Edwards:SIR2
1
SIR2 Saccharomyces cerevisiae in Tetrahymena thermophila: The Mystery of Aging
Emily Edwards
Katelyn Carter
December 2, 2008
BMS 110 Fall 2008
Abstract
For these experiments, the SIR2 gene is focused on because of its implications on aging
and lifespan. By the suppression of the formation of ERCs, part of the aging process, and the
production of enzymes, which limit lifespan, that play a role in cell death, the possibility of a
longer and “younger” life could become a reality due to further research on this gene. SIR2
research has been found to have dramatic results in yeast and has some possible mammalian
applications (Kaeberlein et al 1999). After under going isolation, quantification, and PCR, the
SIR2 gene will be encoded in E. coli to be stored for use in further studies on the gene. It is
hoped that these further studies will uncover valuable data for innovative applications to extend
lifespan and slow the aging process.
Introduction
In these experiments, the SIR2 gene is focused on due to its connections with aging and
longevity. After a lot of research in direct affects on yeast, there are believed to be some
mammalian applications in the possibility of extending lifespan and slowing aging (Kaeberlein et
al 1999). The role of SIR2 in extending life span involves preventing recombination at the
replication forks in the rDNA which suppresses the formation of extrachromosomal rDNA
circles (ERCs) and other enzymes that aid in cell death (Kaeberlein et al 1999 and Li et al 2006).
When overactive, SIR2 dramatically extended the lifespan of yeast, by as much as 30% in some
instances. In aging, Sir2p acts as a limiting component, so when increased, the aging process
Edwards:SIR2
2
slowed dramatically (Kaeberlein et al 1999 and Lin et al 2000). This obviously has many
innovative possibilities and applications. The implications of longer life and more youthful
living are very exciting, motivating, and mind-boggling to young scientists such as ourselves!
First, SIR2 will be isolated, quantified, and put through PCR. The SIR2 gene will then be cloned
into E. coli, so that those E. coli colonies can be stored for use by other scientists for future
studies on SIR2. The success of this experiment we hope will lead to future studies because this
research could affect everyone and how we live.
Materials and Methods
Bioinformatics
The amino acid sequence for the SIR2 protein in Saccharomyces cerevisiae was found
through the use of the NCBI database (http://www.ncbi.nlm.nih.gov/). Next, databases were
searched to see if there was a Tetrahymena homolog or not, for SIR2. One was confirmed
through the use of the Tetrahymena Genome Database (http://www.ciliate.org/). Continuing to
use the Tetrahymena Genome Database, the protein sequence of the Tetrahymena homolog was
obtained. Then, the nucleotide sequence of the SIR2 homolog was determined as well as with
the Expressed Sequence Tags underlined. Next, it was determined that the gene’s start and stop
introns were not encompassed by the ESTs, and therefore, the gene had been predicted correctly.
For further details see Lab 3: Bioinformatics: Molecular Computational Tools (Smith 2008).
Tetrahymena Genomic DNA Isolation
The Tetrahymena genomic DNA was isolated to use as a template for further
applications, such as PCR. During the isolation procedure, 1.4 mL of a Tetrahymena culture was
placed into a microcentrifuge tube. The tube was placed into a microcentrifuge for 1 minute at
10,000 rpm so that the cells could be collected, and then the supernatant was quickly poured off
Edwards:SIR2
3
and the tube given a quick shake to get off residual media. The tube was then flicked to loosen
the pellet of cells from the bottom, and 700 μL of Urea Lysis buffer were added and thoroughly
mixed in the tube. Then phenol extraction was done by adding 600 μL of a phenol:chloroform
(1:1) mixture in the hood, thoroughly mixing the tube, centrifuging the tube for 5 minutes at
maximum speed in a microcentrifuge, and then transferring the top layer in the tube into a new
microcentrifuge tube. The phenol extraction was repeated again. Next, 150 μL of 5M NaCl was
added to the extracted lysate. 700 μL of isopropyl alcohol was added to the lysate to precipitate
the DNA; the tube was inverted about 10 times and was allowed to rest for 10 minutes at room
temperature. The precipitate was then collected by centrifuging the mixture at maximum speed
for 10 minutes, and the supernant was decanted. 500 μL of 70% ethanol were added, and the
tube was flicked to loosen the pellet from the bottom. The precipitate was then collected by
centrifuging for 3 minutes, and the supernant was discarded by removal by micropipette. The
pellet was allowed to air dry, 50 μL of Tris-EDTA (TE) buffer and 1 μL of RNase A (10 mg/mL
stock) were added, and was incubated at 37˚C for 10 minutes.
