Supplementary Information
Structure of the S-adenosylmethionine riboswitch regulatory mRNA
element
Rebecca K. Montange and Robert T. Batey*
* author to whom correspondence should be addressed.
Address: Department of Chemistry and Biochemistry, 215 UCB, University of
Colorado, Boulder, 80309
Telephone: (303) 735-2159
FAX: (303) 492-5894
e-mail: robert.batey@colorado.edu
1
Methods.
RNA preparation.
A 94 nucleotide construct consisting of
the sequence for the SAM riboswitch from the metF-metH2
operon of T. tencongensis was constructed by PCR using
overlapping DNA oligonucleotides (Integrated DNA
Technologies)1.
The resulting fragment contained sites for
the restriction enzymes EcoRI and NgoMIV and was ligated
into plasmid vector pRAV12, which is designed for either
native or denaturing purification of RNA2.
sequence was verified by sequencing.
The cloned
Transcription
template was prepared by PCR using primers directed against
the T7 promoter (5’, GCGCGCGAATTCTAATACGACTCACTATAG, 3’)
and the HV ribozyme in the vector (5’,
GAGGTCCCATTCATTCGCCATGCCGAAGCATGTTG, 3’).
Because the HV
sequence in the vector is mutated to be active only in the
presence of imidazole, the primer used contained the
single-base correction required for wild-type activity.
RNA was transcribed in a 12.5 mL reaction containing 30 mM
Tris-HCl (pH 8.0), 10 mM DTT, 0.1 % Triton X-100, 0.1 mM
spermidine-HCl, 4 mM each NTP (Sigma and Research Products
Inc.), 24 mM MgCl2, 0.25 mg/mL T7 RNA polymerase, 1 mL of
~0.5 M template, and 0.32 unit/mL inorganic pyrophosphatase
2
(Sigma) to suppress formation of insoluble magnesium
pyrophosphate.
The transcription reaction was allowed to
proceed for two hours at 37o C, supplemented with an
additional 20 mM MgCl2 and incubated at 60o C for 15 minutes
to enhance cleavage of the HV ribozyme at the 3’ end of the
riboswitch construct.
RNA was then ethanol precipitated at
-20o C overnight and subsequently purified by denaturing
PAGE (12% polyacrylamide, 1X TBE, 8 M urea).
The band of
interest was visualized by UV shadowing, excised, and
electroeluted overnight in 1X TBE to extract the RNA from
the gel.
The eluted fraction was exchanged three times
into 10 mM Na-MES at pH 6.0 using a 10,000 MWCO centrifugal
filter and then refolded by heating to 95o C for three
minutes followed by snap cooling.
The refolded RNA was
exchanged once into 10 mM Na-MES pH 6.0, 2 mM MgCl2.
The
final yield was ~500 L of RNA at a concentration of 400 M
as judged by absorbance at 260 nm and the calculated
extinction coefficient.
Crystallization.
RNA was stored at -20o C.
SAM was added to the RNA stock
immediately before the RNA was set-up for crystallization
by directly pipetting the appropriate amount of 100 mM SAM
stock into the RNA solution.
the RNA was 5 mM.
Final concentration of SAM in
Bound RNA was crystallized by the
3
hanging drop vapor diffusion method.
RNA was mixed 1:1
with a solution consisting of 8 mM iridium hexaammine, 100
mM KCl, 5 mM MgCl2,, 10% MPD, 40 mM Na-cacodylate pH 7.0,
and 6 mM spermine-HCl.
The drop was seeded with seed-stock
grown in 27 mM spermine-HCl, 34 mM Na-cacodylate pH 7.0, 17
mM BaCl2, 8.5% MPD, and 34 mM KCl.
Crystals grew in a
diamond morphology to their maximum size (~ 0.3 mm on the
edge) in 48 hours at 30o C and were cryoprotected by soaking
the crystals for at least 5 minutes in 50 L of a solution
consisting of the mother-liquor plus 15% ethylene glycol.
Crystals were then flash-frozen in liquid nitrogen.
