Controversy brewing over Lyme disease testing
Roxanne Nelson
Available online 23 September 2005.
Lyme disease, a bacterial infection transmitted by ticks, is difficult to diagnose
because its symptoms mimic those of other disorders. Although diagnostic tests are
currently available, there is a growing controversy over the unreliability of standard
testing, as well as the use of new testing approaches.
The US Centers for Disease Control and Prevention (CDC) has cautioned against
using assays whose accuracy and clinical usefulness has not been adequately
established. These include urine antigen tests, immunofluorescent staining for cell
wall-deficient forms of Borrelia burgdorferi, and PCR tests that are done on
inappropriate specimens such as blood and urine. “Based on calls and complaints that
we get from patients, and also based on what we're hearing from colleagues in Europe,
we are concerned that some patients are being misdiagnosed or potentially
misdiagnosed and mistreated, as a result of unfounded reliance on these tests”, says
Paul Mead, a medical epidemiologist at the CDC.
CDC guidelines recommend a two-test approach using a sensitive enzyme
immunoassay (EIA) or immunofluorescent assay, to be followed by a western
immunoblot if results are positive. But Lyme disease is often mistaken for other
ailments, and conversely, serious illnesses such as amyotrophic lateral sclerosis have
been misdiagnosed as Lyme disease.
Nick Harris, the founder and chief executive of IGeneX, a reference laboratory that
does PCR testing for Lyme disease on a variety of specimens, is among those who
feel that the CDC's guidelines are actually part of the reason for the high rate of
misdiagnosis. “The CDC says the two-tiered system works for Lyme victims within 3
to 4 months of a tick bite and for those who have an erythema migrans rash”, he
points out. “But more than 50% of the patients do not remember being bitten by a tick
and more than 50% do not get the rash.” Any screening test, according to laboratory
experts, needs to be sensitive to 90–100%, and the EIA is less than 70% sensitive in
early Lyme disease, Harris adds. In chronic or late stage Lyme disease, the percentage
of positive EIA is much lower. “The CDC claims that the PCR is not useful in the
diagnosis of Lyme because of its low predictive value,” says Harris. “The PCR's
specificity is 100%, and it does have a high predictive value if positive.”
New method for detection of Borrelia burgdorferi
antigen complexed to antibody in seronegative Lyme
disease
Michael Brunner
,
The Children’s Hospital of Philadelphia, Department of Rheumatology, Abramson
Research Center 1104D, 3516 Civic Center Blvd., Philadelphia, PA 19104-4318,
USA
Received 22 August 2000; revised 21 November 2000; accepted 30 November 2000.
Available online 20 February 2001.
Abstract
Serologic tests for Lyme disease are problematic. Because of cross-reactive
antigens Borrelia burgdorferi (Bb) shares with other organisms, Lyme disease can
be overdiagnosed. However, in addition to specificity problems, serologic tests for
early Lyme disease can be falsely negative due to lack of sensitivity of ELISAs and
Western blots. Most routine antibody tests are designed to detect free antibodies, and
in early, active disease, circulating antibodies may not be free in serum but
sequestered in complexes with the antigens which originally triggered their
production. This difficulty may be overcome by first isolating immune complexes
(IC) from the serum and using this fraction for testing. Free Borrelia-specific
antibodies can then be liberated from the immune complexes which may enhance test
sensitivity in patients with active disease. We developed a technique that captures
the antibody component of IC on immunobeads, and subsequently releases the antigen
component of IC. Immunoblotting with monoclonal antibody detected at least one
antigen to be OspA, thus definitively demonstrating a Borrelia-specific antigen in
circulating IC in early Lyme disease. This test is also useful in demonstrating Bb
antigen in otherwise seronegative Lyme disease patients.
Author Keywords: Lyme disease ; Borrelia burgdorferi; Immune complexes;
Borrelia-specific antigens; OspA; Serologic tests
Abbreviations: IC, immune complex; Bb, Borrelia burgdorferi; OspA, outer surface
protein A; PEG, polyethylene glycol; Mab, monoclonal antibody
Article Outline
1. Introduction
2. Materials and methods
2.1. Detection of antigen from IC of a patient sample
2.2. Preparation of Bb sonicate
2.3. Commercial serologic assays
3. Results
4. Discussion
Acknowledgements
References
1. Introduction
Lyme disease (LD), a common seasonal illness caused by the tick-borne spirochete,
Borrelia burgdorferi (Bb) (Steere et al., 1983), is often diagnosed clinically by the
presence of an erythema migrans rash. However, this ‘bullseye rash’ occurs in only 60
to 80% of patients ( Centers for Disease Control, 1997), and can be atypical in
appearance. Other symptoms, such as summer flu-like illness or joint pains,
commonly bring the patient to the physician for a diagnosis within a few weeks of the
tick bite, often when the rash is absent or no longer present. A potential gold standard
for making the diagnosis is a positive culture from a biopsy (usually skin) of the
affected area, whereupon Borrelia burgdorferi can be detected. Typically, this is only
done in certain circumstances at equipped facilities, and it is not practical for broad
scale testing. Usually, indirect antibody tests are performed as a two-tier approach
(Centers and Dressler) with an ELISA, or immunofluorescent IFA ( Lane et al., 1990)
screening assay, followed by a confirmatory Western blot ( Centers and Dressler).
The Western blot is performed on samples from equivocal or ELISA positive patients,
and known consensus bands for IgM (early cases) or IgG are ascertained ( Centers
and Dressler) before diagnosis is made. These tests can be problematic due to
subjective interpretation of the banding pattern ( Liang et al., 2000), or that there are
cross-reactive antigens shared by Bb (e.g., the flagellin 41 kD antigen of Treponema
pallidum or other flagellin bearing organisms, rheumatoid factor or other serum
contaminants, or 23 kD antigen from Helicobatcer pylori), which may give rise to
false positive bands. Hence, LD can be easily overdiagnosed (Steere and Steere). In
proficiency testing programs, Bakken and Bakken and others have found poor
sensitivity, specificity and reproducibility ( Hedberg; Hedberg and Luger) in repeated
testing which did not improve with time ( Bakken et al., 1997). Even the two-tier
approach has not helped, and they ( Bakken et al., 1997) concluded that more
stringent criteria are needed to approve commercially available kits for the
serodiagnosis of Lyme disease.
The potential problem of poor sensitivity in testing for LD may be due to an assay
performed at an early time in disease when antibodies detected by these tests are not
yet present in circulation, and may only be present as immune complexes (IC). Since
routine serodiagnostic tests rely on free antibody, those antibodies tied up in
complexes are unavailable and therefore missed (Schutzer and Schutzer), leading to
false negative results. There have been academic laboratory examples of using IC to
improve Lyme testing ( Schutzer and Coyle), and ICs have helped both in ELISAs
( Brunner and Brunner) and in Western blots ( Brunner and Schutzer) to detect LD in
seronegative patients ( Schutzer and Coyle).
Outer surface protein A (OspA), shed in outer surface membrane blebs by Bb into
surrounding body fluids (Barbour; Dorward and Katona), has been used before in
assays for early LD involving IC ( Schutzer et al., 1994). The importance of OspA is
noted by the fact that recombinant OspA is used in a preventative vaccine for LD
( Steere and Sigal). In this report we looked for OspA because even though it has been
shown to be down-regulated when Bb enters the mammalian host ( Schwan et al.,
1995), there has been much work done on OspA expression and its antibodies found
early and late in LD ( Akin et al., 1999; Kalish et al., 1995; Montgomery et al., 1996).
Expression of OspA in early and late disease ( Akin; de; Schutzer; Montgomery and
Krause), as well as its association with IC ( Brunner; Brunner and Schutzer), has
possible implications for disease pathogenesis.
The technique reported here is practical for detecting a Bb antigen in an otherwise
seronegative LD patient (positive for Bb culture and presenting with an erythema
migrans rash) by routine antibody testing. Moreover, this is the first clear
demonstration that a specific Bb antigen, OspA, is part of an IC purified from a
patient’s serum. This was accomplished by first capturing the IC by its antibody
component on an immunobead, releasing the attached antigen, and confirming the
identity of the OspA antigen using an OspA-specific monoclonal antibody in an
immunoblot.
Although reporting the results from this particular patient was considered noteworthy
to illustrate the technique, the assay has proven to be sensitive and highly specific in
correctly determining infectivity status in more that 20 patients with various
manifestations of LD, as well as in numerous endemic area negatives and other
disease controls (Brunner and Sigal, 2000).
2. Materials and methods
2.1. Detection of antigen from IC of a patient sample
The patient’s serum (0.6 ml) was first precipitated with an equal amount of 7% PEG
in 0.1 M borate buffer, pH 8.4, overnight at 4°C. High molecular weight components
of serum are known to precipitate at this PEG concentration (Digeon et al., 1977). The
pellet was washed several times with 3.5% PEG in 0.1 M borate buffer, and the final
pellet was resuspended in half the volume (0.3 ml) of 0.1 M borate buffer, pH 10.2, to
concentrate and dissociate the ICs. A small aliquot (20 μl) of this was frozen at −70°C
to be analyzed later (diluted 1:2 in reducing buffer, boiled, and 30 μl added to well)
and is referred to as dissociated PEG precipitate in Fig. 1, lane 3. The remainder (280
μl) was neutralized with (22.5 μl of 3 M sodium acetate pH 5.27) acid to re-associate
the antigen–antibody complex and optimize it for subsequent binding through the
antibody component. This was accomplished by sequential addition of commercial
preparations of protein conjugated agarose beads used for immunoprecipitation.
Specifically, 0.1 ml of GammaBind G Sepharose (Pharmacia, Piscataway, NJ, USA)
was added to the neutralized sample, which was placed on a reciprocal shaker in the
cold (4°C) for 1 h. Theoretically, the conjugated sepharose will bind any IC
containing IgG antibody subclass. This process was repeated with 0.1 ml of
immobilized Mannan binding protein (Ultralink, Pierce, Rockford, IL, USA) to
remove all complexes containing IgM antibody. Finally, protein -agarose (Santa
Cruz Biotechnology, Santa Cruz, CA, USA) was used to remove all remaining IgM,
IgG, and IgA subclasses of antibody that might be contained in ICs. To insure
complete removal, beads were shaken overnight at 4°C and centrifuged at 10,000
RPM (8600×g) for 15 min. After aspiration of supernatant, the bead pellet was
resuspended in 90 μl of reducing buffer, and boiled for 10 min (to release antigen).
The supernatant (30 μl/well) was then electrophoresed on 12% precast gels (Bio-Rad,
Hercules, CA, USA), transferred to PVDF (Polyscreen, NEN, Boston, MA, USA)
membranes and probed with anti-OspA mAb H5332 (from Alan Barbour, UCI) to
detect the 31 kD OspA protein (Fig. 1, lane 2). The second antibody was peroxidase
labelled goat anti-mouse IgG Fab-specific (A2304 Sigma, St. Louis, MO, USA)
adsorbed with bovine, horse, and human serum proteins. This was followed by
reaction with enhanced luminol chemiluminescent substrate (Renaissance Plus, NEN),
and exposure to X-ray film (BioMax, NEN).
