Sex differences in depressive, anxious behaviors
and hippocampal transcript levels in a genetic
rat model
†,‡
†,§
N. S. Mehta ,L.Wang and E. E. Redei
†,‡,∗
‡
†Department of Psychiatry and Behavioral Sciences, The Norman and Helen Asher Center for the Study of Depressive
§
Disorders, and Department of Radiology, Feinberg School of Medicine, Northwestern University, Chicago, IL,
USA *Corresponding author: E. E. Redei, PhD, David Lawrence Stein Professor of Psychiatry, Department of
Psychiatry and Behavioral Sciences, Feinberg School of Medicine, Northwestern University, 303 E. Chicago
Ave 9-223, Chicago, IL 60611, USA. E-mail: e-redei@northwestern.edu
Major depressive disorder (MDD) is a common, debilitating illness with high prevalence of comorbid anxiety. The
incidence of depression and of comorbid anxiety is much higher in women than in men. These gender biases appear
after puberty and their etiology is mostly unknown. Selective breeding of the Wistar Kyoto (WKY) rat strain, an accepted
model of adult and adolescent depression, resulted in two fully inbred substrains. Adult WKY more immobile (WMI) rats
of both sexes consistently show increased depression-like behavior in the forced swim test when compared with the
control WKY less immobile (WLI) strain. In contrast, here we show that while adult female WMIs and WLIs both display
high anxiety-like behaviors, only WLI males, but not WMI males, show this behavior. Moreover, the behavioral profile of
WMI males is consistent from early adolescence to adulthood, but the high depression-and anxiety-like behaviors of the
female WMIs appear only in adulthood. These sex-specific behavioral patterns are paralleled by marked sex differences
in hippocampal gene expression differences established by genome-wide transcriptional analyses of 13th generation
WMIs and WLIs. Moreover, sex-and age-specific differences in transcript levels of selected genes are present in the
hippocampus of the current, fully inbred WMIs and WLIs. Thus, the contribution of specific genes and/or the influence of
the gonadal hormonal environment to depression-and anxiety-like behaviors may differ between male and female WMIs,
resulting in their distinct behavioral and transcriptomic profiles despite shared sequences of the somatic chromosomes.
Keywords: Anxiety behavior, comorbidity, depression animal models, early adolescence, FST, gene expression, hippocampus,
OFT, RT-qPCR, sex differences
Received 31 January 2013, revised 30 April 2013 and 27 June 2013, accepted for publication 18 July 2013
Major depressive disorder (MDD) is a common, debilitating disease with a high prevalence of comorbid anxiety (Kessler et al.
2003). A gender difference in MDD prevalence appears after puberty when the incidence of depression is twice as high in women
as in men (Bebbington 1998; Breslau et al. 1995; Merikangas et al. 2010). In addition, depression with comorbid anxiety is one
and a half times more frequent in women than in men (Breslau et al. 1995; Marcus et al. 2005, 2008; Simonds & Whiffen 2003).
The causes for these gender and pre/post-pubertal differences are not yet established. It has been proposed that inherited risk,
developmental and psychosocial factors and sex-specific hormonal changes interact to increase the risk of depression during
adolescence for women (Angold & Costello 2006; Angold et al. 1999; Hyde et al. 2008; Soares & Zitek 2008; Thapar et al. 2012).
A genetic animal model of depression can answer whether interactions of inherited risk and development between pre-and
post-puberty differ between males and females.
We generated a model from the Wistar Kyoto (WKY) rat strain, an established model of adult and adolescent MDD with comorbid
anxiety (Baum et al. 2006; Braw et al. 2006; Dugovic et al. 2000; Gentsch et al. 1987; Gosselin et al. 2009; Malkesman et al.
2005, 2006; Pare 1994; Pare & Redei 1993a; Ramos et al. 1997; Redei et al. 2001; Schaffer et al. 2010; Solberg et al. 2001;
Solberg et al. 2004). As the WKY strain was not completely inbred at the time of distribution, we were able to generate two fully
inbred substrains through bidirectional selective breeding. The selective breeding used immobility behavior in the forced swim test
(FST), an indicator of despair-like behavior. We thereby generated two fully inbred strains – the WKY more immobile (WMI), which
displayed greater depressive-like behavior compared with the ‘non-depressed’ control strain, the WKY less immobile (WLI)
(Andrus et al. 2012; Will et al. 2003). Similar to human depressed patients, WMIs respond to antidepressant treatments (Will et al.
2003) and show dysfunction in resting-state hippocampal connectivity (Hasler & Northoff 2011; Williams et al. 2012). Because
data are limited and conflicting regarding the sex and developmental differences in depression-and anxiety-like behaviors in
animal models, this study aimed to determine these differences in the WMI compared with the genetically close WLIs.
During puberty, sex hormones act as transcriptional regulators via their receptors and cause abundant gene expression
differences between the sexes, even when their genomic DNA is almost identical (Yang et al. 2011). Additionally, sexually
dimorphic gene expression differences already exist prior to puberty (Dewing et al. 2003; Lee et al. 2009). Interestingly, the
hippocampus, which has been heavily implicated in depression and anxiety (Bannerman et al. 2004; Campbell et al. 2004;
Sapolsky 2000), possesses an abundance of sex hormone receptors and its function is known to be affected by gonadal hormone
alterations. Here, we sought to determine sex-specific differences in the abundance of targeted hippocampal transcripts, before
and after puberty, which may have behavioral relevance in the adult and early adolescent WMIs compared with the WLIs.
Hippocampal transcripts to be measured in the fully inbred WMIs and WLIs were selected from genome-wide hippocampal
transcriptional analyses using adult male and female WMIs and WLIs of the 13th generation. We hypothesized that if the
behavioral profile from the 13th generation was maintained to the current, fully inbred generation, transcript abundance
differences will be consistent between them.
Materials and methods
Animals
The Institutional Animal Care and Use Committee of Northwestern University approved all animal procedures. Animals were group housed in a
temperature-and humidity-controlled vivarium under a 12-h light–dark cycle, with lights on at 0600h. Food and water were available ad libitum. The
WMI and WLI strains have been maintained in our vivarium with continuous brother–sister mating. To measure depression-and anxiety-like
behaviors, FST and open field test (OFT), respectively, were conducted on animals from the 24th to 25th generation. Early adolescent animals
were tested on postnatal day (PND) 30–33 (n = 20–35 sex/strain) and adults at 3–5months of age (n = 18–40 sex/strain). Approximately half of the
adults were also tested as early adolescents in the OFT and FST. No significant differences in adult immobility score in the FST or percent time
spent in the center of the open field were found between adult animals that performed the tests as adolescents compared with naïve adults;
therefore, the adult data for each behavior were combined. As another measure of anxiety-like behavior, elevated plus maze (EPM) test was
conducted on adult male and female 18th generation WMI and WLIs (n = 6–9/sex/strain).
Hippocampal dysfunction has been implicated both in the etiology and consequence of MDD (Davidson et al. 2002; MacQueen & Frodl 2011).
We measured genome-wide hippocampal transcriptomic changes with microarray on brains collected from adult female WMIs and WLIs from the
13th generation (n = 9/strain). Selected genes were chosen for quantification by real-time reverse transcription-polymerase chain reaction
(RT-qPCR) in 23rd–26th generation animals. The RT-qPCR was performed on PND 31 brains collected from naïve early adolescents (n =
5–8/sex/strain) and adult brains collected after at least 4 weeks rest following behavioral testing (n = 5–10/sex/strain).
Behavioral tests
All behavioral testing was performed between 1000 h and 1400 h. The FST was performed on adult animals as described previously (Solberg et al.
