirl gently
Pour with a plastic transfer pipette until the top of the short plate.
Insert the comb and let polymerize for ~ 30 minutes
Remove comb
Rinse wells with running buffer
Set up gel in electrophoresis chamber as outlined below.
Add 1 X SDS running buffer until the buffer reaches half way past the short plate. Do not overfill tank.
IAP 2007 Biology 7.391
34
IAP 2007 Biology 7.391
35
Prepare protein samples




Pipette 5 µl of the phage concentrate into a microfuge tube
Add 45 µl of 1 X SDS lysis buffer (contains SDS and b-mercaptoethanol), close the tube tightly, mix
by vortexing for 3 sec
Place tube into heat block set at 100ºC for 2 minutes
Vortex for several seconds and Centrifuge for one or 2 sec just to bring down the condensation
Load, run, and stain the gel
 Place the loading guide on top the gel
 Using a pipetman and a small tip load 25 µl of each sample into the well starting with the second well
( maximum sample volume is 44 µl)
 Load Mw markers (Broad range) in the first and last well
 Connect the leads and Run at 180 Volts for 30 to 45 minutes
 When the blue dye reaches the bottom shut down the power supply
 Wear gloves
 Remove the chamber from the tank and empty out the buffer into the sink
 Open the clamps and take out the plates.
 Take the plates apart by gently prying them open.
 transfer the gel into a plastic container with lid
 Add Coomassie Blue staining solution
 Set on a shaker for 1 hour
 RINSE all parts of the electrophoresis apparatus with distilled water and set aside to dry.
 WASH plate and store dry
 Transfer the gel into a different plastic container and add enough destaining solution ( in this case
distilled water) just to cover the gel. Add a crumpled kimwipe, close the lid and place on a platform
shaker
IAP 2007 Biology 7.391
36
DAY 9
(#14 continued)


Transfer the gel into a new plastic container containing distilled water.
Record the results
Take a photograph
Measure the distance of each band from the top of the gel
Determine the Mw of each band based on the Mw standard curve
Estimate the size of the gene for each protein
Dry the gel:
You can dry the protein gel between two sheets and cellophane and keep the gel for a long time.
Material:
Plexiglas sheet and a Plexiglas frame.
Clamps
5 % glycerol
Cellophane sheets





Place the Plexiglas sheet flat on the bench.
Wet the cellophane in 5 % glycerol and lay down on the Plexiglas. Make sure that there are NO
bubbles between the cellophane and the Plexiglas.
Lay down the SDS gel on top of the cellophane (no bubbles)
Wet another cellophane in 5% glycerol and lay down on top of gel. Get rid of the bubbles. You can
roll a pipette on top of the cellophane to chase away the bubbles.
Lay the Plexiglas frame on top of the 2 nd cellophane and clamp the two Plexiglas together with
black clamps. Set up the system to stand on the clamps overnight. The gel should be dry the next day.
IAP 2007 Biology 7.391
37
DAY 10
Cleanup!
Data analysis and summary
Electron Microscopy
IAP 2007 Biology 7.391
38
Appendix 1: Basic microbiological techniques
Starting up E. coli cultures
1. Streak for single colonies.
(This has been done for you several days in advance, and can be done up to 2 weeks in advance, depending on how colonies
survive on LB plate.)
It is important to start a liquid culture from a single colony growing on an agar plate to insure that the population of
cells is genetically homogenous. Therefore it is important to know how to obtain a single colony.
Retrieve a permanent agar stab from your strain collection and prepare the work area by wiping the lab bench
surface with ethanol. Set up a Bunsen burner. Label the back of a fresh LB agar plate with the name of the strain and the
date. Using a sterile toothpick or a sterilized loop, transfer a glob of agar with bacteria from the stab onto the labeled LBagar plate. Immediately close the stab and wrap it in parafilm to prevent contamination and drying out. (At your school,
access to the permanent stabs should be limited to teachers that are familiar with sterile techniques, and every precaution
should be taken to avoid contamination of the permanent stabs)
Spread the glob onto one side of the plate by going back and forth with quick light strokes (see diagram below).
Using a new toothpick, turn the plate 90 º and streak across the lines. Turn the plate again and repeat the streaking with a
new sterile toothpick. Incubate the plate overnight at 37º C. The second or third set of streaks should produce single
colonies that have risen from single cells. Wrap the plate in parafilm and store it in the refrigerator (4 ºC). You can use
colonies from the plate to inoculate liquid cultures for up to 2 weeks, depending on the strain.
STREAKING FOR SINGLE COLONIES
First streak
second streak
Third Streak
2. Start an overnight liquid culture.
Pick out an isolated homogeneous colony from the plate using a long sterile wooden stick or sterile loop and
inoculate 2 to 3 ml of liquid LB in a sterile 15 ml capped glass tube. Incubate overnight at 37 ºC in a shaking water bath.