Solutions
Lysis Buffer: 0.35 M NaCl, 0.01 M Tris pH 7.4, 0.01 M EDTA, 1% SDS, 42% urea
TE (pH 8): 10 mM Tris-Cl (pH 8), 1 mM Na2 EDTA
RNase A stock solution: 10 mg/mL in 50mM potassium acetate (pH 5.5)
See LAB Exercise 4: Tetrahymena Genomic DNA Isolation for more information (Smith 2008).
Quantification of Genomic DNA
Two dilutions of DNA, 1:100 and 1:200, were prepared in microcentrifuge tubes
and were then placed into a spectrophotometer, as the UV source, for 15 minutes using the
nucleic acid quantitation program. The Absorbance readings at 260nm and 280 nm were
Edwards:SIR2
recorded for both dilutions. See LAB Exercise 4: Tetrahymena Genomic DNA Isolation for
further details (Smith 2008).
Polymerase Chain Reaction (PCR)
PCR was used to copy SIR2 from our DNA to a large amount in a short amount of time. The
following substances were used and added for PCR:
Reaction #
Primer Annealing Temperature
Temperature
Used
1 genomic template
56.45˚C
56.2˚C
2 genomic template
60.6˚C
60.0˚C
3 genomic template
52.3˚C
52.1˚C
4 genomic template
50.0˚C
50.0˚C
5 genomic template
52.3˚C
52.1˚C
Final Concentration
1.0 μL total genomic DNA
Stock Concentration Master Mix
0.3 μL
3.32 mg/μL
9 μL
0.5 μM TF
1.25 μL
20 μL
3.75 μL
0.5 μM TR
1.25 μL
20 μL
3.75 μL
1 unit (U) Phusion polymerase
0.5 μL
2 U/μL
1.5 μL
1X HF or GC buffer (1.5 mM MgCl2)
10 μL
5X concentrated
30 μL
1 μL
10mM
3 μL
0.2 mM dNTPs
sterile distilled water
FINAL VOLUME:
33 μL
99 μL
50 μL
150 μL
PRIMERS
THD15-TF (36-MER; TM=58°C)
5’-CAC CCT CGA GCA TTT AAA AAC ACT CTT CAA ATC ATT-3’
THD15-TR (35-MER; TM=62°C)
5’-CCT AGG TCA ATT TAT GTA ATC AAT AAT TTA TTT AG-3’
The oligonucleotide primers were designed using the compiled Bioinformatics data and
the genomic DNA as a template. Before the primers were added to the master mix, they were
resuspended in ddH2O with a final concentration of 200μM, made with 20μM concentrated
4
Edwards:SIR2
5
stock, and vortexed. The reactions were kept on ice until placed in the thermocycler to undergo
denaturation, annealing, extension, and cycling of the reaction. For the complete protocol see
LAB Exercise 5: Polymerase Chain Reaction (PCR) (Smith 2008).
Agarose Gel Electrophoresis
A 1% agarose gel mixture, consisting of 0.5g of agarose and 50 mL of 1X TAE, was
microwaved until the agarose was dissolved, allowed to cool slightly, then 0.5 μL of 10 mg/mL
of ethidium bromide were added, and, lastly, poured into a gel apparatus and allowed to setup
(done by Dr. Smith). The casting tray was removed, the comb was removed, and the
electrophoresis chamber was filled with 1X TAE until the wells were just covered.
5 μL of 1kb ladder and 1 μL of dye, xylene cyanol-blue and bromphenol blue-purple,
were loaded in the first well/lane. A mixture of 1 μL of dye and 10 μL of each of our five
samples from PCR, individually, were loaded into the next five wells/lanes. The apparatus was
then connect to the power source and ran at 90 volts for about 1 hour, so that the dyes migrated
through the gel would run ¾ way and the results of the experiment could be viewed. The gel
was then removed from the apparatus and photographed using a UV light box and camera. For
more information see Lab Exercise 6: Agarose Gel Electrophoresis (Smith 2008).
TOPO Cloning and E. coli Transformation
The following components were combined to carry out the TOPO cloning for a total
volume of 6L: 1L of PCR product, 1L of salt solution, 3L of sterile water, and 1L of the
TOPO vector. The reaction was then mixed gently by pipetting up and down. The solution was
then incubated for 10 minutes at room temperature, approximately 22-23˚C.
The lab instructor then provided a vial of chemically competent E. coli, so that the E. coli
transformation could be performed. Ask your lab instructor for a vial of chemically competent E.