◦
2004). Briefly, on the first day of the 2-day test, adult animals were placed in a tank filled with 22–24 C water for 15 min. On day 2,
animals were again placed in the tank for a 5-min session, which was videotaped and scored by a trained,
blind observer for climbing, floating, swimming and diving as described previously (Detke et al. 1995). The FST
was modified for the early adolescents as the 15-min pretest would have been too taxing for these young
animals. Therefore, we used FST procedures similar to those used for mice; animals were tested in a 3-l tank
for a single 6-min videotaped session and the last 4 min of behavior was scored in the same manner as for the
adults.
In OFT, anxious animals tend to spend less time in the center of the open field. OFT was performed on adults as described previously (Nosek et
al. 2008) but the animals’ movement data were collected by TSE Videomot 2 version 5.75 software (Technical & Scientific Equipment, Bad
Homburg, Germany). Briefly, animals were placed in the center of an 82-cm-diameter arena, with an internal, central illumination of 77 lux. The test
lasted 10 min, and the time and distance in the center 50-cm-diameter arena were measured. For OFT on the early adolescents, animals were
placed in a smaller, 58-cm-diameter arena and the time and distance in the center 36cm-diameter arena were measured for 5 min. Distance data
from 17 animals were excluded owing to problems with movement tracking data. The OFT was performed 2 days before the FST, allowing 1 day for
rest. Unpublished data from our laboratory show that this testing schedule does not affect behavior in the FST.
The EPM test was performed on adults as described previously (Nosek et al. 2008) but the animal movement data were collected by the TSE
Videomot 2 version 5.75 software. Briefly, an elevated maze with two open and two closed arms and a central platform with a light measurement of
60 lux was used. Animals were placed in the maze to explore for 5 min and time and distance in the open arms were measured.
Affymetrix microarray gene expression analysis
The hippocampal gene expression analyses of adult female WMI and WLI were performed at the same time as that of the males, described
previously (Andrus et al. 2012), but the results have not been published before. Briefly, adult female WMI and WLIs were killed by fast decapitation
immediately after removal from the home cage. Brain regions were dissected immediately and stored in RNAlater (Ambion, Austin, TX, USA) at
◦
−80 C. RNA was isolated from individual hippocampi using the TRIzol method (Invitrogen, Carlsbad, CA, USA)
and treated with DNase1 (Qiagen, Valencia, CA, USA). To synthesize double-stranded cDNA, reverse
transcription was performed on total RNA from each sample with Invitrogen’s Superscript ® III First-Strand kit
(18080-051). Double-stranded cDNA from adult female WMI and WLI was synthesized, linearly amplified and labeled with biotinylated nucleotides
and hybridized onto Rat Genome 230 2.0 GeneChip arrays (Affymetrix, Santa Clara, CA, USA). Probe intensity data of the array were determined
in the R environment using the R/affy package (http://www.R-project.org). Data were normalized and processed as described previously (Andrus et
al. 2012).
Real-time reverse transcription-polymerase chain reaction
The RT-qPCR was performed as described previously (Andrus et al. 2012). Male and female early adolescent and adult WMIs and WLIs were killed
by fast decapitation immediately after removal from the home cage. Hippocampi were dissected using Paxinos coordinates [dorsal hippocampus
(anterioposterior (AP) −2.12 to −4.16, mediolateral (ML) 0–5.0 and dorsoventral (DV) 5.4–7.6) and ventral hippocampus (AP −4.2 to −6.0, ML 0–5.0
and DV 5.4–7.6)]. Tissue from the right dorsal and ventral hippocampus was used for analysis. RNA was isolated and cDNA was synthesized as in
the microarray study above. ABI 7900HT real-time cycler was used to amplify 5 ng cDNA using SYBR green reaction mix (ABI, Carlsbad, CA,
USA). Primers were designed to amplify 80–150bp products, preferentially within the region of the microarray probe, using default settings of ABI’s
Primer Express software (version 3.0). The primer pairs used for each gene are listed in Table 1. Reactions were performed in triplicate and
reached threshold amplification within 32 PCR cycles. Transcript levels were determined relative to 18S (primers commercially available from ABI,
−""Ct
Foster City, CA, USA) and a general calibrator using the 2 method.
Sequence 51 –31
Gene
Dhdds
F
R
Dhx36
F
Galntl1
Igf2
Psmc6
Slc4a5
Slc29a3
Usf1
Usp40
Yipf3
R
F
R
F
R
F
R
F
R
F
R
F
R
GGAACCTTTGTGAGGCAATCC
GTCTCGGGCCTTCTGAAGTG
AGGCTCTATCCTATACTGCACAACA
G
ACACTGGACAAACGTGAGTCTGA
TCCGCTCATTGTGACAGGAA
TGACAGGTACGCCTTCTCATCA
CCGTACTTCCGGACGACTTC
CGTCCCGCGGACTGTCT
R
AGCTTTCAGATGGCTTTAATGGA
TGCAAACATACCTGCTTCAGTACA
GTCATGATCCTGGGCCTAATCA
GTCATGCTGGGAGAAAATCAAGT
ACCTACTGCTGCCCCAACTG
AAACACGTGGATTGGGACAAC
CAGGACAACGCGAGATGAGA
CGGCGCTCCACTTCGTTA
AATCAGAGATGACATTGGAAAGGA
A
GGACTTCTCGGCTTTTCTTTTTCT
F
TGCCCTGCACATGCTCTTC
R
GGATCCCCTCGACCACCTT
F
Statistical analysis
Data are displayed as means ± SEM. Because of differences in the
behavioral test paradigms for adolescents and adults, FST and OFT
data were analyzed by two-way analysis of variance (ANOVA) (sex and
strain). The RT-qPCR data were analyzed by three-way ANOVA.
Bonferroni-adjusted post hoc tests were used to identify differences
Table 1: Quantitative RT-PCR primer sequences
F, forward; R, reverse.
between groups; significant strain differences are shown in figures.
When main effects were seen in the ANOVA, but post hoc analysis did
not show significance, hypothesis testing by Student’s t-test was
carried out between strains and also reported in the figures. EPM
data were analyzed by Student’s t-tests. Significance was considered
at P < 0.05 for all tests. Statistical analyses were performed using
Systat 11 (Systat Software, Chicago, IL, USA). Statistical
comparisons of microarray expression differences between WMI and
WLI were made by using ANOVA methods with the R/maanova
package as described previously (Andrus et al. 2012).
Results
Depression-and anxiety-like behavior
As immobility was the functional selector for the two strains, the significant strain differences persisted in adulthood, as expected
(F1,129 = 20.9, P < 0.01). Adult immobility behavior also differed by sex (F 1,129 = 13.4, P < 0.01), specifically, adult male WMIs
floated significantly more than adult female WMIs (Bonferroni post hoc; P = 0.01). As Fig. 1 indicates, strain differences in
immobility behavior of early adolescent males were mirrored in adulthood, whereas female strain differences did not follow this
pattern. Specifically, immobility behavior of the early adolescent female WMI was not different from that of WLI, but early
adolescent male WMI showed significantly more immobility than the WLI (Sex × Strain: F1,94 = 8.6, P < 0.01). Please note that the
length of the FST test differed between adolescents and adults and therefore, direct age comparisons were not made.
In contrast to the expected strain differences of immobility in the FST, significant strain differences of the percent time in the
anxiety-provoking center of the OFT were unexpectedly strain-, sex-and age-dependent, as seen in Fig. 2. Specifically, male and
female early adolescent WLIs spent less time in the anxiety-provoking center of the OFT than their respective WMIs (F 1,79 = 7.9, P
< 0.01). However, as adults, only male WLIs spent less time in the center (Strain: F 1,59 = 6.8, P = 0.01; Sex: F1,59 = 10.3, P < 0.01;
Sex × Strain: F1,59 = 6.3, P = 0.01). The strain and sex differences in the time spent in the center of the open field were paralleled
by the distance traveled in the center of the open field, but there were no significant strain differences in overall locomotor activity
as measured by total distance traveled (data not shown).