The culture should reach the late log phase-stationary phase in 8 to 10 hours.
3. Set up exponentially growing liquid culture
It is important to work with exponentially growing cells because they are actively dividing and are a homogenous
and metabolically active population. To start a bacterial culture, inoculate a flask containing 20 ml of pre-warmed (37° C)
liquid LB with 200 µl of the fresh overnight (a 1:100 dilution). Incubate the flask at 37ºC with vigorous shaking, checking
the OD600 of the culture one hour after inoculation and every 30 minutes thereafter. The culture should reach the mid
exponential growth phase in 3 to 4 hours (OD550 between 0.8 and 1).
Putative bacterial host strain can be isolated by inoculating a water sample taken on solid casein-peptone-starch
medium (CPS medium) or LB medium. And incubated at 25 ad 37 ºC.
IAP 2007 Biology 7.391
39
Appendix 2: Useful stuff
Material Safety Data Sheets (MSDS):
http://msds.ehs.cornell.edu/msdssrch.asp
MIT Environmental Health and Safety
http://web.mit.edu/environment/ehs/about_ehs.html
National Center for Biotechnology Information (NCBI):
http://www.ncbi.nlm.nih.gov
New England Biolabs:
http://www.neb.com
Beckman rotor calculator and run-time converter for ultracentrifugation (java scripts):
http://beckman.com/resourcecenter/labresources/centrifuges/rotorcalc.asp
http://www.beckman.com/resourcecenter/labresources/centrifuges/runtimecon.asp
Novagen, makers of the pET vectors:
http://www.novagen.com
The Protein Databank:
http://www.pdb.org
Current Protocols- online pdf files of just about any protocol! Accessed through MIT Libraries:
http://www3.interscience.wiley.com/browse/?type=CURRENT_PROTOCOL
Bacteriophage Ecology Group
http://www.mansfield.ohio-state.edu/~sabedon/bgnws021.htm
Electron microscopy of viruses
http://www.mwrn.com/microscopy/electron/virology.aspx
Phage Therapy- Stalin's forgotten Cure
www.intralytix.com/sciencemag.htm
Extremely useful books and resources:
Current Protocols in Molecular Biology (aka The Red Books) Ausubel et al. editors
Guide to Molecular Cloning, Sambrook et al. (aka Maniatis)
The Merk Index (good for MW and other properties of compounds)
Sigma-Aldrich catalog (also good for MWs)
The New England Biolabs (the appendices have a wealth of useful info)
CRC Handbook of Chemistry and Physics
Salmonella and E. coli, Neidhardt ed. (aka The Bible)
IAP 2007 Biology 7.391
40
Appendix 3: Lists of materials
At each bench:
 Heat block with holes large enough to hold small glass test tubes
 Bunsen burner and lighter
 Scissors and Parafilm ( to seal of agar plates)
 Gloves
 Ice bucket
 Disposable BioRad columns and tubing
 One stand with clamp
 Microcentrifuge
 Sterile Pasteur pipettes (to pluck out plaques, to spool DNA) and small bulb
 Long sterile wood picks ( to inoculate LB with bacteria, to streak for single colonies)
 20, 200 µl and 1000 µl pipetmans
 Bulb or automatic pipetter
 Sterile Tips of P20, P200 and P1000
 Labeling tape (color coded)
 Marker (color coded)
 Kimwipes
 EtOH in squirt bottle
 Waste bins for solid waste ( tips), NO SHARPS
 1.5 ml and 500 µl eppendorfs
 PCR tubes
 Sterile glass pipettes ( 5 ml and 10 ml)
 Plastic Bins for used glass pippettes
 One full Rack of small sterile glass test tubes (for titering and serila dilution)
 One rack of small sterile glass test tubes
 Empty tube racks
 One gel box for DNA agarose gel
At the back of the room: Common equipment
 Spectophotometer and Disposable cuvettes
 Film to take gel pictures, UV box and hand held camera
 Sterile 250 ml and 1 liter flasks
 Platfrom shake PCR machine
Chemical Hood:
 For EtBr waste (solide waste)
 Phenol/Chrolorform liquid waste
 Acrylamide solid waste
Reagents:
100 ml sterile liquid LB
Sterile distilled water
Top agar
LB plates
Phage buffer
IAP 2007 Biology 7.391
41
Phage elution buffer
IAP 2007 Biology 7.391
42
TAE for agarose gel
10X DNA sample buffer
SDS running buffer
3X SDS sample buffer