Edwards:SIR2
6
coli. The cells were thawed on ice for about 5 minutes. Then, 2 μL of the TOPO cloning
reaction were added into the vial of E. coli and mixed gently by stirring the solution with the tip
of the micropipette. The solution was incubated on ice for 10 minutes, before being heatshocked for 30 seconds at 42˚C carefully without being shaken. The solution was then
immediately put on ice. Next, 250μL of room temperature SOC medium were added. The tube
of solution was then shaken horizontally in a shaking incubator at 200 rpm at 37˚C for 1 hour.
Lastly, 200μL of the solution were spread, with sterile glass beads, on a pre-warmed plate
containing 50μg/mL kanamycin and then allowed to incubate overnight in an incubator at 37ºC.
The same was done with the approximately 50μL that was extra solution left over after the
200μL were used. See Lab Exercise 7c: TOPO Cloning and E. coli Transformation for further
information (Smith 2008).
Construction of Plasmid Map and Restriction Enzyme Digestion Design
To be able to visually locate restriction enzymes needed for a later part of the project, we
created maps of our plasmid using Gene Construction Kit 3.0 computer program. We were also
able to see how the ends of the DNA fit together to make our plasmid. Using a computerized
plasmid mapping system allows scientists to exchange this information quickly, and it can be
easily stored. Also, using the program, we were able to input restriction enzymes, that we could
purchase, to show up so that the largest section of the part of our gene that we needed was
enclosed by it. The restriction enzyme that we selected was NheI.
Plasmid Purification and Restriction Enzyme Digest
To determine if the colonies that grew on our plate contains the plasmid containing our
PCR product, we had to isolate the plasmid and confirm that it was the correct plasmid. To do
this, we started off by growing the bacteria. 6 ml of the lysis buffer (LB) were added with
Edwards:SIR2
7
50µg/ml of kanamycin (KAN) in a glass test tube for each colony, and we each had 3 colonies
for a total of 6 tubes. This section (growing the bacteria) was done by the instructor. Next, a
grid was made on a new LB/KAN plate with six regions. A 6-inch, sterile wooden stick was
used to pick whole colonies from our cloning transformation plate, and each was touched to a
corresponding region on the grid, with a total of six colonies used. Then, the remaining material
on the stick was mixed in LB/KAN liquid in a test tube, and the stick was placed in a container
to be sterilized and reused. The test tubes were placed in a 37°C shaking incubator at 200 rpm
and grown overnight.
The second phase is the purification of the plasmid, beginning with getting three 1.5-mL
tubes for each of the 6 cultures. 5mL of each culture were pipetted into each of the
corresponding new tubes, leaving about 1mL in the culture tube, which was saved to freeze
down the bacterial strain of positive transformants. The each of the six sets of three tubes was
centrifuged at maximum speed for 3 minutes. The resulting supernatant was poured off into a
waste beaker. 250μL of the P1 buffer were added to one of each set of the three tubes. The
pellet in each of those tubes was then resuspended by pipetting up and down slowly, and that
solution was then transferred into the second tube in each set of three and resuspended by
pipetting. Then, that was transferred to the third tube and resuspended by pipetting. 250μL of
the P2 buffer were added, and then the tubes were inverted. The solutions then turned blue. The
tubes were continuously inverted, for about 1-2 minutes, until the entire solution was blue and
there was no precipitate present. Then 350μL of the N3 buffer were added, and the tubes were
inverted until the solution had turned completely clear, with no traces of blue left. The samples
were then centrifuged at maximum speed for 10 minutes. The resulting supernatant was then
poured into QIAprep spin columns, which were then centrifuged at maximum speed for 1
Edwards:SIR2
8
minutes, and the flow-through was discarded. Next, 500μL of the PB buffer were added to the
columns, centrifuged for 1 minute at maximum speed, and the flow-through was discarded.
750μL of the PE buffer were then added to the columns, centrifuged for 1 minute at maximum
speed, and the flow-through was discarded. The columns were then centrifuged an additional
minute to remove the residual buffer. The columns were placed into new 1.5mL tubes, and the
plasmid DNA was eluted by adding 50μL of the Elution Buffer. The solutions were let stand for
2 minutes and then centrifuged at maximum speed for 1 minute. The columns were then
discarded. The tubes were then labeled properly, placed on ice, and stored at -20°C. The tubes
were ready to be used to screen for our PCR product using the previously selected restriction
enzyme, NheI.
The third phase was the confirmation of the correct plasmid with the PCR product
insertion by restriction enzyme digestion. With help from the instructor and a handout from the
company through which the restriction enzyme was purchased containing information about the
corresponding restriction buffer to use with our enzyme, we determined the appropriate
restriction buffers, 10X NE Buffer 2 and 100XBSA, to be used in the digest. The following were
combined to make a cocktail for each digest: 14μL of the 1X NE Buffer 2, 35μL of the 1X BSA,
3.5 of the NheI, and 73.5μL of sterile water for a total of 126μL, 18μL for each of the 7 tubes.