(3K)
Fig. 1. OspA detection in immune complexes of a seronegative, culture positive, EM positive Lyme
disease patient. A Western blot was performed using the OspA-specific monoclonal antibody, H5332.
Lane 1 contains Bb sonicate. The patient’s serum was treated as described in the Materials and methods,
and the boiled immunobead eluate and the dissociated PEG precipitate are depicted in lanes 2 and 3,
respectively.
2.2. Preparation of Bb sonicate
This was done as reported previously (Brunner et al., 1998). Briefly, B. burgdorferi
B31 was grown at 32°C in BSK-H medium supplemented with 6% rabbit serum
(Sigma) to late log phase (5–6 days), harvested, and washed four times with
phosphate buffered saline (PBS), pH 7.2, containing 5 mM MgCl2. The final pellet
was resuspended in PBS and sonicated (medium setting; Braun-Sonic 2000) for four
pulses of 30 s each with 1 min between pulses. The sonicate was diluted in reducing
buffer, boiled, and 5 μg in 30 μl volume was added to the well (Fig. 1, lane 1).
2.3. Commercial serologic assays
Patient serum was tested for Lyme antibodies by commercial ELISA and Western blot
(MarDx diagnostics, Carlsbad, CA, USA).
Immunofluorescence assay (IFA) for IgM in patient serum was done as described
(Mitchell et al., 1996) using substrate slides containing B. burgdorferi B31 (Bion
Enerprises, Chicago, IL, USA) and FITC-conjugated goat anti-human IgM (Kallestad
Diagnostics, Chaska, MN, USA) diluted 1:100.
3. Results
The serum from a patient who was seronegative on standard Lyme assays, including
ELISA, IFA, and immunoblot, but who presented with EM and was culture positive
from biopsy taken at the time of the serum sample, was tested for Lyme antigen as
part of IC. The patient’s serum was first PEG precipitated at a concentration known to
bring down high molecular weight circulating immune complexes if present (Digeon
et al., 1977) but not free antibodies. When the dissociated precipitate was
electrophoresed, blotted and probed with monoclonal antibody against OspA (H5332),
a single 31 kD band was obtained ( Fig. 1, lane 3). Antigen migrated identically to the
single band obtained when a B. burgdorferi sonicate was used as the starting material
(Fig. 1, lane 1). When the dissociated PEG precipitate of the patient’s serum was first
treated with antibody-binding beads, boiled to release antigen which was in a complex
with the antibody, and similarly probed with mAb H5332, a band with the same
electrophoretic mobility as the 31 kD OspA antigen was observed ( Fig. 1, lane 2).
Therefore, Lyme-specific antigen (OspA) complexed to antibody was detected in the
serum of a patient with LD at a time when routine Lyme testing (ELISA, IFA,
immunoblot) was negative.
4. Discussion
OspA has been previously detected in immune complexes of patients with Lyme
disease, and has been shown to be useful both for ELISA (Brunner et al., 1997) and
Western blot assays ( Schutzer et al., 1994). Specific IC containing LD antigens have
been isolated in acid fractions off anti-C1q affinity columns and demonstrated in dot
blots ( Zhong et al., 1997) where it was suggested that detection of IC may be a
reliable parameter for monitoring a patient’s response to antibiotic treatment. In Fig. 1,
lane 3, we demonstrate that the dissociated PEG precipitate yields a 31 kD band
reactive with an OspA-specific monoclonal antibody. This shows that OspA antigen
may be present in dissociated IC from a LD patient, as was seen previously with
polyclonal anti-OspA ( Schutzer et al., 1999). Even though this suggested that the
antigen could have been complexed with the antibody in IC, it could also have been
associated with the high molecular weight fraction ( Digeon et al., 1977) and trapped
inadvertently in the PEG precipitate. Fig. 1, lane 2, shows the boiled bead fraction,
which releases antigen from captured IC on various antibody (Fc portion)-binding
beads, and produces one 31 kD band on reaction with anti-OspA Mab, H5332. This
represents a more compelling argument that Lyme-specific OspA antigen was
originally present in IC, as demonstrated by capture through its antibody component
on immunobeads. Therefore, this study gives more convincing evidence than previous
work ( Schutzer and Zhong) that Bb antigen is actually present in IC of a patient with
active Lyme disease.
ICs are also thought to be useful to distinguish between active LD and residual titer of
free antibody, as is sometimes seen with Lyme-specific IgG or IgM for months to
years after LD is cured (Hammers-Berggren et al., 1994). In this regard, ICs are also
useful in conjunction with IgM assays ( Brunner and Brunner) to demonstrate early
disease.
Since IC is present in numerous diseases, for example systemic lupus erythematosus
(Herrmann et al., 1978), infectious hepatitis ( Carella et al., 1977) and multiple
sclerosis ( Coyle, 1987), a variation of this technique may be useful as a generalized
procedure to demonstrate or isolate antigen when appropriate.
We have also seen antibodies to the other expected antigens in ICs of LD patients
previously (e.g., flagellin, OspC, P39, even OspB) in ELISAs (Brunner et al., 1998)
and in Western blots ( Schutzer et al., 1994). To date, using the method reported here
and in related work ( Brunner and Sigal, 2000), we found OspA containing ICs,
although we also probed with H9724 anti-flagellin, 41 kD (from Alan Barbour), and
L22 1F8 anti-OspC, 23 kD (from Betina Wilske) monoclonal antibodies. This could
be due to the ubiquitous nature of OspA as a result of its shedding (even though its
expression may be down-regulated) when the Bb organism enters the mammalian host,
( Schwan et al., 1995). This could also possibly be due to a technical anomaly, that the
OspA epitope recognized by H5332 is more stable to boiling than that for the flagellin
or OspC, and/or that H5332 is a better Mab (higher affinity or avidity) than the others.
Although OspA was thought to be down-regulated upon infection of the mammalian
host (Schwan et al., 1995), a brisk early OspA antibody response occurs after needle
inoculation of mice with OspA ( Fikrig et al., 1990). In another study, one-third of
spirochetes inoculated into mice continued to express OspA ( de Silva et al., 1996),
and in a mouse model of persisting Bb infection, OspA was expressed persistently
( Schwan et al., 1991). Human LD patients showed early OspA T cell responses
( Krause et al., 1992) as well as humoral antibodies by analyzing ICs from those
patients on recombinant OspA immunoblots ( Schutzer et al., 1994). OspA and OspC
were coexpressed in CSF in early neurologic Lyme patients ( Schutzer et al., 1997).
By direct fluorescent staining of uncultured spirochetes ex vivo and by PCR
amplification of spirochetal mRNA, Montgomery et al. (1996) found that spirochetes
expressing OspA could be detected within the first 2 weeks of infection, and mRNA
was present at day 14 of infection but not at day 30, suggesting that expression of
OspA is transient. During periods of maximal Lyme arthritis, Akin et al. (1999) found
that IgG antibody response to OspA correlated with severe and prolonged Lyme
arthritis, and that this activity was directed against a C-terminal epitope of OspA.
However, when Kalish et al. (1995) measured responses to epitopes in full length
recombinant OspA and three recombinant OspA fragments, early IgM responses were
found to epitopes in all three fragments of OspA. The conclusions from all of the
above work are that OspA can be found early in disease, may be abundant and shed
from the spirochete, and may be sequestered in IC. Therefore, the antibody would not
be readily available to assays for free antibody at this time, and its complexed antigen
(OspA) would be difficult to find (in free antigen assays) in addition to its reported
transient appearance at that time ( Montgomery et al., 1996), giving it an unjustified
reputation for being only a late antigen giving rise to a late antibody response.
However, since the antigen has been shown to be present early, and to have multiple
epitopes for reactivity at that time ( Kalish et al., 1995), it is not inconceivable that
OspA would likely be found by the method described in this paper.
Acknowledgements
I would like to thank Dr. Alan Barbour for monoclonal antibodies H5332 and H9724,
and Dr. Betina Wilske for monoclonal antibody L22 1F8. I would also like to thank
Dr. Randy Cron for reading the manuscript and making helpful suggestions.
References
Akin, E., McHugh, G.L., Flavell, R.A., Fikrig, E. and Steere, A.C., 1999. The
immunoglobulin (IgG) antibody response to OspA and OspB correlates with severe
and prolonged Lyme arthritis and the IgG response to P35 correlates with mild and
brief arthritis. Infect. Immun. 67, p. 173. Abstract-MEDLINE | Abstract-EMBASE |
Order Document
Bakken, L.L., Callister, S.M., Wand, P.J. and Schell, R.F., 1997. Interlaboratory
comparison of test results in the Wisconsin State Laboratory of Hygiene/College of
American Pathologists proficiency testing program. J. Clin. Microbiol. 35, p. 537.
Abstract-EMBASE | Abstract-MEDLINE | Order Document
Bakken, L.L., Case, K.L., Callister, S.M., Bourdeau, N.J. and Schell, R.F., 1992.
Performance of 45 laboratories participating in a proficiency testing program for
Lyme disease serology. J. Am. Med. Assoc. 268, p. 891. Abstract-MEDLINE |
Abstract-EMBASE | Order Document
Barbour, A.G. and Hayes, S.F., 1986. Biology of Borrelia species. Microbiol. Rev. 50,
p. 381. Abstract-MEDLINE | Abstract-EMBASE | Order Document
Brunner, M. and Sigal, L.H., 2000. Immune complexes from serum of patients with
Lyme disease contain Borrelia burgdorferi antigen and antigen-specific antibodies:
potential use for improved testing. J. Infect. Dis. 182, p. 534. Abstract-EMBASE |
Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Brunner, M., Stein, S., Mitchell, P.D. and Sigal, L.H., 1998. Immunoglobulin M
capture assay for serologic confirmation of early Lyme disease: analysis of immune
complexes with biotinylated Borrelia burgdorferi sonicate enhanced with Flagellin
peptide epitope. J. Clin. Microbiol. 36, p. 1074. Abstract-MEDLINE | AbstractEMBASE | Order Document
Brunner, M., Stein, S. and Sigal, L.H., 1997. Enzyme-linked, IgM capture, immune
complex, biotinylated antigen assay (EMIBA): a new serologic assay for early Lyme
disease. Arthritis Rheum. 40, p. S142.
Carella, G., Digeon, M., Feldmann, G., Jungers, P., Drouct, J. and Bach, J.F., 1977.
Detection of hepatitis B antigen in circulating immune complexes in acute and
chronic hepatitis. Scand. J. Immunol. 6, p. 1297. Abstract-MEDLINE | AbstractEMBASE | Order Document
Centers for Disese Control, 1997. Case definitions for infectious conditions under
public health surveillance. Morb. Mortal Wkly Rep. 46, p. 14 RR-10.
Centers for Disease Control and Prevention, 1995. Recommendations for test
performance and interpretation from the Second National Conference on Serological
Diagnosis of Lyme disease. Morb. Mortal Wkly Rep. 44, p. 590.