PEG 8000, NaCl
Phenol-chloroform isoamylalcohol (25:24:1)
3 M Na Aceteate pH 5.2
PCR mix
For 12 students ( 4 groups of 3)
Microcentrifuges (at least 2)
Vortexer ( 4)
Regrigerator
Freezer
Pipetmans for 1 ml, 200 µl and 20 µl ( 12 of each)
Sterile Tips
Beakers (4 liters and 1 liters)
Flasks
Erlenmeyers to grow bacterial cultures
Stands for column chromatography ( 4)
Kimwipes (4)
Sterile Glass pipettes in canisters
Automatic Pipeters and bulbs
Platform Shaker and roller drums to use in the 37ªC room
PCR machine ( 1 or 2)
Power supplies and lids
Boxes and trays for agarose gel electrophoresis
Stands for column chromatography
Heat blocks for small glass tubes (melted top agar)
Heat blocks for eppendorfs
Thermometers
Small sterile capped 13 mm glass tubes in racks ( for serial dilutions)
Large sterile capped 18 mm glass tubes in racks( for overnight cultures)
Microwave to melt top agar, agarose and LB-agar)
Balance to weigh gram quantities
Parafilm
Scissors
Tape, timers,
Sterile ddwater
Sterile long wood picks in beakers
Funnels
Graduate cylinders
Ice buckets
Magnetic stir plates (4) and stir bars (4 large)
IAP 2007 Biology 7.391
43
Appendix 4: Uranyl acetate solution for negative stain TEM
Uranyl acetate (UA) solution is used to stain the specimen spotted onto the copper grids. Generally,
either a 1% or a 2% UA solution is used for staining1. The solution should be made fresh from solid uranyl
acetate every two to three weeks and stored at room temperature, in the dark to avoid precipitation. Uranyl
acetate crystallizes when exposed to light and also when left standing for long periods of time. Do not use
the solution if you observe precipitation. UA solution also requires overnight agitation to fully dissolve.
For 10 mL of a 1% uranyl acetate solution:
1. Mass out 0.1g solid uranyl acetate
2. Weigh out solid UA in the weigh room and pour solid UA into a fresh 15 mL conical tube
3. Fill tube containing the UA up to 10 mL mark with distilled water
4. Label tube with name, date and contents
5. Cover tube and cap with aluminum foil to keep out light
6. Agitate tube gently overnight on rocker
7. Store UA solution at room temperature with minimal light exposure
IAP 2007 Biology 7.391
44
Appendix 5: Recipees
5 M NaCl:
(Mw= 58.44)
292.2 g/l
1 M Tris HCl buffer (pH 7.5, etc..)
121.1 g/l of Tris base.
Add HCl to pH
1 M MgCl2:
203 g/l
3 M NaAcetate pH 5.2:
24. 6 g in 100 ml
10X TAE:
48.4 g Tris Base
11.42 ml Acetic Acid
20 ml 0.5 M EDTA
pH to 8.5
5X SDS Running Buffer:
15.1 g Tris Base
72 g Glyicne
5 g SDS
add water to 1 liter
Filter
(Resolution) lower gel buffer:
187 g Tris base pH to 8.8 with HCl
4 g SDS
Add water to 1 liter
Filter
Upper (stacking) gel buffer:
60.5 g Tris Base pH 6.8 with HCl
4 g SDS
Add water to 1 liter
Filter
3X SDS protein sample buffer
18.8 ml Tris pH 6.8
6 g SDS
15 ml -mercaptoethanol
30 ml glycerol
add water to 100 ml
IAP 2007 Biology 7.391
45
10 X DNA sample buffer
2 g of Ficol 400
2 ml of 0.5M EDTA pH 8.0
0.1 g SDS
0.25 % Bromophenol Blue
0.25% Xylene Cyanol
Add water to 10 ml
Phage Column wash buffer
10 ml Tris HCl pH 7.5
5 mM Mg Cl2
25 mM NaCl
Phage column elution buffer
10 mM Tris HCl pH 7.5
5 mM MgCl2
0.5 M NaCl
IAP 2007 Biology 7.391
(40 ml of 1 M stock)
(20 ml of 1 M stock)
(20 ml of 5 M stock)
Water to 4 liters
(10 ml of 1 M stock)
(5 ml of 1 M stock)
(100 ml of 5 M stock)
Water to 1 liter
46
APPENDIX 6:
Vector maps and info
pFLAG: a C-terminal epitope-tagging expression vector (under control of Ptac)
IAP 2007 Biology 7.391
47
pET15b: an N-terminal his-tagging expression vector
IAP 2007 Biology 7.391
48
pET21b: a C-terminal his-tagging expression vector
IAP 2007 Biology 7.391
49
Appendix 7: Estimation of DNA concentration, yield, and purity
DNA concentration can be estimated by adjusting the A260 measurement for turbidity (measured by
absorbance at A320), multiplying by the dilution factor, and using the relationship that an A260 of 1.0 =
50µg/ml pure DNA.