The EPM was only conducted on adults (Fig. S1, Supporting Information). Supporting the adult OFT results, adult male WMIs
spent more time in the open arm than WLIs [WLI = 0.78 ± 0.78 seconds; WMI = 27.7 ± 9.5 seconds; t(13) = 3.4, P < 0.01],
whereas female WMIs spent less time in the open arm than their WLI counterparts [WLI =
10.6 ± 2.9 seconds; WMI = 3.7 ± 1.4seconds; t(15) = 2.3, P < 0.05]. Accordingly, adult male WMIs also traveled significantly more
in the open arm than the WLIs [WLI = 0 cm; WMI = 58.7 ± 22.6cm; t(13) = 3.2, P < 0.01]. The adult female WMIs traveled
significantly less in the open arm than the WLIs [WLI = 35.6 ± 10.9 cm; WMI = 8.3 ± 3.0 cm; t(15) = 2.6, P < 0.05].
Hippocampal gene expression
Transcript abundance differences between 13th generation adult WMI and WLI male hippocampus have been reported previously
(Andrus et al. 2012), and will be used here only for comparison to the unpublished female microarray data. The microarray
analyses of female hippocampal RNA were carried out from the same generation animals, at the same time as the males, using
identical analytical procedures. We found that a total of 72 genes had transcript abundance differences of more than 30% (fold
change > 1.3) with P < 0.01, and false discovery rate (FDR) = 0.05 between the strains in female hippocampi. Using these same
criteria on the published male results (Andrus et al. 2012), 85 genes had transcript abundance differences between the WMI and
WLI male hippocampi (Table S1). Fifteen of these transcripts were common to both males and females, and all but one showed
opposite directional differences in abundance (higher vs. lower levels of the same transcript in WMI vs. WLI) between the sexes.
Given that the microarray analyses were done in an earlier generation of adult male and female W MIs and WLIs only, and the
RT-qPCR validation of selected transcripts from these microarray analysis did not show a relationship between fold change and P
value (Andrus et al. 2012), we used a different selection criteria. We chose the transcripts based on strain and sex specificity,
significance (P < 0.01) and FDR (0.05) of hippocampal expression level differences between the WMIs and WLIs, some of which
are therefore not shown in Table S1. We further selected transcripts where primers could be designed in the region of the
microarray probe and those that had human orthologs.
Solute carrier family 4, sodium bicarbonate cotransporter, member 5 (Slc4a5) and dehydrodolichyl diphosphate synthase
(Dhdds) were selected for quantification by Figure 1: Immobility measured in the FST. (a) Males and (b) females. Number of floats
measured in 5-second bins. Adults underwent a 2-day test, and floating was scored from all 5 min of the second day, resulting in a
maximum number of 61 bins. Early adolescents underwent a 1-day, 6-min test, and floating was scored from the last 4 min, resulting in a
maximum of 49 bins. *P < 0.05 and **P < 0.01 Bonferroni-adjusted post hoc test; ##P < 0.01 Student’s t-test between strains. Data are
presented as mean ± SEM. N = 16–37/strain/sex/age.
Figure 2: Time spent in the anxiety-provoking center of the arena in the OFT. (a) Males and (b) females. Expressed as a percentage
of total time. Early adolescents were tested in the smaller open field for 5 min. Adults were tested in the larger open field for 10 min. **P <
0.01 Bonferroni-adjusted post hoc test; #P < 0.05 Student’s t-test between strains. Data are presented as mean ± SEM. N =
11–32/strain/sex/age.
RT-qPCR because they showed strain differences in hippocampal transcript levels in both sexes and, therefore, were good
correlates for the strain-specific depression trait. Insulin growth factor 2 (Igf2), ubiquitin-specific peptidase 40 (Usp40), yip1
domain family, member 3 (Yipf3),proteasome (prosome, macropain) 26S subunit and ATPase, 6(Psmc6) were selected because
they showed strain differences in males only and, therefore, were good correlates for the male-specific anxiety trait. Finally, DEAH
(Asp-Glu-Ala-His) box polypeptide 36 (Dhx36), upstream transcription factor 1 (Usf1), solute carrier family 29 (nucleoside
transporters), member 3 (Slc29a3) and UDP-N-acetyl-alpha-D-galactosamine:polypeptide Nacetylgalactosaminyltransferase-like 1
(Galntl1; new synonym is Galnt16) showed strain differences only in the female hippocampus and were selected as candidate
transcripts contributing to the depression-and anxiety-like behaviors that are present in the adult female WMI.
Three major groups emerged, distinguished by their expression patterns from the hippocampal gene expression data. First, these
four show sex-specific strain differences in adulthood without differences in early adolescence or sex-specific strain differences in
early adolescence without differences in adulthood: Yipf3, Usf1, Dhx36 and Psmc6 (Fig. 3). Transcript levels of Yipf3 were
significantly higher in early adolescent compared with adult hippocampus (Fig. 3a) (F 1,29 = 52.8, P < 0.001). Yipf3 expression was
significantly higher in adult WMI male compared with WLI hippocampus (Fig. 3a).
Among those transcripts selected for female specificity from the microarray data, Usf1 and Dhx36 maintained hippocampal
abundance differences between the strains in the adult females (Sex: Usf1: F1,42 = 5.3, P < 0.05; Dhx36:
Figure 3: Hippocampal transcript abundance of Yipf3, Usf1, Dhx36 and Psmc6 differs between WMI and WLI in adulthood.
(a) Yipf3,(b) Usf1,(c) Dhx36 and (d) Psmc6. Histograms represent relative quantities of genes measured with quantitative real-time PCR
and calculated using the −""Ct method. All expression levels were normalized to 18S. *P < 0.05 Bonferroni-adjusted post hoc test; #P <
0.05 and ##P < 0.01 Student’s t-test between strains. Data are presented as mean ± SEM. N = 3–8/strain/sex/age.
F1,40 = 3.9, P = 0.05). Additionally, hippocampal expression
of Usf1 decreased from early adolescence to adulthood in
male WLIs with no changes in WMIs (Age × Strain: F1,42 =
5.4, P < 0.05) (Fig. 3b). In contrast, Usf1 expression
increased from early adolescence to adulthood in female
WMIs resulting in a strain difference in adulthood (Sex ×
Strain: F1,42 = 6.2, P < 0.05; Age × Sex: F1,42 = 4.6, P < 0.05).
Similarly, developmental changes of Dhx36 expression
showed a sex difference (Age: F1,40 = 5.6, P < 0.05; Age ×
Sex: F1,40 = 6.4, P < 0.05) (Fig. 3c). Female WLIs expressed
greater levels of hippocampal Dhx36 than WMIs, regardless
of age. In contrast, the low levels of Dhx36 in early
adolescent male WMIs increased by adulthood, abolishing
the existing strain differences (Sex × Strain: F1,40 = 4.6, P <
0.05).
The male-specific adult strain differences of hippocampal
Psmc6 expression were significant but in the opposite
direction from the earlier microarray data (Strain: F 1,38 = 6.0,
P < 0.05; Sex: F1,38 = 33.3, P < 0.001) (Fig. 3d). Developmental changes of Psmc6 hippocampal expression showed
a significant sex difference (Age: F1,38 = 30.8, P < 0.001; Age
× Sex: F1,38 = 26.7, P < 0.001). Specifically, Psmc6 levels
were extremely elevated during early adolescence in the
WMI female but reduced by adulthood (Age × Sex × Strain:
F1,38 = 8.2, P < 0.01) resulting in no strain differences in adult
females.