Centers for Disease Control, 1990. Case definitions for public health surveillance.
Morb. Mortal Wkly Rep. 39, p. 19 No. RR-13.
Coyle, P.K., Schutzer, S.E., Deng, Z., Krupp, L.B., Belman, A.L., Benach, J.L. and
Luft, B.J., 1995. Detection of Borrelia burgdorferi-specific antigen in antibodynegative cerebrospinal fluid in neurologic Lyme disease. Neurology 45, p. 2010.
Abstract-MEDLINE | Order Document
Coyle, P.K., Schutzer, S.E., Belman, A.L., Krupp, L.B. and Golightly, M.G., 1990.
Cerebrospinal fluid immune complexes in patients exposed to Borrelia burgdorferi:
detection of Borrelia-specific and -nonspecific complexes. Ann. Neurol. 28, p. 739.
Abstract-MEDLINE | Abstract-EMBASE | Order Document | Full Text via
CrossRef
Coyle, P.K., 1987. Detection and isolation of immune complexes in multiple sclerosis
cerebrospinal fluid. J. Neuroimmunol. 15, p. 97. Abstract | Abstract + References |
PDF (560 K)
Digeon, M., Laver, M., Riza, J. and Bach, J.F., 1977. Detection of circulating immune
complexes in human sera by simplified assays with polyethylene glycol. J. Immunol.
Methods 16, p. 165. Abstract | Abstract + References | PDF (892 K)
Dorward, D.W., Schwan, T.G. and Garon, C.F., 1991. Immune capture and detection
of Borrelia burgdorferi antigens in urine, blood, tissue from infected ticks, mice, dogs,
and humans. J. Clin. Microbiol. 29, p. 1162. Abstract-EMBASE | AbstractMEDLINE | Order Document
Dressler, F., Whalen, J.A., Reinhardt, B.N. and Steere, A.C., 1993. Western blotting
in the serodiagnosis of Lyme disease. J. Infect. Dis. 167, p. 392. Abstract-EMBASE |
Abstract-MEDLINE | Order Document
Fikrig, E.S., Barthold, S.W., Kantor, F.S. and Flavell, R.A., 1990. Protection of mice
against the Lyme disease agent by immunizing with recombinant OspA. Science
(Wash. DC) 250, p. 553. Abstract-EMBASE | Abstract-MEDLINE | Order
Document
Hammers-Berggren, S., Lebech, A.M., Karlsson, M., Svenungsson, B., Hansen, K.
and Stiernstedt, G., 1994. Serological follow-up after treatment of patients with
erythema migrans and neuroborreliosis. J. Clin. Microbiol. 32, p. 1519. AbstractEMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document
Hedberg, C.W. and Osterholm, M.T., 1990. Serologic tests for antibody to Borrelia
burgdorferi: another Pandora’s box for medicine?. Arch. Intern. Med. 150, p. 732.
Abstract-EMBASE | Abstract-MEDLINE | Order Document
Hedberg, C.W., Osterholm, M.T., MacDonald, K.L. and White, K.E., 1987. An
interlaboratory study of antibody to Borrelia burgdorferi. J. Infect. Dis. 155, p. 1325.
Abstract-EMBASE | Abstract-MEDLINE | Order Document
Herrmann, K., Lohrisch, I., Bohme, H.J. and Hausten, U.F., 1978. Detection of
antibodies after immune complex splitting in serum of patients with bullous
pemphigoid and systemic lupus erythematosus. Br. J. Dermatol. 99, p. 635. AbstractEMBASE | Abstract-MEDLINE | Order Document
Kalish, R.A., Leong, J.M. and Steere, A.C., 1995. Early and late antibody responses
to full-length and truncated constructs of outer surface protein A of Borrelia
burgdorferi in Lyme disease. Infect. Immun. 63, p. 2228. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Katona, L.I., Beck, G. and Habicht, G.S., 1992. Purification and immunologic
characterization of a major low molecular weight lipoprotein from Borreia
burgdorferi. Infect. Immun. 60, p. 4995. Abstract-EMBASE | Abstract-MEDLINE |
Order Document
Krause, A., Burmester, G.R., Rensing, A., Schoerner, C., Schaible, U.E., Simon, M.M.
et al., 1992. Cellular immune reactivity to recombinant OspA and flagellin from
Borrelia burgdorferi in patients with Lyme boreliosis. Complexity of humoral and
cellular immune responses. J. Clin. Invest. 90, p. 1077. Abstract-MEDLINE |
Abstract-EMBASE | Order Document
Lane, R.S., Lennette, E.T. and Madigan, J.E., 1990. Interlaboratory and
intralaboratory comparison of indirect immunofluorescence assays for serodiagnosis
of Lyme disease. J. Clin. Microbiol. 28, p. 1774. Abstract-EMBASE | Order
Document
Luger, S.W. and Krauss, E., 1990. Serologic tests for Lyme disease: interlaboratory
variability. Arch. Intern. Med. 150, p. 761. Abstract-EMBASE | Order Document
Liang, F.T., Aberer, A., Cinco, M. et al., 2000. Antigenic conservation of an
immunodominant invariable region of the VIsE lipoprotein among European
pathogenic genospecies of Borrelia burgdorferi SL. J. Infect. Dis. 182, p. 1455.
Abstract-MEDLINE | Order Document | Full Text via CrossRef
Mitchell, P.D., Reed, K.D. and Hofkes, J.M., 1996. Immunoserologic evidence of
coinfection with Borrelia burgdorferi, Babesia microti, and human granulocytic
Ehrlichia species in residents of Wisconsin and Minnesota. J. Clin. Microbiol. 34, p.
724. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order
Document
Montgomery, R.R., Malawista, S.E., Feen, K.J. and Bockenstedt, L.K., 1996. Direct
demonstration of antigenic substitution of Borrelia burgdorferi ex vivo: exploration
of the paradox of the early immune response to outer surface proteins A and C in
Lyme disease. J. Exp. Med. 183, p. 261. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document | Full Text via CrossRef
Schutzer, S.E., Coyle, P.K., Reid, P. and Holtzman, B.H., 1999. Borrelia burgdorferispecific immune complexes in acute Lyme disease. J. Am. Med. Assoc. 282, p. 1942.
Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
Schutzer, S.E., Coyle, P.K., Krupp, L.B., Zhidian, D., Belman, A.L., Dattwyler, R.
and Luft, B.J., 1997. Simultaneous expression of Borrelia OspA and OspC and IgM
response in cerebrospinal fluid in early neurologic Lyme disease. J. Clin. Invest. 100,
p. 763. Abstract-MEDLINE | Abstract-EMBASE | Order Document
Schutzer, S.E., Coyle, P.K., Dunn, J.J., Luft, B.J. and Brunner, M., 1994. Early and
specific antibody response to Osp A in Lyme disease. J. Clin. Invest. 94, p. 454.
Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order
Document
Schutzer, S.E., Coyle, P.K. and Brunner, M., 1992. Identification of specific Borrelia
burgdorferi components in circulating antigen–antibody complexes. In: Lyme
Disease: Molecular and Immunologic Approaches, Cold Spring Harbor Laboratory
Press.
Schutzer, S.E., Coyle, P.K., Belman, A.L., Golightly, M.G. and Drulle, J., 1990.
Sequestration of antibody to Borrelia burgdorferi in immune complexes in
seronegative Lyme disease. Lancet 335, p. 312. Abstract | Full Text + Links | PDF
(569 K)
Schwan, T.G., Piesman, J., Golde, W.T., Dolan, M.C. and Rosa, P.A., 1995. Induction
of an outer surface protein on Borrelia burgdorferi during tick feeding. Proc. Natl.
Acad. Sci. USA 92, p. 2909. Abstract-MEDLINE | Abstract-EMBASE | AbstractElsevier BIOBASE | Order Document
Schwan, T.G., Karstens, R.H., Schrumpff, M.E. and Simpson, W.J., 1991. Changes in
antigenic reactivity of Borrelia burgdorferi, the Lyme disease spirochete, during
persistent infection in mice. Can. J. Microbiol. 37, p. 450. Abstract-MEDLINE |
Abstract-EMBASE | Order Document
Sigal, L.H., Zahradnik, J.M., Lavin, P. et al., 1998. A vaccine consisting of
recombinant Borrelia burgdorferi outer-surface protein A to prevent Lyme disease.
New Engl. J. Med. 339, p. 216. Abstract-EMBASE | Abstract-Elsevier BIOBASE |
Order Document | Full Text via CrossRef
de Silva, A.M., Telford, S.R., Brunet, L.R. et al., 1996. Borrelia burgdorferi OspA is
an artropod-specific transmission-blocking Lyme disease vaccine. J. Exp. Med. 183, p.
271. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full
Text via CrossRef
Steere, A.C., Sikand, V.K., Meurice, F. et al., 1998. Vaccination against Lyme
disease with recombinant Borrelia burgdorferi outer-surface lipoprotein A with
adjuvant. New Engl. J. Med. 339, p. 209. Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document | Full Text via CrossRef
Steere, A.C., Taylor, E., McHugh, G.L. and Logigian, E.L., 1993. The overdiagnosis
of Lyme disease. J. Am. Med. Assoc. 269, p. 1812. Abstract-EMBASE | Order
Document
Steere, A.C., Grodzicki, R.L., Kornblatt, A.N., Craft, J.E., Barbour, A.G., Burgdorfer,
W., Schmid, G.P., Johnson, E. and Malawista, S.E., 1983. The spirochetal etiology of
Lyme disease. New Engl. J. Med. 308, p. 733. Abstract-MEDLINE | AbstractEMBASE | Order Document
Zhong, W., Oschmann, P. and Wellensiek, H.-J., 1997. Detection and preliminary
characterization of circulating immune complexes in patients with Lyme disease. Med.
Microbiol. Immunol. 186, p. 15. Abstract-Compendex | Abstract-Compendex |
Abstract-INSPEC | Order Document
Tel.: +1-215-590-3792; fax: +1-215-590-1258; email: brunner@email.chop.edu
Journal of Immunological Methods
Volume 249, Issues 1-2 , 1 March 2001, Pages 185-190
The American Journal of Medicine
Volume 110, Issue 3 , 15 February 2001, Pages 217-219
This Document
SummaryPlus
Full Text + Links
·Full Size Images
PDF (57 K)
External Links
Actions
Cited By
Save as Citation Alert
E-mail Article
Export Citation
doi:10.1016/S0002-9343(00)00701-4
Copyright © 2001 Excerpta Medica Inc. All rights reserved.
Brief observation
Intralaboratory reliability of serologic and urine
testing for Lyme disease *1
Mark S. Klempner MD , a, Christopher H. Schmid PhDa, Linden Hu MDa,
Allen C. Steere MDa, Gary Johnsona, Bilaal McCloud BSa, Richard Noring BSa
and Arthur Weinstein MDb
a
Department of Medicine (MSK, CHS, LH, ACS, GJ, BM, RN), New England
Medical Center, Boston, Massachusetts, USA
b
Department of Medicine (AW), George Washington University Medical Center,
Washington, DC, USA
Received 1 May 2000; revised 16 October 2000; accepted 16 October 2000. Available
online 13 February 2001.