Concentration (µg/ml) = (A260 reading – A320 reading) × dilution factor × 50µg/ml
Total yield is obtained by multiplying the DNA concentration by the final total purified sample volume.
DNA Yield (µg) = DNA Concentration × Total Sample Volume (ml)
A260/A280 ratio can be used as an estimate of DNA purity [with a number of important limitations (Wilfinger,
Mackey and Chanczynski, 1997; Glasel, 1997; Manchester, 1995)]. An A260/A280 ratio between 1.7 and 2.0 is
generally accepted as representative of a high-quality DNA sample. The ratio can be calculated after
subtracting the non-nucleic acid absorbance at A320.
DNA Purity (A260/A280) = (A260 reading – A320 reading) ÷ (A280 reading – A320 reading)
Note that the spectrophotometer is most accurate when measurements are between 0.1–1.0.
IAP 2007 Biology 7.391
50
Appendix 8: Oligonucleotides for PCR cloning
Gene/Primer
E15_stermF
E15_stermR
E15_ltermF
E15_ltermR
E15_4F
E15_4R
E15_15F
E15_15R
E15_16F
E15_16R
E15_17F
E15_17R
lacZF
lacZR
Syn5_53F
Syn5_53R
Syn5_54F
Syn5_54R
Syn5_58F
Syn5_58R
Syn9_41F
Syn9_41R
Syn9_42F
Syn9_42R
Vector
pFLAG
pFLAG
pFLAG
pFLAG
pFLAG
pFLAG
pFLAG
pFLAG
pFLAG
pFLAG
pFLAG
pFLAG
pFLAG
pFLAG
pET21b
pET21b
pET21b
pET21b
pET21b
pET21b
pET15b
pET15b
pET15b
pET15b
Ins Fwd RS
NdeI (4)
Ins Rev RS
Vect Fwd RS
NdeI (4)
XmaI (4)
NdeI (4)
Vect Rev RS
XmaI (4)
NdeI (4)
XmaI (4)
NdeI (4)
XmaI (4)
NdeI (4)
XmaI (4)
AseI (3)
XmaI (4)
NdeI (2)
SalI (3)
NdeI (4)
XhoI (2)
NdeI (4)
XmaI (4)
AseI (3)
XmaI (4)
NdeI (2)
SalI (3)
AseI (3)
XhoI (2)
NdeI (4)
BspEI (3)
NdeI (4)
XmaI (4)
NdeI (4)
SacI (4)
NdeI (2)
SacI (4)
NdeI (2)
BamHI (2+S)
NdeI (2)
BamHI (2+S)
NdeI (2)
BamHI (2+S)
XhoI (2)
BamHI (2+S)
XhoI (2)
BamHI (2+S)
NdeI (2)
BamHI (2+S)
NdeI (2)
BamHI (2+S)
BamHI (2+S)
Primer Sequence
GACGATGCATATGCCAGCAGAACCAAAAGC
GTAGAGACCCGGGTCATTCTTCACCACCTGCC
GACGATGCATATGACAGCCGCAGCCATATCGACG
GTAGAGACCCGGGTTATTTCCACGGGTCATATTCTGTGACC
GACGATGCATATGGCGGAAACCGAAAAAGAGCGC
GTAGAGACCCGGGTCATTGCTGCGGTGCTCCTGC
GACGATGATTAATGCCAGTTGTACCTACAGTTAACG
GTAGAGAGTCGACTTATTCAACCCTCACGACAATAGC
GACGATGCATATGGCTGATGTATTTTCACTGGC
GTAGAGACCCGGGTTATGGATTCCTCAGGAAGCACG
GACGATGATTAATGAAACAGGCATGTGTTGAAGC
GTAGAGAGTCGACTCATTGTCCTACCGCCTTTCC
GACGATGATTAATGACCATGATTACGGATTCACTGG
GTAGAGATCCGGATTATTTTTGACACCAGACC
GACGATGCATATGGCTCTTATTGTTGATCC
TAAGCGGAGCTCGGGTTGGAGTAGTTACGC
GACGATGCATATGTCATTCAACATTAGTAATAACG
GTAGAGAGGATCCACGGGGTTGTTGTACTGTCG
GACGATGCATATGTCTGCTACTACTTCTAACG
GTAGAGAGGATCCGCGAGGGTGCGGACGATGAATGCAGC
GTCTAACTCGAGATTCTATTTGTATTGTCGG
GTAGAGAGGATCCTCAATTTTCATAATAGTCAGATCG
GACGATGCATATGAAAATTGAAAGTGTTGC
GTAGAGAGGATCCTTATTCAGCAGACCCATAGATTTCG