Next, four genes showed hippocampal expression
differences between the strains in early adolescence but not
adulthood: Slc29a3 (Fig. 4a), Galntl1 (Fig. 4b), Dhdds (Fig.
4c) and Igf2 (Fig. 4d). Early adolescent female WLIs showed
particularly high hippocampal transcript abundance of all four
genes compared with all other groups: Slc29a3 (Strain: F 1,41
= 14.4, P < 0.001; Sex: F1,41 = 10.0, P < 0.01; Age: F1,41 =
47.6, P < 0.001; Age × Strain: F1,41 = 14.5, P < 0.001; Strain
× Sex: F1,41 = 4.8, P < 0.05; Age × Sex: F1,41 = 7.9, P < 0.01;
Strain × Age × Sex: F1,41 = 5.4, P < 0.05); Galntl1 (Strain:
F1,43 = 8.1, P < 0.01; Sex: F1,43 = 5.7, P < 0.05; Age: F1,43 =
5.9, P < 0.05; Age × Strain: F1,43 = 17.9, P < 0.001); Dhdds
(Strain: F1,35 = 4.4, P < 0.05; Sex: F1,35 = 5.6, P < 0.05; Age:
F1,35 = 17.5, P < 0.001; Age × Sex: F1,35 = 10.1, P < 0.01;
Strain × Age: F1,35 = 7.2, P = 0.01; Sex × Strain: F1,35 = 6.5, P
< 0.05) and Igf2 (Age: F1,33 = 7.6, P = 0.01). Early adolescent
male WLIs also expressed higher levels of Slc29a3
compared with WMIs, but to a lesser degree. A similar
pattern emerged in hippocampal levels of Galntl1. The
elevated levels of these four genes in early adolescent
female WLIs decreased by adulthood, and adult males and
females of both strains showed similar expression.
Lastly, two genes, Usp40 (Fig. 5a) and Slc4a5 (Fig. 5b),
showed higher expression in early adolescent females of
both strains that decreased by adulthood (Fig. 5a)
(Usp40:Sex: F1,39 = 10.6, P < 0.01; Age: F1,39 = 36.6, P <
0.001; Age × Sex: F1,39 = 13.1, P = 0.001; Slc4a5: Age: F1,34
= 13.8, P = 0.001; Sex: F1,34 = 20.4, P < 0.001; Age × Sex:
F1,34 = 5.4, P < 0.05).
The comparison of the microarray results and of the current
RT-qPCR data indicates a partial agreement in the
hippocampal gene expression profile between the 13th
generation and the current 23rd–26th generation. Table S2
indicates transcripts that show significant and non-significant
same directional strain effects between the two methods.
Figure 4: Hippocampal transcript abundance of Slc29a3, Galtnl1, Dhdds and Igf2 differs between WMI and WLI in early
adolescence but not in adulthood. (a) Slc29a3, (b) Galtnl1, (c) Dhdds and (d) Igf2. Histograms represent relative quantities of genes
measured with quantitative real-time PCR and calculated using the −""Ct method. All expression levels were normalized to 18S. *P < 0.05
and **P < 0.01 Bonferroni-adjusted post hoc;#P < 0.05 Student’s t-test between strains. Data are presented as mean ± SEM. N =
4–8/strain/sex/age.
Discussion
Here, we show that in a genetic animal model of depression
the co-occurrence of depression-and anxiety-like behaviors
differs between males and females. Specifically, adult male
WMIs displayed elevated depression-, but low anxiety-like
behaviors, whereas adult female WMIs showed both
elevated depression-, and anxiety-like behaviors. While the
behaviors of the male WMI were consistent from early
adolescence to adulthood, the elevated depression-and
anxiety-like behaviors of the adult female WMIs appeared
only after early adolescence. These developmental and sex
differences in behavior were paralleled by hippocampal
expression differences in a set of apriori chosen genes.
Comorbid anxiety disorders are very common in patients
with MDD (Gorwood 2004; Kessler et al. 2003; Lamers et al.
2011; Zimmerman & Chelminski 2003; Zimmerman et al.
2002), particularly in females (Marcus et al. 2005, 2008).
exhibit both depression-and anxiety-like behaviors, though
few studies compare these behaviors between the sexes.
The WKY, the parental strain of the WMI, shows both
depression-and anxiety-like behaviors in both males and
females (Pare 1994; Pare & Redei 1993a,1993b; Tizabi et
al. 2010). However, while the segregation of the
depression-and anxiety-like behaviors of the male
WMIs/WLIs occurred progressively throughout the
generations, female WMIs retained their high anxiety-like
behavior. Specifically, third-generation WMIs showed high
anxiety-like behaviors (Will et al. 2003), but by the 11th
generation, WMI and WLI males displayed similar levels of
anxiety-like behaviors (Andrus et al. 2012). These behaviors
further segregated between the strains in males through this
study where WMIs displayed lower levels of anxiety-like
behavior compared with WLIs. It is interesting to
Similarly, most, but not all, animal models of depression
Figure 5: Greater transcript abundance of Usp40 and Slc4a5 in early adolescent female WMIs and WLIs is decreased by
adulthood. (a) Usp40 and (b) Slc4a5. Histograms represent relative quantities of genes measured with quantitative real-time PCR and
calculated using the −""Ct method. All expression levels were normalized to 18S. Data are presented as mean ± SEM. N =
3–9/strain/sex/age.
point out that as the parental WKY was at their 17th generation of inbreeding at the time of distribution, and the animals
used in this study are from the 23rd to 26th generation of
inbreeding, these strains are highly inbred by now.
Among other selectively bred or genetic models, rats
selected for anxiety-like behaviors or for low avoidance have
increased depression-and anxiety-like behaviors (Landgraf
2003; Piras et al. 2010). However, three other models,
selectively bred for low swim behavior, congenital
helplessness or sensitivity to a cholinesterase inhibitor
[Flinder’s sensitive line (FSL)], show increased depression-,
but decreased anxiety-like behaviors (Overstreet et al. 1995,
2005; Shumake et al. 2005; Weiss et al. 1998).
Chronic stress models also provide varying results
regarding concomitant depression-and anxiety-like behaviors
as well as sex differences. For example, male rodents have
either high or low anxiety behavior concomitant with
anhedonia in response to chronic mild stress (D’Aquila et al.
1994; Li et al. 2010). Interestingly, chronic mild stress during
adolescence leads to increased anhedonia, but decreased
anxiety in female, but not male, rats (Pohl et al. 2007).
Prenatal stress models of depression (Holmes et al. 2005)
also result in sex-specific deficits with enhanced
depressive-and anxiety-like behaviors in male, but not
female offspring (Van den Hove et al. in press). Taken
together, the preponderance of these different genetic and
stress models shows both depression-and anxiety-like
behaviors, suggesting that the molecular mechanisms
underlying these behaviors are partially overlapping (Eley &
Stevenson 1999; Kendler et al. 1992; Roy et al. 1995).
Previous
developmental
studies
reported
that
depression-and anxiety-like behaviors are either increased,
decreased or the same in early adolescents compared with
adult male and female animals (Doremus et al. 2006;
Doremus-Fitzwater et al. 2009; Hefner & Holmes 2007;
Imhof et al. 1993; Klausz et al. 2011; Martinez-Mota et al.
2011; Slawecki 2005). Depression-like behaviors have been
demonstrated in the pre-pubertal male WKY and FSL rat
(Malkesman & Weller 2009; Malkesman et al. 2005, 2006).