Referred to by:
Intralaboratory reliability of serologic and urine testing for
lyme disease, The American Journal of Medicine, Volume 111,
Issue 6, 15 October 2001, Pages 502-503
Boyd G. Stephensa and Nick S. Harrisa
SummaryPlus | Full Text + Links | PDF (46 K)
Article Outline
• Material and methods
• Study subjects
• Sample collection
• Serologic testing
• Lyme urine antigen test
• Statistical analysis
• Results
• Serologic test
• Lyme urine antigen test
• Discussion
• References
Laboratory testing for Lyme disease is controversial because of problems with test
sensitivity and specificity, the lack of standardized reagents, and interlaboratory and
intralaboratory variability [1, 2, 3, 4 and 5]. We determined the reliability of a
serologic test and a urine test for Lyme disease, each performed in a reference
laboratory, in control subjects and patients with Lyme disease who had posttreatment
symptoms.
Material and methods
Study subjects
We studied 10 healthy control subjects who had never had Lyme disease and 21
patients with a history of acute Lyme disease, as defined by the Centers for Disease
Control and Prevention [6], who had chronic (>6 month’s duration) fatigue,
musculoskeletal pain, or neurocognitive impairment despite treatment with
recommended antibiotics. The study protocol was approved by the Human
Investigation Institutional Review Boards of New England Medical Center and New
York Medical College. All subjects gave written, informed consent.
Sample collection
Serum samples were obtained from all 21 patients and the 10 control subjects. One
aliquot was immediately analyzed; duplicate aliquots were frozen at −70°C and tested
within 6 months after collection.
Midstream clean-catch urine samples were collected from the 10 control subjects into
Vacutainer urine collection kits (Becton Dickinson, no. 36-4962) supplied by the
manufacturer of the Lyme urine antigen test (IGeneX, Palo Alto, California). Each
specimen was immediately aliquoted into five gray-top Vacutainer urine collection
tubes, agitated to mix the sample with the preservative, and either packaged on ice
and sent immediately for testing or stored at −70°C and tested within 6 months after
collection. Aliquots of each sample were assayed separately.
Frozen urine samples for offsite testing were packaged in insulated boxes containing
refrigeration packets and shipped by overnight courier. All duplicate samples were
sent blinded to the reference laboratories.
Serologic testing
Immunoglobulin G western blot assays for antibodies against Borrelia burgdorferi
antigens were performed at New England Medical Center. In all cases, the
immunoglobulin G Marblot strip test system kit (MarDx Diagnostics, Carlsbad,
California) was used according to the manufacturer’s instructions. As recommended
by the Centers for Disease Control and the Second National Conference on Serologic
Diagnosis of Lyme Disease [7], strips that had 5 or more of the 10 significant bands
were considered positive for specific immunoglobulin G antibody to B. burgdorferi.
Lyme urine antigen test
Urine testing was performed by IgeneX, the manufacturer of the Lyme urine antigen
test. This test is based on an antigen capture-inhibition enzyme-linked immunosorbent
assay that uses adsorbed polyclonal antibodies that bind to several antigenic moieties
(31kDa, 34 kDa, 39 kDa, and 93kDa) of B. burgdorferi [8]. The test results are
interpreted according to the antigen level in the sample: negative, <20 ng/mL;
borderline, 20 to 31 ng/mL; positive, 32 to 45 ng/mL, and highly positive, >45 ng/mL.
Statistical analysis
Between-sample agreement was assessed with the kappa statistic for categories and
the intraclass correlation for numeric values [9]. Kappa values >0.75 indicated
excellent agreement; values <0.40 indicated poor agreement.
Results
Serologic test
In all 10 control subjects, the initial western blot analysis yielded negative results. In
three of four duplicate specimens analyzed, the same immunoreactive bands seen in
the original aliquot were present; 1 duplicate specimen contained a 41-kDa band that
was not present in the original aliquot.
In the 21 patients with Lyme disease, the results of the initial western blot analysis
were positive in 14 cases and negative in 7. Analysis of duplicate specimens yielded
identical results in all 21 patients (κ = 1.0, Table 1). The same immunoreactive bands
identified in the first analysis were present in 7 of the 14 seropositive duplicate
samples; 5 samples had 1 additional band, and 2 samples had 2 additional bands.
Repeat testing of the 7 seronegative samples showed fewer than 5 reactive bands in all
samples.
Table 1. Western Blot Testing for Immunoglobulin G Antibodies to B. burgdorferi in 21 patients with
Posttreatment Symptoms of Lyme Disease legend
Lyme urine antigen test
The results of urine antigen testing in the 10 control subjects were not reliable (Table
2). The standard deviation of the antigen level in the five aliqots of each specimen
ranged from 18 to 150 ng/mL. According to the manufacturer, the maximal standard
deviation of a test result should be <9 ng/mL. The interpretation of these test results
was also unreliable. It ranged from negative to highly positive for 6 specimens, from
negative to positive for 1, from borderline to highly positive for 1, and from positive
to highly positive for 2. The multiple category (negative, borderline, positive, highly
positive) agreement was poor (κ = 0.10). Agreement was also poor when negative
results were compared with all other categories (κ = 0.12) and when negative and
borderline results together were compared with the other categories (κ = 0.18).
Table 2. Results of Lyme Urine Antigen Testing in 10 Control Subjects without Lyme Disease
Discussion
Nonculture-based testing is the mainstay for laboratory diagnosis of Lyme disease. In
patients with chronic symptoms of at least 6 months’ duration, the most appropriate
serologic test for prior infection with B. burgdorferi is the immunoglobulin G western
blot, which is recommended by the Centers for Disease Control as the final basis for
determination of seroreactivity [7]. In a 1997 review of serologic testing for Lyme
disease, there were no reports on the interlaboratory or intralaboratory consistency of
this test [10]. Our study showed that testing of duplicate serum specimens from 21
patients with Lyme disease and 10 healthy controls by a single reference laboratory
using a commercially available immunoglobulin G western blot kit gave 100%
concordant results for seroreactivity and highly reproducible results for the
identification of individual bands.
In contrast, Lyme urine antigen testing of 10 healthy control subjects gave
contradictory results on aliquots of the same specimen in 8 of 10 cases and yielded
consistently false-positive results in the other 2. At least one aliquot of each specimen
was falsely positive. IGeneX, the manufacturer of the test, claims a 3% false-positive
rate and a 95% ability to distinguish between a positive and negative population with
an antigen cut-off level of ≥32 ng/mL. Our results do not support these claims and
indicate that this test should not be used for the laboratory diagnosis of active or
suspected Lyme disease.
References
1. H. Hofmann, Lyme borreliosis—problems of serological diagnosis. Infection 24
(1996), pp. 470–472. Abstract-EMBASE | Abstract-MEDLINE | Order Document
2. S.L. Brown, S.L. Hansen and J.J. Langone, Role of serology in the diagnosis of
Lyme disease. JAMA 282 (1999), pp. 62–66. Abstract-MEDLINE | Order Document
| Full Text via CrossRef
3. L.L. Bakken, S.M. Callister, P.J. Wand and R.F. Schell, Interlaboratory comparison
of test results for detection of Lyme disease by 516 participants in the Wisconsin State
Laboratory of Hygiene/College of American Pathologists proficiency testing program.
J Clin Microbiol 35 (1997), pp. 537–543. Abstract-EMBASE | Abstract-MEDLINE |
Order Document
4. L.L. Bakken, K.L. Case, S.M. Callister et al., Performance of 45 laboratories
participating in a proficiency testing program for Lyme disease serology. JAMA 268
(1992), pp. 891–895. Abstract-MEDLINE | Abstract-EMBASE | Order Document
5. S.W. Luger and E. Krauss, Serologic tests for Lyme disease. Interlaboratory
variability. Arch Intern Med 150 (1990), pp. 761–763. Abstract-EMBASE | Order
Document
6. Centers for Disease Control and Prevention, Case definitions for infectious
conditions under public health surveillance: Lyme disease. MMWR 46 suppl RR-10
(1997), pp. 20–21.
7. Recommendations for test performance and interpretation from the Second
International Conference on Serologic Diagnosis of Lyme Disease. MMWR.
1995;44:590–591.
8. N.S. Harris and B.G. Stephens, Detection of Borrelia burgdorferi antigen in urine
from patients with Lyme borreliosis. J Spirochetal Tick-Borne Dis 2 (1995), pp. 37–
41.
9. J. Fleiss. Statistical Methods for Rates and Proportions, Wiley & Sons, New York
(1981).
10. P. Tugwell, D.T. Dennis, A. Weinstein et al., Laboratory evaluation in the
diagnosis of Lyme disease. Ann Intern Med 127 (1997), pp. 1109–1123. AbstractMEDLINE | Abstract-EMBASE | Order Document
*1 Supported by grants from the National Institute of Allergy and Infectious Diseases
(AI-65308) and from the Division of Research Resources supporting the General
Clinical Research Center (RR-00054) at New England Medical Center.
Correspondence should be addressed to Mark S. Klempner, MD, Department of
Medicine, New England Medical Center, 750 Washington Street, Boston,
Massachusetts 02111
The American Journal of Medicine
Volume 110, Issue 3 , 15 February 2001, Pages 217-219
Intralaboratory reliability of serologic and urine
testing for Lyme disease *1
Mark S. Klempner MD , a, Christopher H. Schmid PhDa, Linden Hu MDa,
Allen C. Steere MDa, Gary Johnsona, Bilaal McCloud BSa, Richard Noring BSa
and Arthur Weinstein MDb
a
Department of Medicine (MSK, CHS, LH, ACS, GJ, BM, RN), New England
Medical Center, Boston, Massachusetts, USA
b
Department of Medicine (AW), George Washington University Medical Center,
Washington, DC, USA
Received 1 May 2000; revised 16 October 2000; accepted 16 October 2000. Available
online 13 February 2001.
Referred to by:
Intralaboratory reliability of serologic and urine testing for
lyme disease, The American Journal of Medicine, Volume 111,
Issue 6, 15 October 2001, Pages 502-503
Boyd G. Stephensa and Nick S. Harrisa
SummaryPlus | Full Text + Links | PDF (46 K)
Article Outline
• Material and methods
• Study subjects
• Sample collection
• Serologic testing
• Lyme urine antigen test
• Statistical analysis
• Results
• Serologic test
• Lyme urine antigen test
• Discussion
• References
Laboratory testing for Lyme disease is controversial because of problems with test
sensitivity and specificity, the lack of standardized reagents, and interlaboratory and
intralaboratory variability [1, 2, 3, 4 and 5]. We determined the reliability of a
serologic test and a urine test for Lyme disease, each performed in a reference
laboratory, in control subjects and patients with Lyme disease who had posttreatment
symptoms.