Data
was collected on beamline 8.2.1 at the Advanced Light
Source in Berkeley, CA using an inverse beam experiment at
two wavelengths.
using D*TREK3.
group (a =
Data was indexed, integrated, and scaled
The crystals belong to the P43212 space
62.90 Å, b = 62.90 Å, c = 158.97 Å,  =  =  =
90o) and have one molecule per asymmetric unit.
All data
used in phasing and refining came from one crystal.
Preparation of iridium hexaammine.
The iridium hexaammine
was prepared according to methods outlined in the
literature4, 5.
Two grams iridium chloride (IrCl3) (Aldrich)
and 35 mL ammonium hydroxide were added to a heavy-walled
ACE pressure tube (Aldrich)4.
The tube was then sealed and
4
incubated in a 150o C silicone oil bath for four days4, 5.
The reaction was then allowed to completely cool and
incubated on slushy ice.
The clear, light brown solution
was then filtered and evaporated to dryness under vacuum.
While evaporating, the solution was heated to 50o C using a
waterbath5.
The resulting solid was then resuspended in 5
mL of water and transferred to a 50 mL conical tube.
Two
mL of concentrated HCl was then added to the solution.
Precipitate was spun down in a centrifuge and the light
yellow supernatant was discarded.
Pellet was washed three
times with 10 mL of a 2:1 (v/v) water:conc. HCl solution by
vigorous vortexing followed by centrifugation.
was discarded after each wash.
Supernatant
Pellet was then washed
three times in absolute ethanol, air-dried and resuspended
in ~ 3 mL ddH2O4.
Solution was centrifuged one more time to
remove insoluble material.
The resulting supernatant
should show a clear absorbance maxima at 251 nm and
concentration can be calculated using the extinction
coefficient 92 M-1cm-1 at 251 nm5.
Typical yield is 50%.
Supernatant was then aliquoted into fresh Eppendorf tubes
and stored at -20o C.
Phasing and structure determination. Phases were determined
by multi-wavelength anomalous diffraction (MAD) using data
5
that extended to 2.8 Å.
The peak and inflection wavelength
datasets were merged and scaled in CNS6 and Patterson maps
were then calculated for both space groups P41212 and P43212.
From the maps it was determined that there were four
possible iridium sites within the unit cell, although most
if not all had less than full occupancy.
A CNS heavy-atom
search for four possible sites was then carried out in both
space groups, and both space groups yielded 94 possible
solutions.
The best of these were used to calculate
predicted Patterson maps, which showed peaks that
correlated very well with those seen in the original maps
in all four Harker sections.
The best solution sites were
used to calculate phases in CNS.
The resulting density map
for P41212 was uninterpretable, whereas the map for P43212
clearly showed features that were macromolecular, such as
RNA helix backbones and base-stacking.
The phasing
solution found by CNS had a figure of merit of 0.6332 which
was further improved to 0.8846 following a round of density
modification with the solvent level set to 0.46.
The
phasing power at the peak wavelength was 3.3 with a Rcullis
of 0.39 (acentric).
The model was built in O7 and refined in CNS6 in iterative
rounds.
The RNA nucleotides were placed in the first
6
round, the iridium hexaammines were placed in the second
round, and then in the third round two magnesium ions were
placed based on their position in the density with respect
to the sugar-phosphate backbone of the RNA.
were in place the SAM was built.
Once the ions
Structure, parameter, and
topology files for iridium hexaammine and SAM were
downloaded from HIC-Up (Hetero-compound Information Centre
– Uppsala)8; the parameters for Mg2+ ions were already
loaded into CNS.
The compact conformation of the SAM
molecule was chosen to fit the density seen in the binding
pocket, and in order to get the model molecule to fit the
density the energy parameters in the SAM parameter file
downloaded from HIC-Up had to be changed.
This was
followed by one round of water-picking carried out by CNS.
Waters were chosen based on peak size in an anomalous
difference map.
The minimum was set to 2.5 with the
additional parameters that the B-factor could be no greater
than 200, and the peak must be within hydrogen bonding
distance of the oxygens and nitrogens in the RNA.