Pre-pubescent FSL males, like adult FSL males, do not
exhibit anxiety-like behaviors (Malkesman et al. 2005).
However, like adult WKY males, pre-pubescent WKY males
display greater anxiety-like behaviors in the OFT compared
with Wistars (Malkesman et al. 2005). The depression-and
anxiety-like behaviors of males from these genetic models of
depression are consistent from pre-pubescence to
adulthood, similar to the behaviors of the WMI male in this
study. Within environmental models, adult male rats, but not
adolescents, show anhedonia in response to chronic mild
stress (Toth et al. 2008). Similarly, adults, but not adolescent
males and females, show increased anxiety after prenatal
stress (Fride et al. 1986; Vallee et al. 1997; Weinstock et al.
1992; Zagron & Weinstock 2006).
Although first episodes of both MDD and anxiety tend to
occur before adulthood, anxiety onset usually precedes
MDD onset (Kessler et al. 2005; Woodward & Fergusson
2001). Whether anxiety predisposes individuals to
depression (Breslau et al. 1995; Fava et al. 2000; Kovacs et
al. 1989) or the two disorders create mutual vulnerabilities,
they likely share genetic and environmental etiologies
(Eaves et al. 2003). Women show greater prevalence of
MDD (Bebbington 1998; Kovacs et al. 1989; Merikangas et
al. 2010; Weissman et al. 1993), anxiety (Angst &
Dobler-Mikola 1985; Bruce et al. 2005; Kessler et al. 1994)
and anxiety comorbidity (Breslau et al. 1995; Marcus et al.
2005, 2008; Simonds & Whiffen 2003). In contrast, men show
greater severity or a decreased ability to cope with depression
as indicated by a much higher suicide rate than women
(Blair-West et al. 1999). The differences in presentation of
MDD between men and women indicate that both overlapping
and separate genes contribute to depression and anxiety and
also that overlapping and disparate genes affect MDD in a
sexually dimorphic manner. Findings from both human and
animal genetic studies support this (Aragam et al. 2011;
Kendler & Prescott 1999; Silberg et al. 1999; Solberg et al.
2004). Additionally, external challenges or internal hormonal
environments may affect the genes contributing to depression
and anxiety differently in males and females.
Our current results are consistent with the above assumptions. As male and female WMIs are genetically identical (with
the exception of sex chromosomes), and they were selected
for depression-like behaviors, the genes mediating their
depression-like behaviors must overlap. However, prior to the
increase in sex-specific gonadal hormones that occurs during
puberty, depression-like behaviors showed a sex difference
between WMIs and WLIs, suggesting that sex-specific genes
may contribute to the development of depression-like behavior
in the WMI males and females. The adult sex differences in
the extent of depression-like behavior in the WMIs further
imply the differential effects of sex hormones on this behavior.
In contrast, anxiety-like behaviors did not show a sex
difference between the strains in early adolescence,
suggesting that both shared and separate sequence variations
between WMIs and WLIs mediate depression-and anxiety-like
behaviors. While the depression-and anxiety-like behaviors of
the adult WMI female are not yet present in early adolescents,
these behaviors remain relatively consistent between the early
adolescent and adult male WMI, implying that the female
hormonal environment during puberty induces transcriptional
changes
in
female-specific
genes
to
precipitate
depression-and anxiety-like behaviors in the adult females.
Similar to the sexually dimorphic behavioral patterns,
hippocampal transcriptional differences between male and
female WMIs and WLIs had been found in our early
microarray study and also in our study. Selected transcripts
showed sex-specific strain differences in hippocampal
expression in adulthood and/or in early adolescence. Other
than being highly conserved across species, very little is
known about Yipf3, one of the transcripts with strain
differences in adulthood. The functions of Dhx36 and Psmc6
with female-and male-specific strain differences, respectively,
have not yet been investigated in the brain. Usf1, which
showed female-specific strain differences in adulthood, has
been shown to regulate angiotensinogen expression with
consequences in females only (Park et al. 2012).
Furthermore, polymorphisms in Usf1 have been associated
with neuropathological lesions in Alzheimer’s disease (Isotalo
et al. 2012). Female-specific expression differences of Dhx36
and Usf1 did not change from the 13th to 26th generation,
suggesting that they contribute to depressive-like behavior,
which has not changed through the generations. Among the
genes showing strain differences in early adolescence, Dhdds
is an important enzyme in the synthesis of dolichol
pyrophosphate. Interestingly, dolichols accumulate in the
neuropathological human brain (Endo et al. 2003). Both Igf2
and Slc29a3 have been previously related to depression. Igf2
is thought to be neuroprotective (Mackay et al. 2003), is
involved in cognition and memory consolidation (Chen et al.
2011) and upregulation of Igf2 has been implicated as
mediating the antidepressant effects of dicholine succinate
(Cline et al. 2012). Further, two recent studies show
decreased Igf2 expression in the amygdala or hippocampus
of male rodents in response to chronic stress (Andrus et al.
2012; Jung et al. 2012). Slc29a3 transports adenosine into
lysosomes and a sequence variation in Slc29a3 has been
significantly associated with depressive disorder in women
(Gass et al. 2010). These genes with strain expression
differences only in early adolescence could be causal to
adult behavioral differences between WMI and WLI, by
fulfilling a neurodevelopmental role.
In summary, we have shown that the concomitance and
onset of increased depression-and anxiety-like behaviors
differ between the male and female WMIs, despite their
shared genetics. These sex-and age-specific behavioral
patterns were mirrored by sex-, age-and strain-specific
differences in hippocampal transcript abundance. We
propose that the WMI is a very powerful model of
depression, as it parallels human sex differences in the
comorbidity of depression and anxiety, and the onset of
depression in females after puberty.
References
Andrus, B.M., Blizinsky, K., Vedell, P.T., Dennis, K., Shukla, P.K.,
Schaffer, D.J., Radulovic, J., Churchill, G.A. & Redei, E.E. (2012) Gene
expression patterns in the hippocampus and amygdala of endogenous
depression and chronic stress models. Mol Psychiatry 17, 49–61.
Angold, A. & Costello, E.J. (2006) Puberty and depression. Child
Adolesc Psychiatr Clin N Am 15, 919–937, ix.
Angold, A., Costello, E.J., Erkanli, A. & Worthman, C.M. (1999)
Pubertal changes in hormone levels and depression in girls.
Psychol Med 29, 1043–1053.
Angst, J. & Dobler-Mikola, A. (1985) The Zurich Study. V. Anxiety
and phobia in young adults. Eur Arch Psychiatry Neurol Sci 235,
171–178.
Aragam, N., Wang, K.S. & Pan, Y. (2011) Genome-wide association
analysis of gender differences in major depressive disorder in the
Netherlands NESDA and NTR population-based samples. JAffect
Disord 133, 516–521.
Bannerman, D.M., Matthews, P., Deacon, R.M. & Rawlins, J.N.
(2004) Medial septal lesions mimic effects of both selective dorsal
and ventral hippocampal lesions. Behav Neurosci 118,
1033–1041.
Baum, A.E., Solberg, L.C., Churchill, G.A., Ahmadiyeh, N.,
Takahashi,
J.S. & Redei, E.E. (2006) Test-and behavior-specific genetic
factors affect WKY hypoactivity in tests of emotionality. Behav
Brain Res 169, 220–230.
Bebbington, P.E. (1998) Sex and depression. Psychol Med 28,1–8.
Blair-West, G.W., Cantor, C.H., Mellsop, G.W. & Eyeson-Annan,
M.L. (1999) Lifetime suicide risk in major depression: sex and age
determinants. J Affect Disord 55, 171–178.