So, 18μL of the cocktail and 2μL of the purified plasmid samples were added to seven new tubes
and were mixed by pipetting. The new solutions were then incubated at 37°C for 1hour, after
which 1μL of 10X sample dye was added to each. They were then run on a gel in hopes of
getting the two predicted bands from the restriction enzyme digestion design at 2572 and 886
base pairs.
Edwards:SIR2
9
Results
Bioinformatics
CACCCTCGAGCATTTAAAAACACTCTTCAAATCATTAATTACTCCAAGTAAGTAAATTACTTTG
AGAATATCTAACGTATAGCCAGTTATCAACAGTATTAAATTCGATTAAACAAATCATAGTATAC
ATAACTCAATCTCACATGAAGTATAGGACAGATCTCAAATAATTGAGAATTTTGCTGAGAAGTT
GTTAGCAAAAAAATATAAATAGATAGCTTTCTTGACAGGAGCAGGAATTAGTGTAAGTGCTGGA
ATTCCAGATTTTAGATCTCCTGAAACTGGGCTTTACGCCTAAATAAAAAAAGAATATGACATAA
GTGATCCTTAAAAAATATTTTCAATTAGATATTATCAAGATAATCCTTTGCCTTTTATGCAAGT
TATTAGAGATTTCTTTTCAAGAGAATATCACCCAACTTATGCTCATAAGTTAATCCATTAAATC
TACAAAAGAAAACAACTATTAATAAATATAACCTAAAATATTGATGGCTTAGAGTTAAAAACAG
GGATTAATCCCTCAAAAGTAGTCTAAGCACATGGACATATGAGAAAGGCTCATTGTGTGAATTG
CAATCATATTGTCAATATTGAAACTTACTTACAAAACTGCAAACAGTTAAAAAAAACCTAATGC
CCCATTTGCAATAATTTAGTGAAGCCAAAAGTAATTTTATTTCTTTGTTTAAATTTTAATTGTA
ATGCTAGCAAAAATATAGGAAATAAAAATTAGAAATTATTGGCACAATTAGTTGAAAAAAATAA
ATATTTTAAATTTCAATCAAAAATATTTATTGAGAATCAACTTTATTTATTATTGAAATTTATC
AGTTAGTTTCCATATCATAAATTTTTTATATTTATAAAAATAAAAGATTGTTTTCTTTGGAGAG
TTTCTTCCTAATGAGTTTTATTAGTCTAGAGATATTTTGCCAAATTCAGATTGTGTGGTTGTTA
TGGGAACATCTTTAGGTGTCTTTCCATTTGCTAATTTAATAAACGAAGTAGGTACTTCTGTTCC
AATATATATAATAAACAATAAACTTCCTAAAAATATAAGTCATCTTAAAAATCAAATTGAATTT
ATATAAGGAGATATCAATGAAATTTCTAAATAAATTATTGATTACATAAATTGACCTAGG
Figure 1. This is the genomic sequence of Tetrahymena thermophilia
SIR2 gene. The forward and reverse primers designed for PCR are
highlighted in yellow, introns are black, and exons are red.
T.t SIR2 (THD15) Genomic =1148 bp & cDNA = 940 bp
For the Bioinformatics part of this project, we were able to find the genomic sequence of
Tetrahymena thermophilia that we needed, which allowed us to continue to the PCR experiment.
The highlighted section in Figure 1, was vital to being able to perform the PCR portion that was
to follow the Bioinformatics. So, this portion of the project allowed us to continue further and
was successful.
Edwards:SIR2
10
Quantification of Genomic DNA
A260
A280
0.332
0.180
DNA Concentration
1:200
1:200
3.32 μg/μL
Purity
1.844
Table 1. After quantifying our DNA, our 1:200 numbers
were the best, so we used those. We calculated the DNA concentration
by multiplying 50μg by the A260 reading by the 200 concentration, then
dividing that by 1000μL. We calculated the purity to be 1.844 by dividing
the Absorbance 260 nm by the Absorbance 280nm.
DNA is supposed to have a purity of 1.8, so we were successful in purifying our DNA.
The calculation of the DNA concentration gave us the needed information to determine how
much DNA was needed for PCR.
(PCR) Polymerase Chain Reaction
The PCR was successful, so we were able to move on to the agarose gel electrophoresis.
