Supplementary methods
Molecular analyses. Most of the Plantago DNAs used in this study were obtained from
Kew Gardens. Additional DNA samples were extracted using the DNeasy Plant Mini Kit
(QIAGEN) from herbarium material provided by the Missouri Botanical Garden (P.
tubulosa) or from fresh tissue grown from seeds provided by the Western Regional
Plant Introduction Station (P. coronopus). atp1 genes were amplified by polymerase
chain reaction (PCR) using a MJ Research PTC-200 thermocycler. Each reaction was
performed using 35 cycles of 45 sec at 94°C, 45 sec at 50°C, and 2.0-2.5 min at 72°C,
with an initial step of 3 min at 94°C and a final step of 10 min at 72°C. For those species
of Plantago with two copies of atp1, three strategies were employed to isolate each
copy: 1) mixed PCR products were cloned with the TOPO TA Cloning Kit (Invitrogen)
according to the manufacturer’s instructions; 2) prior to PCR, genomic DNA template
was digested with restriction enzymes that cut only one of the atp1 copies; and 3) copyspecific PCR primers were used. PCR products were either directly purified using the
QIAquick PCR Purification Kit (QIAGEN) or gel-extracted with the QIAquick Gel
Extraction Kit (QIAGEN). Purified products were sequenced on both strands at the
Indiana Molecular Biology Institute. Primers used in this study were atp1F1
ACACGAATTTTCAAGTGGATGAGA, atp1F4 TGTCTATGTAGCGRTTGGACAG,
atp1F8 GTATTATTGAACGAAAATCTGTA, atp1F9 GGTAGAAGTCAAAGCACCCGGA,
atp1R3 TCTAGTGGCATTCGATCACAGAA, and atp1R4
GTSGCTGCTACAAGAATGGAAT. Primers atp1F8 and atp1F9 are specific to the
functional atp1 copies from the P. rigida and P. coronopus groups, respectively.
1
Of the 46 atp1 sequences analyzed in Fig. 1 of the main text, 39 were
determined in this study and are deposited in GenBank (accession numbers AY741816
- AY741854). The other seven sequences used in Fig. 1 were collected from GenBank
(Convolvulus assyricus, AY596678; Cuscuta europaea, AY596701; Dinetus truncatus,
AY596699; Montinia caryophyllacea, AY596706; Nicotiana plumbaginifolia, X07745;
Petunia axillaris ssp. parodii, U61392; Schizanthus pinnatus, AY596705). The 1291 NT
alignment used for the analysis shown in Fig. 1 and showing the multiple frameshift
mutations present in the horizontally acquired pseudogenes of certain Plantago species
is available upon request from J.P.M. (jpmower@indiana.edu).
Phylogenetic analyses. Maximum likelihood trees were constructed with PAUP*
version 4.0b101 using the HKY substitution model, a gamma parameter with four rate
categories, and the proportion of invariant sites parameter. The transition-transversion
ratio, base frequencies, shape of the gamma parameter, and proportion of invariant
sites were estimated from a neighbor-joining tree constructed from the data set prior to
the likelihood analysis. A heuristic search used the tree-bisection reconnection (TBR)
branch-swapping algorithm and the MULTREES option. Support was evaluated by
bootstrapping with 500 replicates.
Removal of the highly divergent clade of seven intact and likely functional
Plantago atp1 genes had no effect on the phylogenetic position of the atp1
pseudogenes (data not shown). That the tree resulting from this analysis had an
identical topology and virtually identical bootstrap values to that shown in Fig. 1 of the
main text shows that inclusion of these exceptionally divergent Plantago genes is not
2
causing any phylogenetic artifacts. Broadening taxon sampling to include
representatives across all major groups of angiosperms or exclusion of known sites of
RNA editing also had no effect on the phylogenetic position of the atp1 pseudogenes.