Material and methods
Study subjects
We studied 10 healthy control subjects who had never had Lyme disease and 21
patients with a history of acute Lyme disease, as defined by the Centers for Disease
Control and Prevention [6], who had chronic (>6 month’s duration) fatigue,
musculoskeletal pain, or neurocognitive impairment despite treatment with
recommended antibiotics. The study protocol was approved by the Human
Investigation Institutional Review Boards of New England Medical Center and New
York Medical College. All subjects gave written, informed consent.
Sample collection
Serum samples were obtained from all 21 patients and the 10 control subjects. One
aliquot was immediately analyzed; duplicate aliquots were frozen at −70°C and tested
within 6 months after collection.
Midstream clean-catch urine samples were collected from the 10 control subjects into
Vacutainer urine collection kits (Becton Dickinson, no. 36-4962) supplied by the
manufacturer of the Lyme urine antigen test (IGeneX, Palo Alto, California). Each
specimen was immediately aliquoted into five gray-top Vacutainer urine collection
tubes, agitated to mix the sample with the preservative, and either packaged on ice
and sent immediately for testing or stored at −70°C and tested within 6 months after
collection. Aliquots of each sample were assayed separately.
Frozen urine samples for offsite testing were packaged in insulated boxes containing
refrigeration packets and shipped by overnight courier. All duplicate samples were
sent blinded to the reference laboratories.
Serologic testing
Immunoglobulin G western blot assays for antibodies against Borrelia burgdorferi
antigens were performed at New England Medical Center. In all cases, the
immunoglobulin G Marblot strip test system kit (MarDx Diagnostics, Carlsbad,
California) was used according to the manufacturer’s instructions. As recommended
by the Centers for Disease Control and the Second National Conference on Serologic
Diagnosis of Lyme Disease [7], strips that had 5 or more of the 10 significant bands
were considered positive for specific immunoglobulin G antibody to B. burgdorferi.
Lyme urine antigen test
Urine testing was performed by IgeneX, the manufacturer of the Lyme urine antigen
test. This test is based on an antigen capture-inhibition enzyme-linked immunosorbent
assay that uses adsorbed polyclonal antibodies that bind to several antigenic moieties
(31kDa, 34 kDa, 39 kDa, and 93kDa) of B. burgdorferi [8]. The test results are
interpreted according to the antigen level in the sample: negative, <20 ng/mL;
borderline, 20 to 31 ng/mL; positive, 32 to 45 ng/mL, and highly positive, >45 ng/mL.
Statistical analysis
Between-sample agreement was assessed with the kappa statistic for categories and
the intraclass correlation for numeric values [9]. Kappa values >0.75 indicated
excellent agreement; values <0.40 indicated poor agreement.
Results
Serologic test
In all 10 control subjects, the initial western blot analysis yielded negative results. In
three of four duplicate specimens analyzed, the same immunoreactive bands seen in
the original aliquot were present; 1 duplicate specimen contained a 41-kDa band that
was not present in the original aliquot.
In the 21 patients with Lyme disease, the results of the initial western blot analysis
were positive in 14 cases and negative in 7. Analysis of duplicate specimens yielded
identical results in all 21 patients (κ = 1.0, Table 1). The same immunoreactive bands
identified in the first analysis were present in 7 of the 14 seropositive duplicate
samples; 5 samples had 1 additional band, and 2 samples had 2 additional bands.
Repeat testing of the 7 seronegative samples showed fewer than 5 reactive bands in all
samples.
Table 1. Western Blot Testing for Immunoglobulin G Antibodies to B. burgdorferi in 21 patients with
Posttreatment Symptoms of Lyme Disease legend
Lyme urine antigen test
The results of urine antigen testing in the 10 control subjects were not reliable (Table
2). The standard deviation of the antigen level in the five aliqots of each specimen
ranged from 18 to 150 ng/mL. According to the manufacturer, the maximal standard
deviation of a test result should be <9 ng/mL. The interpretation of these test results
was also unreliable. It ranged from negative to highly positive for 6 specimens, from
negative to positive for 1, from borderline to highly positive for 1, and from positive
to highly positive for 2. The multiple category (negative, borderline, positive, highly
positive) agreement was poor (κ = 0.10). Agreement was also poor when negative
results were compared with all other categories (κ = 0.12) and when negative and
borderline results together were compared with the other categories (κ = 0.18).
Table 2. Results of Lyme Urine Antigen Testing in 10 Control Subjects without Lyme Disease
Discussion
Nonculture-based testing is the mainstay for laboratory diagnosis of Lyme disease. In
patients with chronic symptoms of at least 6 months’ duration, the most appropriate
serologic test for prior infection with B. burgdorferi is the immunoglobulin G western
blot, which is recommended by the Centers for Disease Control as the final basis for
determination of seroreactivity [7]. In a 1997 review of serologic testing for Lyme
disease, there were no reports on the interlaboratory or intralaboratory consistency of
this test [10]. Our study showed that testing of duplicate serum specimens from 21
patients with Lyme disease and 10 healthy controls by a single reference laboratory
using a commercially available immunoglobulin G western blot kit gave 100%
concordant results for seroreactivity and highly reproducible results for the
identification of individual bands.
In contrast, Lyme urine antigen testing of 10 healthy control subjects gave
contradictory results on aliquots of the same specimen in 8 of 10 cases and yielded
consistently false-positive results in the other 2. At least one aliquot of each specimen
was falsely positive. IGeneX, the manufacturer of the test, claims a 3% false-positive
rate and a 95% ability to distinguish between a positive and negative population with
an antigen cut-off level of ≥32 ng/mL. Our results do not support these claims and
indicate that this test should not be used for the laboratory diagnosis of active or
suspected Lyme disease.
References
1. H. Hofmann, Lyme borreliosis—problems of serological diagnosis. Infection 24
(1996), pp. 470–472. Abstract-EMBASE | Abstract-MEDLINE | Order Document
2. S.L. Brown, S.L. Hansen and J.J. Langone, Role of serology in the diagnosis of
Lyme disease. JAMA 282 (1999), pp. 62–66. Abstract-MEDLINE | Order Document
| Full Text via CrossRef
3. L.L. Bakken, S.M. Callister, P.J. Wand and R.F. Schell, Interlaboratory comparison
of test results for detection of Lyme disease by 516 participants in the Wisconsin State
Laboratory of Hygiene/College of American Pathologists proficiency testing program.
J Clin Microbiol 35 (1997), pp. 537–543. Abstract-EMBASE | Abstract-MEDLINE |
Order Document
4. L.L. Bakken, K.L. Case, S.M. Callister et al., Performance of 45 laboratories
participating in a proficiency testing program for Lyme disease serology. JAMA 268
(1992), pp. 891–895. Abstract-MEDLINE | Abstract-EMBASE | Order Document
5. S.W. Luger and E. Krauss, Serologic tests for Lyme disease. Interlaboratory
variability. Arch Intern Med 150 (1990), pp. 761–763. Abstract-EMBASE | Order
Document
6. Centers for Disease Control and Prevention, Case definitions for infectious
conditions under public health surveillance: Lyme disease. MMWR 46 suppl RR-10
(1997), pp. 20–21.
7. Recommendations for test performance and interpretation from the Second
International Conference on Serologic Diagnosis of Lyme Disease. MMWR.
1995;44:590–591.
8. N.S. Harris and B.G. Stephens, Detection of Borrelia burgdorferi antigen in urine
from patients with Lyme borreliosis. J Spirochetal Tick-Borne Dis 2 (1995), pp. 37–
41.
9. J. Fleiss. Statistical Methods for Rates and Proportions, Wiley & Sons, New York
(1981).
10. P. Tugwell, D.T. Dennis, A. Weinstein et al., Laboratory evaluation in the
diagnosis of Lyme disease. Ann Intern Med 127 (1997), pp. 1109–1123. AbstractMEDLINE | Abstract-EMBASE | Order Document
*1 Supported by grants from the National Institute of Allergy and Infectious Diseases
(AI-65308) and from the Division of Research Resources supporting the General
Clinical Research Center (RR-00054) at New England Medical Center.
Correspondence should be addressed to Mark S. Klempner, MD, Department of
Medicine, New England Medical Center, 750 Washington Street, Boston,
Massachusetts 02111
The American Journal of Medicine
Volume 110, Issue 3 , 15 February 2001, Pages 217-219
Cardiovascular manifestations of Lyme disease • ARTICLE
American Heart Journal, Volume 122, Issue 5, November 1991, Pages 1449-1455
Jafna Cox and Mel Krajden
Abstract | Abstract + References
Intrathecal antibody production in a mouse model of
Lyme neuroborreliosis
Libin Li1, Kavitha Narayan1, Elena Pak1 and Andrew R. Pachner
,
Department of Neurosciences, University of Medicine and Dentistry of New Jersey–
New Jersey Medical School, 185 S. Orange Ave., Newark, NJ 07103, United States
Received 27 September 2005; accepted 21 November 2005. Available online 4
January 2006.
Abstract
Intrathecal antibody (ITAb) production is a common feature of neurological diseases,
yet very little is known about its mechanisms. Because ITAb is prominent in human
Lyme neuroborreliosis (LNB), in the present study we established a mouse model of
LNB to study ITAb production.
We injected different strains of Borrelia burgdorferi into a variety of mouse strains by
the intracerebral (i.c.) route to develop the model. Spirochetal infection and ITAb
production were identified by complementary methods. This study demonstrates that
the mouse model of LNB can be utilized to test hypotheses related to the mechanisms
of ITAb production.
Keywords: Antibody; Lyme ; Intrathecal
Article Outline
1. Introduction
2. Materials and methods
2.1. Spirochetes
2.2. Mice
2.3. Antibody quantitation by enzyme-linked immunosorbent assay (ELISA)
2.4. Antibody deposition in brain parenchyma by immunoblotting
2.5. RNA isolation, reverse transcription (RT) and real-time reverse transcription–
polymerase chain reaction (RT–PCR)
2.6. Quantitation of spirochetes in tissue by 16S RNA TaqMan RT–PCR
2.7. IgG RT–PCR for measurement of in situ antibody production
2.8. CXCL13 RT–PCR for measurement of in situ chemokine production
2.9. Number of antibody-secreting cells (ASCs) by ELISPOT and image analysis
2.10. Statistical analysis
3. Results
3.1. Experimental design
3.2. Quantitation of spirochetal infection
3.2.1. In naïve mice
3.2.2. In sensitized mice
3.3. Total IgG concentration in CSF and serum
3.3.1. After i.c. inoculation of naïve mice
3.3.2. After i.c. inoculation of sensitized mice
3.4. ITAb production of spirochete-specific IgG – measured by AI
3.4.1. WCS as antigen
3.4.2. DbpA as antigen
3.5. Antibody deposition in the brain
3.6. ITAb production of immunoglobulin as measured by in situ detection of IgG
expression using IgG RT–PCR
3.6.1. In naïve mice
3.6.2. In sensitized mice
3.7. Detection of ASCs by ELISPOT
3.7.1. Total ASCs
3.7.2. B. burgdorferi-specific ASCs
3.8. In situ detection of CXCL13 expression using RT–PCR
4. Discussion
Acknowledgements
References
1. Introduction
ITAb production is a hallmark of a variety of human CNS inflammatory and
infectious diseases, occurring in more than 90% of multiple sclerosis (MS) patients
and very frequently in chronic neurological infections such as Lyme
neuroborreliosis (LNB) (Kaiser et al., 1993, Andersson et al., 1994, Pachner et al.,
1998 and Yao et al., 2001). Several approaches have been used to study ITAb
production (Wilske et al., 1991 and Picha et al., 2000). The most commonly used
clinical measurement for ITAb production in infections of the CNS is that of assaying
cerebrospinal fluid (CSF). CSF and serum are analyzed for either total
immunoglobulin G (IgG) or antigen-specific IgG, and antibody index (AI), the
comparison of antigen-specific immunoglobulin present in CSF relative to serum, is a
standard measurement of ITAb (Steere et al., 1990, Kaiser and Lucking, 1993, Kaiser,
1995 and Picha et al., 2000) in clinical practice. However, given the fact that
deposited immunoglobulin is detected in both peripheral tissues during chronic
infection with Borrelia burgdorferi (Cadavid et al., 2003 and Pachner et al., 2004)
and neural tissues after ovalbumin infusion in the brain (Knopf et al., 1998), it is
possible that the immunoglobulin produced in the brain may reside in local
parenchyma and interstitial fluids and not appear in CSF. Thus, CSF analysis alone
might underestimate the magnitude of ITAb production.