Each
round of model-building was followed by a simulated
annealing run and B-factor refinement using CNS.
Rfree was
monitored in each round to ensure that it was dropping.
Sugar puckers were restrained in most cases to C3’ endo,
except for residues A9, A14, A33, A51, U63, and G74 which
7
were restrained to C2’ endo.
Figures were prepared using
Ribbons 3.09 and Pymol10.
8
Supplementary Table 1: Data collection, phasing and refinement statistics
Crystal 1
Ir-hexaammine
Data collection
Space group
Cell dimensions
a, b, c (Å)
 (º)
Wavelength
Resolution (Å)
Rsym or Rmerge
I/I
Completeness (%)
Redundancy
P43212 (96)
Peak
1.10532 Å
50 - 2.8 (2.9 -2.8)*
7.2% (42.6%)
17.9 (4.4)
99.6 (99.9)
14.6 (11.7)
62.90, 62.90, 158.97
90, 90, 90
Inflection
1.10573 Å
50 -2.8 (2.9 -2.8)
7.3% (44.6%)
18.2 (4.3)
99.4 (100)
14.7 (11.9)
Refinement
Resolution (Å)
50 - 2.9 (3.0 - 2.9)
No. reflections
13415 (99.3%)
Rwork/ Rfree
26.6/28.9
No. atoms
2174
RNA
2029
Ligand/ion
27/30
Water
88
B-factors
69.6
RNA
69.3
Ligand/ion
59.2/79.4
Water
79.3
R.m.s deviations
Bond lengths (Å)
0.009592
Bond angles (º)
1.64
Data was collected from a single crystal.
*Highest resolution shell is shown in parenthesis.
9
Supplementary Figure 1: Secondary structure and switching by the T.
tengcogensis metFH2 SAM-I riboswitch. In the presence of SAM, the 5’-end of
the metFH2 mRNA adopts a secondary structure comprising four helices (P1-4)
surrounding a four-way junction (J1/2, J3/4 and J4/1) (left). Nucleotides >95%
conserved across phylogeny are highlighted in magenta and those >80%
conserved are in cyan. In the presence of SAM, the four-way junction structure
is stable, forcing the mRNA to form a terminator element immediately
downstream. In the absence of SAM, the 3’-side of the P1 helix is used to form
an antiterminatior element (AT), allowing for the mRNA to be fully transcribed
and the genes to be expressed (right).
10
Supplementary Figure 2: P1 helix in the experimental
electron density map. The orange represents density at 1;
the red represents density at 5. Clearly interpretable
density representing both the sugar-phosphate backbone and
the bases is observed. A well-ordered iridium hexaammine
ion is in the foreground docked into the major groove, and
in the background, the SAM molecule can be seen in contact
with the minor groove.
11
Supplementary Figure 3: (a) Top and (b) side views of the
stacking interactions within SAM and with the RNA. The
double arrow between the methionine main chain amino group
and the adenine ring denote a pi-cation interaction.
12
Supplementary Figure 4: Stereo views of a comparison of
various bound forms of SAM and SAH by superimposing the
adenine moiety of each, viewed from the side (top) and the
top (bottom). The carbon atoms colored to denote the RNAbound form (salmon), metJ bound (green), and
methyltransferase bound (slate blue). The letters
correspond to ligand from the following structures (PDB ID
is in parentheses): a, SAM riboswitch SAM; b, MetJ
repressor SAM, (1CMA)11, c, SpoU methyltransferase SAH
(1MXI)12; d, Biotin synthase SAM (1R30)13; e, Oxygenindependent coproporphyrinogen III oxidase SAM (1OLT)14; f,
FtsJ RNA methyltransferase SAM (1EJ0) 15; g, Mycolic acid
cyclopropane synthase CmaA2 SAH (1KPI)16; h, Human histone
methyltransferase Set7/9 SAM (1O9S)17; i, 5'-fluoro-5'-
13
deoxyadenosine synthase SAM (1RQP)18.
14
Supplementary Figure 5: Surface representation of the SAM-I RNA:SAM
complex from a (a) front and (b) back perspective. The colors for each of the
segments (P1/P4, blue; J1/2, orange, P2/P3, green; J3/4, magenta) and SAM
(salmon) is consistent with that of Figure 1.