Braw, Y., Malkesman, O., Dagan, M., Bercovich, A., Lavi-Avnon, Y.,
Schroeder, M., Overstreet, D.H. & Weller, A. (2006) Anxiety-like
behaviors in pre-pubertal rats of the Flinders Sensitive Line (FSL)
and Wistar-Kyoto (WKY) animal models of depression. Behav
Brain Res 167, 261–269.
Breslau, N., Schultz, L. & Peterson, E. (1995) Sex differences in
depression: a role for preexisting anxiety. Psychiatry Res 58,
1–12.
Bruce, S.E., Yonkers, K.A., Otto, M.W., Eisen, J.L., Weisberg, R.B.,
Pagano, M., Shea, M.T. & Keller, M.B. (2005) Influence of psychiatric
comorbidity on recovery and recurrence in generalized anxiety
disorder, social phobia, and panic disorder: a 12-year prospective
study. Am J Psychiatry 162, 1179–1187.
Campbell, S., Marriott, M., Nahmias, C. & MacQueen, G.M. (2004)
Lower hippocampal volume in patients suffering from depression: a
meta-analysis. Am J Psychiatry 161, 598–607.
Chen, D.Y., Stern, S.A., Garcia-Osta, A., Saunier-Rebori, B.,
Pollonini, G., Bambah-Mukku, D., Blitzer, R.D. & Alberini, C.M.
(2011) A critical role for IGF-II in memory consolidation and
enhancement. Nature 469, 491–497.
Cline, B.H., Steinbusch, H.W., Malin, D., Revishchin, A.V., Pavlova,
G.V., Cespuglio, R. & Strekalova, T. (2012) The neuronal insulin
sensitizer dicholine succinate reduces stress-induced depressive
traits and memory deficit: possible role of insulin-like growth factor
2. BMC Neurosci 13, 110.
D’Aquila, P.S., Brain, P. & Willner, P. (1994) Effects of chronic mild
stress on performance in behavioural tests relevant to anxiety and
depression. Physiol Behav 56, 861–867.
Davidson, R.J., Lewis, D.A., Alloy, L.B., Amaral, D.G., Bush, G., Cohen,
J.D., Drevets, W.C., Farah, M.J., Kagan, J., McClelland, J.L.,
Nolen-Hoeksema, S. & Peterson, B.S. (2002) Neural and behavioral
substrates of mood and mood regulation. Biol Psychiatry 52, 478–502.
Detke, M.J., Rickels, M. & Lucki, I. (1995) Active behaviors in the rat
forced swimming test differentially produced by serotonergic and
noradrenergic antidepressants. Psychopharmacology (Berl) 121,
66–72.
Dewing, P., Shi, T., Horvath, S. & Vilain, E. (2003) Sexually
dimorphic gene expression in mouse brain precedes gonadal
differentiation. Brain Res Mol Brain Res 118, 82–90.
Doremus, T.L., Varlinskaya, E.I. & Spear, L.P. (2006) Factor
analysis of elevated plus-maze behavior in adolescent and adult
rats. Pharmacol Biochem Behav 83, 570–577.
Doremus-Fitzwater, T.L., Varlinskaya, E.I. & Spear, L.P. (2009)
Social and non-social anxiety in adolescent and adult rats after
repeated restraint. Physiol Behav 97, 484–494.
Dugovic, C., Solberg, L.C., Redei, E., Van Reeth, O. & Turek, F.W.
(2000) Sleep in the Wistar-Kyoto rat, a putative genetic animal
model for depression. Neuroreport 11, 627–631.
Eaves, L., Silberg, J. & Erkanli, A. (2003) Resolving multiple
epigenetic pathways to adolescent depression. J Child Psychol
Psychiatry 44, 1006–1014.
Eley, T.C. & Stevenson, J. (1999) Using genetic analyses to clarify
the distinction between depressive and anxious symptoms in
children. J Abnorm Child Psychol 27, 105–114.
Endo, S., Zhang, Y.W., Takahashi, S. & Koyama, T. (2003)
Identification of human dehydrodolichyl diphosphate synthase gene.
Biochim Biophys Acta 1625, 291–295.
Fava, M., Rankin, M.A., Wright, E.C., Alpert, J.E., Nierenberg, A.A.,
Pava, J. & Rosenbaum, J.F. (2000) Anxiety disorders in major
depression. Compr Psychiatry 41, 97–102.
Fride, E., Dan, Y., Feldon, J., Halevy, G. & Weinstock, M. (1986)
Effects of prenatal stress on vulnerability to stress in prepubertal
and adult rats. Physiol Behav 37, 681–687.
Gass, N., Ollila, H.M., Utge, S., Partonen, T., Kronholm, E., Pirkola,
S., Suhonen, J., Silander, K., Porkka-Heiskanen, T. & Paunio, T.
(2010) Contribution of adenosine related genes to the risk of
depression with disturbed sleep. J Affect Disord 126, 134–139.
Gentsch,
C., Lichtsteiner, M. & Feer, H. (1987) Open field
and elevated plus-maze: a behavioural comparison between
spontaneously hypertensive (SHR) and Wistar-Kyoto (WKY) rats
and the effects of chlordiazepoxide. Behav Brain Res 25,
101–107.Gorwood, P. (2004) Generalized anxiety disorder and
major depressive disorder comorbidity: an example of genetic
pleiotropy? Eur Psychiatry 19, 27–33.
Gosselin, R.D., Gibney, S., O’Malley, D., Dinan, T.G. & Cryan, J.F.
(2009) Region specific decrease in glial fibrillary acidic protein
immunoreactivity in the brain of a rat model of depression.
Neuroscience 159, 915–925.
Hasler, G. & Northoff, G. (2011) Discovering imaging endophenotypes
for major depression. Mol Psychiatry 16, 604–619.
Hefner, K. & Holmes, A. (2007) Ontogeny of fear-, anxiety-and
depression-related behavior across adolescence in C57BL/6J mice.
Behav Brain Res 176, 210–215.
Holmes, A., le Guisquet, A.M., Vogel, E., Millstein, R.A., Leman, S. &
Belzung, C. (2005) Early life genetic, epigenetic and environmental
factors shaping emotionality in rodents. Neurosci Biobehav Rev 29,
1335–1346.
Hyde, J.S., Mezulis, A.H. & Abramson, L.Y. (2008) The ABCs of
depression: integrating affective, biological, and cognitive models
to explain the emergence of the gender difference in depression.
Psychol Rev 115, 291–313.
Imhof, J.T., Coelho, Z.M., Schmitt, M.L., Morato, G.S. & Carobrez,
A.P. (1993) Influence of gender and age on performance of rats in
the elevated plus maze apparatus. Behav Brain Res 56, 177–180.
Isotalo, K., Kok, E.H., Luoto, T.M., Haikonen, S., Haapasalo, H.,
Lehtimaki, T. & Karhunen, P.J. (2012) Upstream transcription factor 1
(USF1) polymorphisms associate with Alzheimer’s disease-related
neuropathological lesions: Tampere Autopsy Study. Brain Pathol 22,
765–775.
Jung, S., Lee, Y., Kim, G., Son, H., Lee, D.H., Roh, G.S., Kang, S.S.,
Cho, G.J., Choi, W.S. & Kim, H.J. (2012) Decreased expression of
extracellular matrix proteins and trophic factors in the amygdala
complex of depressed mice after chronic immobilization stress. BMC
Neurosci 13, 58.
Kendler, K.S. & Prescott, C.A. (1999) A population-based twin study
of lifetime major depression in men and women. Arch Gen
Psychiatry 56, 39–44.
Kendler, K.S., Neale, M.C., Kessler, R.C., Heath, A.C. & Eaves, L.J.