Our understanding of humoral immunity within the brain is fragmentary. Although
some other basic mechanisms in neuroimmunology have been unraveled in the past
few decades, a grasp of mechanisms of B cell activation, recruitment, differentiation
and maintenance in CNS remains elusive (Reiber and Peter, 2001). Studies of rodent
models utilizing infection with neurotropic viruses suggest that only activated, but not
resting B cells, can infiltrate into the brain and induce local humoral immune
responses (Tyor and Griffin, 1993 and Tschen et al., 2002). There is also evidence
that peripheral lymphoid tissues, particularly in the deep cervical lymph nodes
(DCLNs), might be an integral component of CNS antigen delivery and B cell
priming (Knopf et al., 1998 and Harling-Berg et al., 1999). Knopf and his colleagues
proposed the following hypothesis: after CNS infection, antigens in the brain drain to
lymph nodes and are there presented to lymphocytes for priming. Activated B
lymphoblasts then migrate back into the brain and differentiate into antibodysecreting cells (ASCs) when encountering the same antigen. This scenario might be
accelerated if activated B cells already exist in the periphery.
In human LNB (Pachner and Steere, 1984) and its animal model in Rhesus manaques
(Pachner et al., 2001), chronic infection and inflammation usually occur in the
nervous system after the dissemination of the causative spirochete to the CNS. The
arm of the immune system primarily responsible for spirochetal clearance is the
humoral immune response (Johnson et al., 1986 and McKisic and Barthold, 2000), a
hypothesis supported by our previous report that in situ immunoglobulin and
chemokine (CXCL13) production were identified in the sites of infection within
tissues in the non-human primate (NHP) model (Narayan et al., 2005). These
immunologically active areas found in nonlymphoid tissues are called ectopic
germinal centers (Wolniak et al., 2004), and are related to the classic germinal center
in secondary lymphoid tissues. Interactions between the pathogen and humoral
immune response in the CNS need to be studied in greater depth.
To address these questions, we established a mouse model of LNB, developed novel
methods to measure ITAb production, and investigated the humoral mechanisms in
this model. B. burgdorferi was injected intracerebrally to induce a CNS infection in
various mouse strains. American or European strains of B. burgdorferi were used to
infect either naïve or sensitized mice, and the results of ITAb production were
compared among the strains. Mice with intracerebral (i.c.) inoculation of heat-killed
spirochetes or intradermal (i.d.) inoculation of the bacteria served as controls.
2. Materials and methods
2.1. Spirochetes
N40 and 297 are two Borrelia burgdorferi sensu stricto strains. N40 was originally
isolated from ticks, subsequently passaged in mice, and isolated from infected mouse
brain (Pachner and Itano, 1990); 297 is an American human CSF isolate (Goodman et
al., 1991 and Fung et al., 1994). Both Pli and Pbi belong to the subspecies Borrelia
garinii, and are CSF isolates from humans in Germany with LNB (Jauris-Heipke et al.,
1993).
Spirochetes were grown, counted, sonicated, and injected as previously described
(Pachner and Itano, 1990). Heat-killed spirochetes were prepared by incubating live
spirochetes in BSKII medium for 30 min at 57 °C. Heat-killed spirochetes were intact
but non-mobile under dark-field microscopy.
2.2. Mice
Outbred male Swiss–Webster mice were purchased from Taconic laboratories
(Germantown, NY). Inbred C3H/HeJ and C57BL/6 mice were from Jackson
Laboratories (Bar Harbor, ME). All mice were 4- to 8-week-old males, and were
housed in isolated cages in the Research Resource Facility. Mice were allowed to
adjust to the new environment for at least 1 week before infection.
Mice were inoculated with B. burgdorferi either intradermally or intracerebrally. Both
routes were reviewed and approved by the University Animal Care and Use
Committee. Mice were first anesthetized with intraperitoneal (i.p.) injection of Syntex
mouse cocktail (10 mg/ml ketamine, 1 mg/ml xylazine, 0.25 mg/ml acepromazine,
0.9% NaCl). I.d. injection was performed along the dorsal thoracic midline of mice, in
multiple aliquots, with a total volume of 0.2 ml BSKII medium containing 106
spirochetes. For i.c. injection, 20 μl BSKII medium containing 106 spirochetes were
injected using a 30-gauge needle. The needle was inserted 2 mm under the external
surface of scalp skin in the right hemisphere 1 mm away from the bregma. For
sensitization, mice were first inoculated by i.p. injection with B. burgdorferi whole
cell sonicate (WCS) (20 μg WCS in 200 μl PBS per mouse). Two weeks later, the
same mice were challenged by i.c. injection of the live agent.
Mouse CSF was obtained by cisternal puncture performed by a modification of
Ronald's method (DeMattos et al., 2002 and Fleming et al., 1983). After the animal
was anesthetized, meninges overlying the cisterna magna were exposed, and the
surrounding area was gently washed as clean as possible to prevent blood
contamination. The animal was then placed on a platform in an inverted position. A
30-gauge needle was used to puncture the arachnoid membrane covering the cisterna.
A polypropylene pipette was used to collect CSF by gentle pipetting. Depending on
the age, about 20–30 μl of CSF was obtained from each mouse. Blood was obtained
by cardiac puncture, and was allowed to clot to isolate sera. Perfusions were
performed with 30 ml of PBS per mouse to remove the remaining blood from tissues.
Brain, DCLNs, spleen, heart and bladder were collected in Fast Prep green tubes
(Savant Instruments Inc, Holbrook, NY), each containing 1 ml of Trizol (Life
Technologies, Grand Island, NY). Tissue samples were homogenized using the Fast
Prep System (Savant Instruments Inc.) and stored at − 80 °C for RNA isolation.
2.3. Antibody quantitation by enzyme-linked immunosorbent assay
(ELISA)
Both total IgG and B. burgdorferi-specific IgG were determined in CSF and sera by
ELISA as previously described (Pachner et al., 2002a). Capture ELISA was used to
quantitate total IgG. Donkey anti-mouse IgG (Jackson ImmunoResearch Laboratories,
West Grove, PA) was used as coating antibody, and horseradish peroxidaseconjugated donkey anti-mouse IgG (Jackson) was used as detecting antibody. A
purified murine IgG (Jackson) was serially diluted as a standard positive control on
each plate. In quantitation of IgG specific for spirochete, coating antigens used in the
experiments included B. burgdorferi WCS and decorin binding protein A (DbpA).
To determine ITAb production, a serum sample with positive specific IgG response
was serially diluted and used as reference standard on each plate. Using the upper titer
as 100 units of IgG reactivity to the antigen, a linear standard curve was generated.
Each sample was assigned an activity of arbitrary units (AU) according to the
standard curve. Total IgG in sera and corresponding CSF were diluted to the same
levels before anti-B. burgdorferi AU were determined. AI = AUCSF/AUserum.
2.4. Antibody deposition in brain parenchyma by immunoblotting
Immunoblotting was performed as previously described (Cadavid et al., 2003). In
brief, samples were collected, after thorough perfusion, from the mouse brain
ipsilateral and contralateral to the injecting site. Cell lysis and protein extraction were
performed using CelLytic MT (Sigma Saint Louis, MS). Protein concentrations were
determined with the bicinchoninic acid protein assay (Pierce, Rockford, IL). Dot blots
were prepared by spotting 0.3 to 3 μg in duplicate from each protein extract onto
polyvinylidene difluoride membranes (BioRad, Hercules, CA). Goat anti-mouse
polyvalent Ig (Sigma, 1:5000) and alkaline phosphatase-conjugated rabbit anti-goat
IgG (Sigma, 1:5000) were used as primary and secondary antibodies respectively. A
mouse IgG1 from the hybridoma line CRL-1605 (ATCC, Manassas, VA) and normal
brain samples served as positive and negative control respectively. After incubation in
fluorescence substrate enzyme-catalyzed fluorescence (Amersham Life Science,
Piscataway, NJ) for 5 min, the membranes were scanned with a Typhoon 8600
scanner (Amersham). The results were analyzed by densitometry and were expressed
as relative expression of ratios to normal brain.
2.5. RNA isolation, reverse transcription (RT) and real-time reverse
transcription–polymerase chain reaction (RT–PCR)
These methods were performed as previously described (Pachner et al., 2004, Bai et
al., 2004, Cadavid et al., 2003 and Pachner et al., 2002b). In brief, total RNA was
isolated from frozen tissue samples using the Trizol One Step Isolation method, and
was incubated with DNAse. RT was performed in a Gene Amp PCR system 9700
(Perkin-Elmer Applied Biosystems, Foster City, CA). TaqMan RT–PCR was
performed in an ABI 7000 Sequence Detection System (PE Applied Biosystems).
2.6. Quantitation of spirochetes in tissue by 16S RNA TaqMan RT–PCR
Spirochetes in mouse tissues were quantitated using TaqMan RT–PCR as previously
described. The 16S ribosomal of B. burgdorferi, found in all strains, was used as a
target (Barbour et al., 1996, Wilske et al., 1992, Dever et al., 1992, Pachner et al.,
2004 and Cadavid et al., 2003). For quantification of the spirochetal load in tissues,
N40 spirochetes were cultured in vitro and the concentration was determined by
counting under microscope. A solution with 106/ml spirochetes was then serially
prepared with log10 dilutions, including a fresh medium as negative controls. Each
diluted sample with known numbers of spirochetes was added to 100 mg of fresh
brain tissues from noninfected mice and RNA was extracted from the mixtures.
cDNA of these samples were run on each TaqMan test plate. A standard curve with a
linear range coefficient of 0.95 was obtained when the threshold cycle (CT) values of
the samples were plotted against known spirochetal concentration. Spirochetal load in
tissue was estimated by referring the CT values of experimental samples to the
standard curve. Results were expressed as estimated spirochetal numbers in each 100
mg tissue. Mouse GAPDH mRNA levels were used as a measure of RNA quality.