Agarose Gel Electrophoresis
Figure 2. The location of the band concurs with the expected
PCR results of 1148 bps, and there were no primer dimers. The
annealing temperatures are listed below each lane. The best
product, which will be used in further experiments, was lane 5
with the annealing temperature of 52.3˚C.
Edwards:SIR2
11
Three out of the five samples ran as predicted. The other two did not appear at all.
Temperature did not seem to have any affect on the experiment because the two highest and one
of the lower annealing temperatures had bands. The product in lane 5 was the product that we
chose to continue using for the rest of the experiments. This part of the experiment was
completely successful, with no primer dimers and three good products.
TOPO Cloning and E. coli Transformation
Our Samples
9 colonies
0 colonies
200μL
Extra
Negative Control
200μL
16 colonies
Extra
2 colonies
Table 2. This portion of the project turned out
to be unsuccessful. To make up for this loss, we used
the other SIR2 group’s colonies to continue.
The numbers speak for themselves, this part of the project failed. The negative control
had more colonies than did our plates. So, to continue on we had to use colonies from the other
SIR2 group. The other SIR2 group had almost 200 colonies on their 200μL plate, which is what
we picked colonies from for the further
experiments.
Construction of Plasmid Map and
Restriction Enzyme Digestion Design
Figure 3. The black regions are the introns.
The restriction enzyme that is boxed in red,
NheI, was the enzyme we had to use, because
it was the only one that appeared more than
once and contained the largest part of the gene
which is the section containing the green
ending with the red points.
Edwards:SIR2
12
The construction of the plasmid map enabled us to choose the best restriction enzyme for
the digest. It definitely helped us to visualize our gene and the information that the second gel
results provided. Showing how much of the gene was represented by the 3 divisions and what
each predicted base pair band prediction meant.
Plasmid Purification and Restriction Enzyme Digest
Figure 4. The predicted band, the one designated by
the arrow, which is supposed to be 2572 base pairs, was
the only one to appear.
Ladder
Ladder
Ln
1
Ln
2
Ln
3
Ln
4
Ln
5
Ln
6
Figure 5. These are the
predicted bands from the
restriction enzyme digestion
design at 2572 and 886 base
pairs.
As you can see, we expected to see the top two bands in Figure 5, but one of the
predicted bands did not appear on the gel. But the one designated by the arrow did, which is
supposed to be 2572 base pairs. The 886bp band would have contained our gene, but it did not
appear, so our plasmid was not the correct one. So, this portion of the project was unsuccessful.
Edwards:SIR2
13
Discussion
Everything up to the cloning of the E. coli was successful. There are several possibilities
as to why that part of the project failed such as contamination in any form or improperly
processed E. coli. The restriction enzyme digest also failed, we believe due to contamination.
We feel that this gene holds so much promise that this project should be repeated until the results
are successful. With all of the possibilities of a longer, youthful life that the SIR2 gene provides,
we hope that these exciting ideas will soon become a reality. All of these processes and
procedures will be reevaluated in order that any errors will not be repeated in the future. I feel I
have gained adequate micropipetting skills, from practice and making mistakes, which will be
necessary in most future labs in any class. I also feel I have gained a basic knowledge of DNA
and how it is used in the most basic laboratory settings.
Edwards:SIR2
14
References
Kaeberlein, Matt, et al. "Saccharomyces cerevisiae by two different mechanisms The SIR2/3/4
complex and SIR2 alone promote longevity in." Genes & Development 13 (1999): 257085. 6 Jan. 2007 <http://www.genesdev.org/>.
Li, Chonghua, et al. "Sir2 Represses Endogenous Polymerase II Transcription Units in the
Ribosomal DNA Nontranscribed Spacer." Molecular Biology of the Cell 17.Sept (2006):
3848-59.
Lin, Su-Ju, et al. "Requirement of NAD and SIR2 for Life-Span Extension by Calorie Restriction
in Saccharomyces cerevisiae." Science (2000): 2126-28.
Smith, Joshua J. Lab Exercise 3: Bioinformatics: Molecular Computational Tools. Vol. Fall.
2008.
---. LAB Exercise 4: Tetrahymena Genomic DNA Isolation. Vol. Fall. 2008.
---. Pre-Lab Exercise 5: Design PCR Amplification Reactions . Vol. Fall. 2008.
---. LAB Exercise 5: Polymerase Chain Reaction (PCR). Vol. Fall. 2008.
---. Lab Exercise 6: Agarose Gel Electrophoresis . Vol. Fall. 2008.
---. Lab Exercise 7c: TOPO Cloning and E. coli Transformation. Vol. Fall. 2008.
TTHERM_00112480
(4.2E-27)
THD15