(1992) Major depression and generalized anxiety disorder. Same
genes, (partly) different environments? Arch Gen Psychiatry 49,
716–722.
Kessler, R.C., McGonagle, K.A., Zhao, S., Nelson, C.B., Hughes, M.,
Eshleman, S., Wittchen, H.U. & Kendler, K.S. (1994) Lifetime and
12-month prevalence of DSM-III-R psychiatric disorders in the United
States. Results from the National Comorbidity Survey. Arch Gen
Psychiatry 51, 8–19.
Kessler, R.C., Berglund, P., Demler, O., Jin, R., Koretz, D., Merikangas,
K.R., Rush, A.J., Walters, E.E. & Wang, P.S. (2003) The epidemiology
of major depressive disorder: results from the National Comorbidity
Survey Replication (NCS-R). JAMA 289, 3095–3105.
Kessler, R.C., Berglund, P., Demler, O., Jin, R., Merikangas, K.R. &
Walters, E.E. (2005) Lifetime prevalence and age-of-onset
distributions of DSM-IV disorders in the National Comorbidity
Survey Replication. Arch Gen Psychiatry 62, 593–602.
Klausz, B., Pinter, O., Sobor, M., Gyarmati, Z., Furst, Z., Timar, J. &
Zelena, D. (2011) Changes in adaptability following perinatal
morphine exposure in juvenile and adult rats. Eur J Pharmacol
654, 166–172.
Kovacs, M., Gatsonis, C., Paulauskas, S.L. & Richards, C. (1989)
Depressive disorders in childhood. IV. A longitudinal study of
comorbidity with and risk for anxiety disorders. Arch Gen
Psychiatry 46, 776–782.
Lamers, F., van Oppen, P., Comijs, H.C., Smit, J.H., Spinhoven, P., van
Balkom, A.J., Nolen, W.A., Zitman, F.G., Beekman, A.T. & Penninx,
B.W. (2011) Comorbidity patterns of anxiety and depressive disorders
in a large cohort study: the Netherlands Study of Depression and
Anxiety (NESDA). J Clin Psychiatry 72, 341–348.
Landgraf, R. (2003) HAB/LAB rats: an animal model of extremes in
trait anxiety and depression. Clin Neurosci Res 3, 239–244.
Lee, S.I., Lee, W.K., Shin, J.H., Han, B.K., Moon, S., Cho, S.,
Park, T., Kim, H. & Han, J.Y. (2009) Sexually dimorphic gene
expression in the chick brain before gonadal differentiation. Poult
Sci 88, 1003–1015.
Li, Y., Zheng, X., Liang, J. & Peng, Y. (2010) Coexistence of
anhedonia and anxiety-independent increased novelty-seeking
behavior in the chronic mild stress model of depression. Behav
Processes 83, 331–339.
Mackay, K.B., Loddick, S.A., Naeve, G.S., Vana, A.M., Verge,
G.M. & Foster, A.C. (2003) Neuroprotective effects of insulin-like
growth factor-binding protein ligand inhibitors in vitro and in vivo. J
Cereb Blood Flow Metab 23, 1160–1167.
MacQueen, G. & Frodl, T. (2011) The hippocampus in major
depression: evidence for the convergence of the bench and
bedside in psychiatric research? Mol Psychiatry 16, 252–264.
Malkesman, O. & Weller, A. (2009) Two different putative genetic
animal models of childhood depression--a review. Prog Neurobiol
88, 153–169.
Malkesman, O., Braw, Y., Zagoory-Sharon, O., Golan, O.,
Lavi-Avnon, Y., Schroeder, M., Overstreet, D.H., Yadid, G. &
Weller, A. (2005) Reward and anxiety in genetic animal models of
childhood depression. Behav Brain Res 164, 1–10.
Malkesman, O., Braw, Y., Maayan, R., Weizman, A., Overstreet,
D.H., Shabat-Simon, M., Kesner, Y., Touati-Werner, D., Yadid, G. &
Weller, A. (2006) Two different putative genetic animal models of
childhood depression. Biol Psychiatry 59, 17–23.
Marcus, S.M., Young, E.A., Kerber, K.B., Kornstein, S., Farabaugh,
A.H., Mitchell, J., Wisniewski, S.R., Balasubramani, G.K., Trivedi,
M.H. & Rush, A.J. (2005) Gender differences in depression: findings
from the STAR*D study. J Affect Disord 87, 141–150.
Marcus, S.M., Kerber, K.B., Rush, A.J., Wisniewski, S.R.,
Nierenberg, A., Balasubramani, G.K., Ritz, L., Kornstein, S., Young,
E.A. & Trivedi, M.H. (2008) Sex differences in depression symptoms
in treatment-seeking adults: confirmatory analyses from the
Sequenced Treatment Alternatives to Relieve Depression study.
Compr Psychiatry 49, 238–246.
Martinez-Mota, L., Ulloa, R.E., Herrera-Perez, J., Chavira, R. &
Fernandez-Guasti, A. (2011) Sex and age differences in the impact
of the forced swimming test on the levels of steroid hormones.
Physiol Behav 104, 900–905.
Merikangas, K.R., He, J.P., Burstein, M., Swanson, S.A., Avenevoli,
S., Cui, L., Benjet, C., Georgiades, K. & Swendsen, J. (2010)
Lifetime prevalence of mental disorders in U.S. adolescents: results
from the National Comorbidity Survey Replication-Adolescent
Supplement (NCS-A). J Am Acad Child Adolesc Psychiatry 49,
980–989.
Nosek, K., Dennis, K., Andrus, B.M., Ahmadiyeh, N., Baum, A.E.,
Solberg Woods, L.C. & Redei, E.E. (2008) Context and
strain-dependent behavioral response to stress. Behav Brain Funct
4,
23.
Overstreet, D.H., Pucilowski, O., Rezvani, A.H. & Janowsky, D.S.
(1995) Administration of antidepressants, diazepam and psychomotor stimulants further confirms the utility of Flinders Sensitive
Line rats as an animal model of depression. Psychopharmacology
(Berl) 121, 27–37.
Overstreet, D.H., Friedman, E., Mathe, A.A. & Yadid, G. (2005) The
Flinders Sensitive Line rat: a selectively bred putative animal model
of depression. Neurosci Biobehav Rev 29, 739–759.
Pare, W.P. (1994) Open field, learned helplessness, conditioned
defensive burying, and forced-swim tests in WKY rats. Physiol
Behav 55, 433–439.
Pare, W.P. & Redei, E. (1993a) Depressive behavior and stress
ulcer in Wistar Kyoto rats. J Physiol Paris 87, 229–238.
Pare, W.P. & Redei, E. (1993b) Sex differences and stress
response of WKY rats. Physiol Behav 54, 1179–1185.
Park, S., Liu, X., Davis, D.R. & Sigmund, C.D. (2012) Gene trapping
uncovers sex-specific mechanisms for upstream stimulatory factors
1 and 2 in angiotensinogen expression. Hypertension 59,
1212–1219. Piras, G., Giorgi, O. & Corda, M.G. (2010) Effects of
antidepressants on the performance in the forced swim test of two
psychogenetically selected lines of rats that differ in coping
strategies to aversive conditions. Psychopharmacology (Berl) 211,
403–414.
Pohl, J., Olmstead, M.C., Wynne-Edwards, K.E., Harkness, K. & Menard,
J.L.
(2007)
Repeated
exposure
to
stress
across
the
childhood-adolescent period alters rats’ anxiety-and depression-like
behaviors in adulthood: the importance of stressor type and gender.
Behav Neurosci 121, 462–474.