GAPDH CT values which were greater than the mean ± 2 standard deviation (S.D.) of
the CT values for the tissues in each assay were felt to be degraded and were not
included in data analysis. Using normal mouse brain as negative control samples,
mean ± 3 S.D. of calculated spirochetal number of these samples was used as a cut off
value for negative spirochetal load.
2.7. IgG RT–PCR for measurement of in situ antibody production
TaqMan RT–PCR was used to measure IgG mRNA expression in mouse tissues. This
assay was validated in our prior studies in vitro and in vivo system (Narayan et al.,
2005), in which the primers were derived from studies of IgG in baboons (Attanasio
et al., 2002). Since IgG1 is one of the subtypes for murine Lyme borreliosis
(Bockenstedt et al., 2003), we chose for our target sequence an IgG1 heavy chain
(AF542525 on GenBank) for IgG RT–PCR. Primer and fluorogenic probe sequences
are: upstream, CCTTGCATATGTACAGTCCCAGAA; downstream,
CAGAGTAATGGTGAGCACATCCTT; probe, 6FAM,
ATCTGTCTTCATCTTCCCCCCCAAAGCC–TAMRA. Mouse house keeping gene
GAPDH (upstream, GGGAAGCCCATCACCATCTT; downstream,
ACATACCCGGCCTC; probe, 6FAM,
AGCGAGACCCCACTAACATCAAATGGG–TAMRA) was run with IgG in each
test. IgG mRNA level was expressed as relative expression index of 2 to the power of
− ΔCT, where − ΔCT = − (CT, IgG − CT, GAPDH).
2.8. CXCL13 RT–PCR for measurement of in situ chemokine
production
In situ CXCL13 expression was determined by RT–PCR. Primer and probe sequences
are: upstream, AAATGTGAACTTGTAGCTCGTACTAACAA; downstream,
ATTTTGGAAGCCTGCGTTTTTAC; probe, 6FAM,
AGGTTTGCGATGGACTTCAGTTATTTTGCA–TAMRA.
2.9. Number of antibody-secreting cells (ASCs) by ELISPOT and image
analysis
We used ELISPOT to determine the ASCs in mouse tissues. Thorough perfusion was
performed before tissue collection as described above. For spleen, tissue pieces were
minced on frosted glass slides to obtain single cell suspensions. Ammonium chloride
was used to lyse red blood cells in splenocytes. For the brain and heart, Percoll
gradient procedures were used to isolate cerebral mononuclear cells (CMCs) as
described previously (Tschen et al., 2002). CMCs were then counted, diluted and
ELISPOT was performed according to manufacture's directions (KPL, Gaithersburg,
MD). The ELISPOT plates were air-dried overnight before image analysis (Guerkov
et al., 2003). Total ASCs were determined by using goat anti-mouse polyclonal
IgG + IgM (KPL) to coat the plates and using Biotinylated goat anti-mouse Ig
(Jackson) as detecting antibodies. B. burgdorferi WCS was used as coating antigen to
detect B. burgdorferi-specific ASCs.
We used a Series 1 Immunospot Image Analyzer (Cellular Technology, Cleveland,
OH) to evaluate spots generated in ELISPOT assay. The Analyzer initially captured
the images to an image file, following which the images were analyzed. A spot was
considered an ASC when its color density exceeded background limits set based on
the comparison between experimental and control wells, utilizing custom software
(Cellular Technology). Data were recorded as spots per well. Results were expressed
as number of ASCs in each mouse organ.
2.10. Statistical analysis
Differences in mean concentration or density between groups were compared for
statistical significance with Student's t test and Excel software. Statistical significance
was established at p < 0.05.
3. Results
3.1. Experimental design
Table 1 summarizes the experimental design of this study. We used different strains
of B. burgdorferi, including American sensu stricto and European B. garinii strains,
and a variety of mouse strains, both in- and outbred, to establish a mouse LNB model.
Heat-killed spirochetes were also used in control groups. I.c. as well as i.d. injections
were performed to infect mice. Infection of the brain and other tissues was
documented by detection of Borrelia rRNA by RT–PCR. The analyses for ITAb
production included: AI calculation, measurements of antibody deposition by
immunoblot, IgG mRNA by RT–PCR, and ASCs by ELISPOT. In some experiments,
sensitization of the peripheral immune system to spirochetal antigens before CNS
infection was performed as a means of hastening the kinetics of B cell activation, as
previously described (Knopf et al., 1998).
Table 1.
Experimental design
Group
Sensitized?
Mouse
straina
Route of
injection
Spirochete
live/heatkilled
Spirochete
strain
Analysesb
I-A
No
SW/C3/C57
i.c.
Live
N40/297
AI, 16S, IgG, E
I-B
No
SW
i.c.
Heat-killed
N40
AI, 16S, IgG
I-C
No
SW
i.d.
Live
N40
AI, 16S, IgG
I-D
No
SW
i.d.
Heat-killed
N40
AI, 16S, IgG
I-E
No
SW
i.c.
Live
Pli/Pbi
AI, 16S, IgG
II
Yes
C57
i.c.
Live
N40
AI, 16S, IgG, BLC, I, E
a
b
Mouse strain: SW = Swiss–Webster, C3 = C3H/HeJ, C57 = C57BL/6.
Analyses: AI = antibody index (CSF/sera); 16S = 16S RT–PCR for Borrelia quantitation; IgG = IgG
mRNA by RT–PCR; BLC = BLC mRNA by RT–PCR; I = immunoblotting assay for antibody
deposition analysis; E = ELISPOT for ASC detection.
3.2. Quantitation of spirochetal infection
3.2.1. In naïve mice
Spirochetal distribution was determined by real-time RT–PCR of the 16S Borrelial
rRNA in mouse tissues after inoculation. The concentration immediately after i.c.
injection of live spirochetes was approximately 105 spirochetes in each 100 mg tissue
(Table 2, Group I-A). Infection was then detected in other organs in the following
weeks, predominantly in the DCLNs, heart and bladder. Although most injected
spirochetes left the brain after 1 week, a low level of spirochetes were still detectable
3 weeks after injection. In contrast, heat-killed spirochetes injected intracerebrally
were eliminated from the mouse brain after 1 week (Table 2, Group I-B). When the
mice were inoculated with live spirochetes via the i.d. route, infection of the heart and
bladder resulted; no spirochetes could be detected in the brain (Table 2, Group I-C).
I.d. injection of heat-killed spirochetes resulted in no spirochetal accumulation in any
tissues (Table 2 Group I-D). Interestingly, the i.c. route resulted in earlier and higher
levels of spirochetes in the heart and bladder than the i.d. route. The i.d. route had
previously been shown to result in significantly greater disseminated infection than
the i.p. or intravenous (i.v.) routes (Pachner et al., 1992).
Table 2.
Spirochetal distribution in mouse organs after spirochetal inoculation
Group
I-A
I-B
I-C
Tissues
Weeks after inoculation
0
1
3
6
9
Brain
154,540 ± 11,922a
118 ± 12
86 ± 15
< 20b
< 20
DCLN
< 20
3339 ± 507
175 ± 25
< 20
< 20
Spleen
< 20
118 ± 19
105 ± 1
22 ± 10
< 20
Heart
53 ± 3
3085 ± 215
1374 ± 404
1569 ± 349
1147 ± 512
Bladder
< 20
2045 ± 155
861 ± 190
928 ± 279
698 ± 133
Brain
196,896 ± 39,893
46 ± 19
< 20
< 20
< 20
Heart
< 20
< 20
< 20
< 20
< 20
Bladder
< 20
< 20
< 20
< 20
< 20
Brain
< 20
20
< 20
< 20
< 20
Heart
< 20
< 20
1231 ± 691
1869 ± 387
291 ± 1
Group
I-D
I-E
II
Tissues
Weeks after inoculation
0
1
3
6
9
Bladder
20
58 ± 21
72 ± 44
140 ± 25
< 20
Brain
< 20
< 20
< 20
< 20
< 20
Heart
< 20
32
< 20
< 20
< 20
Bladder
< 20
< 20
< 20
< 20
< 20
Brain
27,935 ± 749
< 20
< 20
< 20
NDc
Heart
92 ± 0
156 ± 74
1419 ± 231
355 ± 138
ND
Bladder
< 20
211 ± 0
316 ± 76
< 20
ND
Brain
54,810 ± 4371
< 20
< 20
< 20
ND
Heart
< 20
< 20
< 20
< 20
ND
Bladder
< 20
< 20
< 20
< 20
ND
Spirochetal distribution in each 100 mg mouse tissues determined by real-time TaqMan PCR.
a
Numbers are the calculated spirochetal load referring to the standard curve, representing the mean of
two to six separated experiments for each time point ± standard error of the mean (S.E.M.). n > 4
animals per time point.
b
Cut off value for negative spirochetal load (see ""Materials and methods"").
c
ND = not done.
The American strains of Borrelia, N40 and 297, were more infective in mice than the
European strains Pli and Pbi. After injection, European strains were cleared from the
mouse brain and systemic tissues earlier than American strains (Table 2, Groups I-A
and I-E). This observation was also consistent with our previous report (Pachner et al.,
2004).
3.2.2. In sensitized mice
In Group II, mice were sensitized by i.p. injection with spirochetal WCS 2 weeks
before i.c. injection with live spirochetes. In this group, the spirochetes were cleared
from the mouse brain and systemic tissues earlier (Table 2, Group II), indicating
accelerated clearance of infection and prevention of dissemination.
3.3. Total IgG concentration in CSF and serum
3.3.1. After i.c. inoculation of naïve mice
Total IgG, quantitated by capture ELISA, increased more than 300% both in sera (Fig.
1A) and in CSF (Fig. 1B) of Group I-A mice. The combination of live spirochetes and
the i.c. route resulted in significantly higher IgG concentrations in both CSF and
serum than any other combination (p < 0.05). American strains induced a higher IgG
response than European strains.
(74K)
Fig. 1. Increased total IgG concentrations in mouse sera and CSF after spirochetal infection. Data
represent mean ± S.E.M. (A) Total IgG in sera of Group I mice. aTotal IgG was significantly higher in
Group I-A than in Group I-B, I-C, and I-D for each time point after infection. bTotal IgG was
significantly higher in Group I-E than in Group I-B, I-C, and I-D at week 6 after inoculation. (B) Total
IgG in CSF of Group I-A was significantly higher than in Groups I-B, I-C, and I-D mice. (C)
Accelerated IgG response in sera of Group II mice. *p < 0.05. n > 4 animals per time point.
3.3.2. After i.c. inoculation of sensitized mice
The increase in total IgG after infection was accelerated in sensitized animals relative
to that of naïve animals (Fig. 1C). While the IgG level continued to increase in naïve
mice after the second week of infection, sensitized mice reached a plateau 2 weeks
after i.c. infection and then started to decrease after 4 weeks.
