From Gene to Protein
Three Important Points to Remember:
1. Chromosomes are made of DNA
2. Segments of DNA, called genes, code for specific proteins
3. Proteins in turn relate to a trait
For example eye color, enzymes, hair type
But there is a problem!
DNA holds the instructions for proteins…
BUT proteins are built in the cytoplasm at the ribosomes and DNA CANNOT leave the
nucleus!
How are proteins synthesized from DNA?
1. DNA is transcribes into messenger RNA (mRNA)
2. mRNA leaves the nucleus and travels to the cytoplasm
3. Ribosomes in the cytoplasm use the code on mRNA to translate it into amino acids
with the help of transfer RNA (tRNA)
4. Amino acids form a polypeptide chain – a protein!!
Sounds simple huh?
Well, you’re not getting off that easy, now we will break down each step of the
process…
Step 1 Transcription:
The process by which DNA passes genetic information to RNA.
What does it mean to transcribe something?
_____________________________________________________________
Ribonucleic Acid (RNA) is very similar to DNA with the following exceptions:




It is a single strand
It has uracil instead of thymine
It has the sugar ribose, instead of deoxyribose
It CAN leave the nucleus
Transcription takes place when DNA is unwound and the enzyme RNA polymerase
reads the gene and builds a messenger RNA strand to carry the instructions for a
protein out to the ribosome.
Why do you think is it so important that DNA does not leave the nucleus?
The base-pair rule is followed during transcription, except, instead of pairing thymine
with adenine, when creating an RNA strand, uracil is used.
DNA Strand:
RNA Strand:
TGCA TCAGA
ACGUAGUCU
Now you try…
DNA Strand:
RNA Strand:
AAGCTCCATGCC
______________________
DNA Strand:
RNA Strand:
TTCGATACCGGC
______________________
How could you tell if you are looking at a strand of DNA or RNA?
_____________________________________________________________
Step 2 Translation:
The process of protein synthesis from an mRNA template, occurring at the ribosome.
1. Messenger RNA travels out of the nucleus to the cytoplasm.
2. The ribosome begins to read the mRNA three bases at a time, we call these three
bases a codon. Each codon codes for one amino acid. We know that amino acids
are strung together to make a protein. See the chart below.
3. Amino acids exist freely in the cytoplasm, many of them you acquire from your
diet.
4. The ribosome starts reading the gene at the start codon AUG.
5. Transfer RNA (tRNA) has an anitcodon at one end and an amino acid at the other,
it binds to the complimentary codon on the messenger RNA.
6. Another tRNA reads the next codon, the amino acid attached to it binds with the
amino acid on the previous tRNA using a peptide bond. The first tRNA falls off
and the mRNA moves through the ribosome.
7. This process continues until the “Stop” codon is reached.
8. The amino acid chain folds into a 3 dimensional structure, now a protein.
9. That protein can be an enzyme, a hormone, or any other structure in the body that
gives it traits and functionality.
DNA Sequence: ATGACCCAGTAGCCCGGATGAACT
You will act as RNA polymerase and come up with the complimentary mRNA
Sequence:
Break the RNA into 3 base codons and determine the string of amino acids that this
gene codes for and write them below:
__________________________________________________________________________