Ramos, A., Berton, O., Mormede, P. & Chaouloff, F. (1997) A
multiple-test study of anxiety-related behaviours in six inbred rat
strains. Behav Brain Res 85, 57–69.
Redei, E.E., Ahmadiyeh, N., Baum, A.E., Sasso, D.A., Slone, J.L.,
Solberg, L.C., Will, C.C. & Volenec, A. (2001) Novel animal models
of affective disorders. Semin Clin Neuropsychiatry 6, 43–67.
Roy, M.A., Neale, M.C., Pedersen, N.L., Mathe, A.A. & Kendler,
K.S. (1995) A twin study of generalized anxiety disorder and major
depression. Psychol Med 25, 1037–1049.
Sapolsky, R.M. (2000) The possibility of neurotoxicity in the
hippocampus in major depression: a primer on neuron death. Biol
Psychiatry 48, 755–765.
Schaffer, D.J., Tunc-Ozcan, E., Shukla, P.K., Volenec, A. & Redei,
E.E. (2010) Nuclear orphan receptor Nor-1 contributes to
depressive behavior in the Wistar-Kyoto rat model of depression.
Brain Res 1362, 32–39.
Shumake, J., Barrett, D. & Gonzalez-Lima, F. (2005) Behavioral
characteristics of rats predisposed to learned helplessness:
reduced reward sensitivity, increased novelty seeking, and
persistent fear memories. Behav Brain Res 164, 222–230.
Silberg, J., Pickles, A., Rutter, M., Hewitt, J., Simonoff, E., Maes, H.,
Carbonneau, R., Murrelle, L., Foley, D. & Eaves, L. (1999) The
influence of genetic factors and life stress on depression among
adolescent girls. Arch Gen Psychiatry 56, 225–232.
Simonds, V.M. & Whiffen, V.E. (2003) Are gender differences in
depression explained by gender differences in co-morbid anxiety?
J Affect Disord 77, 197–202.
Slawecki, C.J. (2005) Comparison of anxiety-like behavior in
adolescent and adult Sprague–Dawley rats. Behav Neurosci 119,
1477–1483.
Soares, C.N. & Zitek, B. (2008) Reproductive hormone sensitivity
and risk for depression across the female life cycle: a continuum of
vulnerability? J Psychiatry Neurosci 33, 331–343.
Solberg, L.C., Olson, S.L., Turek, F.W. & Redei, E. (2001) Altered
hormone levels and circadian rhythm of activity in the WKY rat, a
putative animal model of depression. Am J Physiol Regul Integr
Comp Physiol 281, R786–R794.
Solberg, L.C., Baum, A.E., Ahmadiyeh, N., Shimomura, K., Li, R.,
Turek, F.W., Churchill, G.A., Takahashi, J.S. & Redei, E.E. (2004)
Sex-and lineage-specific inheritance of depression-like behavior in
the rat. Mamm Genome 15, 648–662.
Thapar, A., Collishaw, S., Pine, D.S. & Thapar, A.K. (2012)
Depression in adolescence. Lancet 379, 1056–1067.
Tizabi, Y., Hauser, S.R., Tyler, K.Y., Getachew, B., Madani, R.,
Sharma, Y. & Manaye, K.F. (2010) Effects of nicotine on
depressive-like behavior and hippocampal volume of female WKY
rats. Prog Neuropsychopharmacol Biol Psychiatry 34, 62–69.
Toth, E., Gersner, R., Wilf-Yarkoni, A., Raizel, H., Dar, D.E.,
Richter-Levin, G., Levit, O. & Zangen, A. (2008) Age-dependent
effects of chronic stress on brain plasticity and depressive
behavior. J Neurochem 107, 522–532.
Vallee, M., Mayo, W., Dellu, F., Le Moal, M., Simon, H. & Maccari, S.
(1997) Prenatal stress induces high anxiety and postnatal handling
induces low anxiety in adult offspring: correlation with
stress-induced corticosterone secretion. J Neurosci 17,
2626–2636.
Van den Hove, D.L.A., Kenis, G., Brass, A., Opstelten, R., Rutten,
B.P.F., Bruschettini, M., Blanco, C.E., Lesch, K.P., Steinbusch,
H.W.M. & Prickaerts, J. (in press) Vulnerability versus resilience to
prenatal stress in male and female rats; implications from gene
expression profiles in the hippocampus and frontal cortex. Eur
Neuropsychopharmacol (in press).
Weinstock, M., Matlina, E., Maor, G.I., Rosen, H. & McEwen,
B.S. (1992) Prenatal stress selectively alters the reactivity of the
hypothalamic-pituitary adrenal system in the female rat. Brain Res
595, 195–200.
Weiss, J.M., Cierpial, M.A. & West, C.H. (1998) Selective breeding
of rats for high and low motor activity in a swim test: toward a new
animal model of depression. Pharmacol Biochem Behav 61,
49–66.
Weissman, M.M., Bland, R., Joyce, P.R., Newman, S., Wells, J.E.
& Wittchen, H.U. (1993) Sex differences in rates of depression:
cross-national perspectives. J Affect Disord 29, 77–84.
Will, C.C., Aird, F. & Redei, E.E. (2003) Selectively bred
Wistar-Kyoto rats: an animal model of depression and
hyper-responsiveness to antidepressants. Mol Psychiatry 8,
925–932.
Williams, K.A., Mehta, N., Wang, L., Redei, E.E. & Procissi, D. (2012)
Resting state functional MRI in a rat model of major depressive
disorder. Program No. 827.11. 2012 Neuroscience Meeting Planner.
Society for Neuroscience, New Orleans, LA, Online.
Woodward, L.J. & Fergusson, D.M. (2001) Life course outcomes
of young people with anxiety disorders in adolescence. JAmAcad
Child Adolesc Psychiatry 40, 1086–1093.
Yang, C.N., Shiao, Y.J., Shie, F.S., Guo, B.S., Chen, P.H., Cho,
C.Y., Chen, Y.J., Huang, F.L. & Tsay, H.J. (2011) Mechanism
mediating oligomeric Abeta clearance by naive primary microglia.
Neurobiol Dis 42, 221–230.
Zagron, G. & Weinstock, M. (2006) Maternal adrenal hormone
secretion mediates behavioural alterations induced by prenatal
stress in male and female rats. Behav Brain Res 175, 323–328.
Zimmerman, M. & Chelminski, I. (2003) Generalized anxiety
disorder in patients with major depression: is DSM-IV’s hierarchy
correct? Am J Psychiatry 160, 504–512.
Zimmerman, M., Chelminski, I. & McDermut, W. (2002) Major
depressive disorder and axis I diagnostic comorbidity. J Clin
Psychiatry 63, 187–193.
Acknowledgments
This study was supported by the Davee Foundation. The authors
thank Brian Andrus for his early work in the selective breeding and
sample preparation for the microarray. They also thank Gary
Churchill and Peter Vedell for their work on the early microarray
data analyses. The authors have no conflict of interest.
Supporting Information
Additional supporting information may be found in the online
version of this article at the publisher’s web-site:
Table S1. Differentially expressed transcripts in males and
females from the microarray analysis. Data shown are fold
change > 1.3, P < 0.01. When fold change < 1, WLI > WMI;
when fold change > 1, WMI > WLI.
Table S2. Comparison of gene expression results between
microarray and RT-qPCR. When fold change < 1, WLI > WMI;
when fold change > 1, WMI > WLI.
Figure S1. Distance traveled in the anxiety-provoking open
arms of the elevated plus maze test. (a) Males and
(b) females. Distance traveled in the open arm measured in
centimeters. Animals were tested for 5 min. *P < 0.05 and **P
< 0.01. Student’s t-test between strains. Data are