15
References.
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
Sambrook, J. & Russel, D. W. Molecular Cloning: A
laboratory manual (Cold Spring Harbor Laboratory
Press, Cold Spring Harbor, New York, 2001).
Kieft, J. S. & Batey, R. T. A general method for rapid
and nondenaturing purification of RNAs. RNA 10, 988995 (2004).
Pflugrath, J. W. The finer things in X-ray diffraction
data collection. Acta Crystallogr D Biol Crystallogr
55, 1718-1725 (1999).
Cruse, W. S., P.; Neuman, A.; and Prangé, T. Destabilizing effect of a
fluorouracil extra base in a hybrid RNA dplex compared with bromo and
chloro analogues. Acta Crystallogr D Biol Crystallogr 57, 1595-1608
(2001).
Galsbøl, F. H., S.K.; and Simonsen, K. The Preparation, Separation and
Characterization of some Ammine Complexes or Iridium(III). Acta Chem
Scand 44, 796-801 (1990).
Brunger, A. T. et al. Crystallography & NMR system: A
new software suite for macromolecular structure
determination. Acta Crystallogr D Biol Crystallogr 54,
905-921 (1998).
Jones, T. A., Zou, J. Y., Cowan, S. W. & Kjeldgaard.
Improved methods for building protein models in
electron density maps and the location of errors in
these models. Acta Crystallogr A 47, 110-119 (1991).
Kleywegt, G. J. a. J., T.A. Databases in protein crystallography. Acta
Cryst D54, 1119-1131 (CCP1114 Proceedings) (1998).
Carson, M. Ribbons. Methods Enzymol 277, 493-505
(1997).
Delano, W. L. (DeLano Scientific, San Carlo, CA, USA, 2002).
Somers, W. S. P., E.V. Crystal structure of the Met repressor-operator
complex at 2.8 angstroms resolution reveals DNA recognition by betastrands. Nature 359, 387-393 (1992).
Lim, K. Z., H.; Tempczyk, A.; Bonander, N.; Toedt, J.; Howard, A.;
Eisenstein, E.; and Herzberg, O. Structure of YibK from Haemophilus
Influenzae (HI0766): A methyltransferase with a cofactor bound at a site
formed by a knot. Proteins 51, 56-67 (2003).
Berkovitch, F. N., Y.; Wan, J.T.; Jarrett, J.T.; and Drennan, C.L. The
crystal strucutre of biotin synthase, an S-adenosylmethionine-dependent
radical enzyme. Science 303, 76-79 (2004).
Layer, G. M., J.; Heinz, D.W.; Jahn,D.; and Schubert, W.-D. Crystal
structure of coproporphyrinogen III oxidase reveals cofactor geometry of
radical SAM enzymes. EMBO J 22, 6214-6224 (2003).
16
15.
16.
17.
18.
Bugl, H. F., E.B.; Staker, B.L.; Zheng, F.; Kushner, S.R.; Saper, M.A.;
Bardwell, J.C.A.; Jakob, U. RNA methylation under heat shock control.
Mol Cell 6, 349-360 (2000).
Huang, C.-C. S., C.V.; Jacobs Jr., W.R.; Glickman, M.S.; and
Sacchettini,J.C. Crystal structures of mycolic acid cyclopropane snthases
from mycobacterium tuberculosis. J Biol Chem 277, 11559-11569
(2002).
Xiao, B. J., C.; Wilson, J.R.; Walker, P.A.; Vasisht, N.; Kelly, G.; Howell,
S.; Taylor, I.A.; Blackburn, G.M.; and Gamblin, S.J. Structure and
catalytic mechanism of human histone methyltransferase SET7/9. Nature
421, 652-656 (2003).
Dong, C. D., H.; Dorward, M.; Schaffrath, C.; O'Hagan, D.; and Naismith,
J.H. Crystal structure and mechanism of a bacterial fluorinating enzyme.
Nature 427, 561-565 (2004).
17