To determine whether the origin of the pseudogenes could alternatively be
explained by an intragenomic gene duplication scenario, the Shimodaira-Hasegawa
test2 was employed. The SH-test, a likelihood-based statistical test of alternative tree
topologies, strongly rejected (P<0.001 in both cases) the placement of the P. rigida/P.
tubulosa pseudogene group as sister to its functional gene group and the placement of
the P. coronopus /P. subspathulata/P. macrorhiza pseudogene group as sister to its
functional gene group.
Ruling out DNA contamination or misidentification. For the following five sets of
reasons, DNA contamination or misidentification can be definitively ruled out in both
cases of atp1 HGT reported in this study:
1) Each case was “phylogenetically reproducible”, i.e., not just one, but two or three
species of Plantago were found to harbor one or the other class of putatively
horizontally acquired atp1 pseudogenes. Moreover, each of these two small
groups of species forms a monophyletic group of most closely related species
among the 43 diverse Plantago species whose atp1 genes have been
sequenced (Supplementary Figure).
2) Reproducibility was demonstrated in another manner for three of the five species
harboring an atp1 pseudogene by isolating precisely or virtually the same atp1
genes (both intact and pseudogenes) from multiple independent DNA extractions
3
made from each species [three different preparations of DNA were made from P.
coronopus (two DNAs were isolated at Kew Botanical Gardens and the third from
plants growing at Indiana University); two independent DNAs were analyzed from
P. rigida (both DNAs were isolated at Kew Gardens) and from P. tubulosa (both
DNAs were isolated from herbarium specimens, from Kew Gardens and from
Missouri Botanical Garden)].
3) The putative donors (Bartsia and Cuscuta) in both cases of HGT are broad hostrange parasites, and the Plantago species in question are all fully autotrophic
plants that can be readily grown in isolation from these or any other parasitic
plants. DNA was isolated from four of these five Plantago species using pure
Plantago plant material that was carefully cultivated, well in isolation from any
parasitic plants [all four were grown at Kew Botanical Garden, and one of these
(P. coronopus) was also grown independently in a greenhouse at Indiana
University]. DNA for the fifth species (P. tubulosa) was obtained from herbarium
specimens at Kew Gardens and the Missouri Botanical Garden that were free of
any parasitic plant growth.
4) We obtained only Plantago-like sequences for eight other mitochondrial (cox1
and 18S rDNA), chloroplast (ndhF, rbcL, and intergenic spacers atpB/rbcL,
psaA/trnS, and trnC/trnD), and nuclear (ITS) loci from our stocks of P. rigida and
P. coronopus DNA (Y. Cho, J. P. M., Y. L. Qiu, and J. D. P., in preparation). The
two mitochondrial control genes (cox1 and 18S rDNA) are especially important
here because the exceptionally high divergence of Plantago mitochondrial genes
[see Fig. 1 and Supplementary Figure for atp1; similar divergence patterns are
4
seen for the other two mitochondrial genes (Cho et al., in prep.)] means that
native, vertically transmitted Plantago mitochondrial genes will in general be poor
competitors in PCR reactions compared to the highly conserved mitochondrial
genes found in virtually all other flowering plants (and potentially present in
Plantago DNA preparations due either to horizontal transfer or contamination).
Indeed, we initially identified only the horizontally acquired copy of atp1 from both
P. rigida and P. coronopus. After realizing that these are pseudogenes and
probably of horizontal origin, we then predicted the presence of a second,
functional but more divergent copy in both plants. The various strategies used to
amplify these otherwise disfavored intact atp1 genes are described in Methods. If
the atp1 pseudogenes were the result of contamination, then Cuscuta- and
Bartsia-like cox1 and 18S genes should have been preferentially isolated from
the respective groups of Plantago species too. The failure to obtain these is thus
strong evidence against contamination.
5) The putatively horizontally acquired atp1 genes are all pseudogenes, whereas
contamination is much more likely to result in artefactual isolation of functional
copies of this gene. On the one hand, pseudogenes are commonly found in the
context of plant mitochondrial HGT3, and also in bacterial HGT4; it appears that
many horizontally acquired genes fail to become used and simply decay as
pseudogenes. On the other hand, full-length atp1 pseudogenes rarely occur in
plant mitochondria via processes of strictly vertical transmission, for two reasons.
First, all duplications of this length (ca. 1.5 kb) or larger that have been described
in angiosperm mitochondria genomes are maintained as identical duplicates
5
(through high-frequency, copy-correction recombination between the duplicated
sequences), and thus one copy is not free to diverge and become a
pseudogene5. Second, unlike ribosomal protein genes, whose frequent functional
transfer to the nucleus in plants results in their frequently losing selection and
evolving as pseudogenes within the mitochondrial genome, the essential gene
atp1 has never been found transferred to the nucleus in plants (among over 280
diverse angiosperms examined6) and thus cannot decay as a pseudogene
(except when a second, divergent copy is introduced by horizontal transfer).
Consistent with all this, the two sets of Plantago atp1 pseudogenes – putatively
acquired by HGT – were the only atp1 pseudogenes isolated from those 109
species whose atp1 genes we PCR-amplified and sequenced and which are
included in the Supplementary Figure (there is no reason to suspect that a
second, pseudogene copy was found for the other five atp1 sequences in the
figure, nor for any other published atp1 genes, but we can’t be certain that other
authors didn’t fail to note pseudogenes in their papers or deposit them in
GenBank).
The combination of these five reasons, most of which are moderately to rather
compelling individually, unequivocally rules out the possibility of DNA contamination or
sample misidentification as an explanation for the recovery of atp1 genes of
phylogenetically anomalous origin in the Plantago species in question. Contamination
could explain our results only in the extraordinarily unlikely circumstances that 1) each
of three independent DNAs of P. coronopus was contaminated with the same broadrange parasite host (and likewise for both DNAs analyzed from P. rigida, and from P.
6
tubulosa too); and 2) of the 43 Plantago species investigated, only those DNAs from the
monophyletic clade comprising P. coronopus, P. subspathulata, and P. macrorhiza were
contaminated with DNA from Cuscuta, each contamination being from a different
Cuscuta species; and 3) likewise, only those DNAs from the sister-species P. rigida and
P. tubulosa were contaminated with DNA from (related species of) Bartsia; and 4) atp1
just happened to be the only one of nine different loci – including two other
mitochondrial genes that should preferentially amplify from contaminating DNA
compared to native DNA – to amplify from the contaminating DNA for all five Plantago
species and nine DNA preparations for which putatively transferred genes were found;
and 5) all of these many contaminating atp1 genes turn out to be pseudogenes, when
only functional atp1 genes have been isolated from each of over 100 other plant species
for which atp1 has been sequenced.
Supplementary references
1. Swofford, D. L. PAUP*: Phylogenetic analysis using parsimony (*and other
methods), Version 4.0b10 (Sinauer, Sunderland, MA, 2002).
2. Shimodaira, H. & Hasegawa, M. Mol. Biol. Evol. 16, 1114-1116 (1999).
3. Bergthorsson, U., Adams, K. L., Thomason, B. & Palmer, J. D. Nature 424, 197201 (2003).
4. Liu, Y., Harrison, P. M., Kunin, V. & Gerstein, M. Genome Biol. 5, R64 (2004).
5. Palmer, J.D. In Plant Gene Research, Vol. 6, Cell Organelles, ed. R.G.
Herrmann, Springer-Verlag, Vienna, pp. 99-133 (1992).
7
6. Adams, K. L., Qiu, Y.-L., Stoutemyer, M. & Palmer, J. D. Proc. Natl. Acad. Sci.
USA 99, 9905-9912 (2002).
7. Rønsted, N., Chase, M. W., Albach, D. C. & Bello, M. A. Bot. J. Linn. Soc. 139,
323-338 (2002).
8