3.4. ITAb production of spirochete-specific IgG – measured by AI
3.4.1. WCS as antigen
AI values were calculated from the CSF/serum quotients for antibody reactive to B.
burgdorferi WCS. The AI was < 0.6 when infection was systemic, as in Groups I-C
and I-D. Levels above 1.0 were consistent with ITAb production. This level of AI was
observed only in animal Group I-A (Fig. 2A), with the AI being 1.0 3 weeks after
infection, and then continuing to rise to a peak of 1.4. I.c. inoculation of European
strains also resulted in ITAb (AI > 1.0 at week 6).
(64K)
Fig. 2. Spirochete-specific IgG responses after spirochetal infection in mice, as expressed by AI. Data
represent mean ± S.E.M. (A) AI was analyzed in Group I mice using WCS as antigen. ITAb was
identified in Group I-A and I-E by elevated AI values. AI values were significantly higher in Group IA than in Group I-B, I-C, and I-D at week 3 and week 9. (B) AI was analyzed in Group II mice using
WCS as antigen. AI reached 1.0 at day 5 in sensitized mice, but at day 21 in naïve mice, indicating
accelerated ITAb production in sensitized mice. (C) AI was analyzed in Group I mice using DbpA as
antigen. AI > 1 was found at week 9 of Group I-A mice only. *p < 0.05. n > 4 animals per time point.
ITAb generation was accelerated in sensitized mice with AI values above 1 occurring
by 5 days after i.c. injection of spirochete. ITAb production persisted throughout the
duration of the experiments (i.e. 42 days) in these animals (Fig. 2B).
3.4.2. DbpA as antigen
DbpA, a lipoprotein of B. burgdorferi predominantly expressed in vivo (Cassatt et al.,
1998 and Pachner et al., 2002a) was tested in this model in order to determine
whether DbpA was a major antigen driving the intrathecal antibody response. As
predicted from previous data showing that DbpA is expressed in vivo and not during
in vitro growth, when recombinant DbpA was used in the ELISA to measure B.
burgdorferi-specific IgG, no anti-DBPA antibody was detected in mice inoculated
with heat-killed spirochetes (Fig. 2C, Group I-B and I-D). In contrast, an increasing
level of anti-DbpA antibody was observed in both serum and in CSF in animals
infected with live spirochetes. However, the magnitude of the AI for DbpA was not as
high as for WCS, indicating that DbpA does not appear to be a selectively important
antigen relative to other spirochetal antigens in driving the intrathecal antibody
response within the first few months of infection.
3.5. Antibody deposition in the brain
We used quantitative densitometry of fluorescent dot blots to determined whether
there were antibody deposited in the parenchyma of mouse brain, which may not
appear in CSF. The tissue samples were collected from the mouse brain 2 weeks after
i.c. infection, either on the injecting site (ipsilateral) or away from injecting site
(contralateral). The whole protein extracts were dot blotted and probed with IgGspecific antibodies. Fig. 3 showed the result of relative fluorescence of each dot
measured by densitometry. The amounts of IgG were 3.1 fold higher (p = 0.003) in
the infected brain tissue ipsilateral to injecting and 2.3 fold higher (p = 0.008) in
tissue contralateral to injecting site than in normal brain, respectively. This analysis
confirmed our hypothesis that antibody produced locally in the brain can be deposited
in parenchyma, and thus may not be measurable by analysis of the CSF compartment.
(25K)
Fig. 3. IgG deposition in perfused brain parenchyma from spirochetal-infected mice, as determined by
quantitative dot blot analysis. Bars represent standard error. Relative fluorescence of each dot was
measured by densitometry with a Typhoon 8600 scanner. Background readings were subtracted from
the density values of experimental samples. **P < 0.01 vs. normal brain by Student's t test.
3.6. ITAb production of immunoglobulin as measured by in situ
detection of IgG expression using IgG RT–PCR
3.6.1. In naïve mice
We also performed quantitative real-time RT–PCR to examine IgG mRNA levels
during the course of infection, an assay of IgG production in tissues validated in prior
studies in human and non-human primate Lyme neuroborreliosis (Narayan et al.,
2005). The data was expressed as a relative expression index (see detail in Materials
and methods).
In mice injected with live spirochetes via the i.c. route (Group I-A), IgG mRNA
increased in the brain about 2 weeks after inoculation, and remained elevated for
about 9 weeks post infection (p.i.) (Fig. 4A). IgG expression was also up-regulated in
nonneural tissues. In DCLNs, IgG production began increasing by 1 weeks p.i.,
plateaued, and then returned to baseline by week 6 (Fig. 4B), a process consistent
with the hypothesis of earlier immune activity in DCLNs than in the brain during
CNS infection. In contrast, spleen and heart IgG production remained elevated
through 14 weeks (Fig. 4C and D). As expected, IgG mRNA content in spleen and
lymph node at baseline, prior to infection, was substantially higher, by 3–4 logs, than
in brain or heart, since IgG expression is a feature of the baseline state in lymphoid,
but not non-lymphoid tissues.
(41K)
Fig. 4. IgG expression in tissues of Group IA mice after spirochetal infection. The organs tested include
(A) brain, (B) DCLN, (C) spleen and (D) heart. Open circles (○) represent relative IgG expression in
each mouse organ, expressed as 2− CT(IgG − GAPDH). Mean mRNA values are represented as horizontal
bars. n > 4 animals per group.
3.6.2. In sensitized mice
As with other measures of immunoglobulin production, IgG expression was
accelerated in infection of sensitized (Group II) mice (Fig. 5) relative to infection of
naïve (Group I) mice. In contrast to naïve mice in which elevated IgG mRNA was not
detected in the brain until 2 weeks after the i.c. injection, in sensitized mice, IgG
mRNA increased rapidly, and was elevated 5 days p.i.
(30K)
Fig. 5. IgG expression in the brain of Group II mice after spirochetal infection. Accelerated IgG upregulation was found in sensitized mice. Open circles (○) represent relative IgG expression in each
mouse brain, expressed as 2− CT(IgG − GAPDH). Mean mRNA values are represented as horizontal bars.
n > 4 animals per time point.
3.7. Detection of ASCs by ELISPOT
3.7.1. Total ASCs
We used ELISPOT to determine the number of ASCs in the tissues of sensitized and
naïve mice. Splenocytes and CMCs were isolated from infected as well as normal
tissues respectively, and their release of Ig was imaged and evaluated in the ELISPOT
assay. Fig. 6 gives an image result of spots generated from CMCs of infected and
normal brains. In sensitized animals, ASCs in the brain in the absence of i.c.
inoculation were nearly undetectable, but high numbers of ASCs were then detected
in the brain by day 7 (the first time point we measured after the i.c. infection), after
which the numbers declined (Table 3). ASC numbers in the spleen peaked with a
delay relative to the brain, with the maximal number observed at week 3. In infected
hearts of naïve animals, high level of ASCs persisted for the duration of the
experiment, i.e. 14 weeks, correlating with high concentration of spirochetes in this
target tissue throughout the course of infection.
(39K)
Fig. 6. ELISPOT results of ACSs in mouse brain. Spots caught by image system from each ELISPOT
plates, showing positive ACSs in infected brains (4 weeks after infection) vs. normal control in
duplicates.
Table 3.
Number of total ASCs in mouse tissues
Tissues
Weeks after i.c. infection
0
1
2
3
4
6
14
Tissues
Weeks after i.c. infection
Group II
Group I-A
0
1
2
3
4
6
14
Brain
8a
589
177
315
225
61
86
Spleen (×1000)
141
257
324
714
449
434
340
Heart
8
NDb
24
ND
ND
865
451
Total ASCs in mouse tissues determined by ELISPOT. Samples from Group II mice were used to
detect total ACSs in the brains and spleens; ACSs in the hearts were detected from mice without
sensitization. To obtain adequate CMCs, at least 4 brains were pooled from same group in each test.
Numbers represent total ACSs per organ.
a
Number represent total ACSs in each mouse organ.
b
ND = not done.
3.7.2. B. burgdorferi-specific ASCs
B. burgdorferi WCS was used as the antigen in the ELISPOT assay to determine the B.
burgdorferi-specific ASCs in the brain and spleen in sensitized mice. Table 4 showed
the percentage of ASCs producing Ig specific for the WCS of B. burgdorferi within
19 days after i.c. infection. There were no B. burgdorferi-specific ASCs found in the
brain prior to i.c. inoculation. The percentage then increased sharply and peaked at 1
week after i.c. infection. Only a small percentage of ASCs was B. burgdorferi-specific
in the spleen. The percentages in other nonneural organs, such as lymph nodes and
bone marrow, were also low (data not show).
Table 4.
The percentage of B. burgdorferi-specific ASC in the brain and spleen of sensitized mice
Tissues
Days after i.c. infection
0
6
11
13
19
Brain
0
45.3
21.7
18.6
17.2
Spleen
1.6
4.3
5.5
2.2
7.4
The percentage of ASCs that were B. burgdorferi-specific determined by ELISPOT. Samples from
Group II mice were used. n > 4 mice per time point.
3.8. In situ detection of CXCL13 expression using RT–PCR
CXCL13 is an important chemokine for specific anti-spirochetal immunity in target
tissues of Lyme borreliosis in the non-human primate (Pachner et al., 2002b and
Narayan et al., 2005). We next tested whether CXCL13 was involved in ITAb
production and IgG production in infected tissues by measuring CXCL13 expression
in infected mouse brains and hearts. In both naïve and sensitized animals after
infection, no significantly elevated CXCL13 mRNA levels were observed relative to
baseline expression. This finding was different from our prior findings in the nonhuman primate system in which infected tissues had very high levels of CXCL13.
In order to investigate these negative results in mice, we stimulated mouse
splenocytes with spirochetal WCS, a potent inducer in vitro expression of a variety of
cytokines (Habicht et al., 1991 and Wooten et al., 1996), and a stimulus markedly
increasing CXCL13 expression in human PBMCs (Narayan et al., 2005). CXCL13
mRNA levels in the mouse cells did not vary after stimulation, confirming the results
from the measurement of CXCL13 in vivo.
4. Discussion
The goal of this study was to establish a mouse model of ITAb production. Our
studies used a variety of techniques: ELISA to measure spirochete-specific antibody
in CSF, immunoblotting to detect antibody deposition in brain parenchyma, IgG RT–
PCR to measure in situ IgG expression in mouse brain, and ELISPOT to detect ASCs
in the brain. These studies confirm that ITAb production is a feature of murine
Lyme neuroborreliosis (mLNB), and the ITAb response is driven by the CNS
pathogen.
ITAb production is the most consistent diagnostic finding of neurological infectious
and inflammatory diseases, yet very little is known about it. To date, few rodent
models for CNS inflammation are suitable for the study of ITAb production. In the
most commonly used rodent model for neurological inflammation, EAE
(experimental allergic encephalomyelitis), ITAb production is not clearly
demonstrable: antibody present in the CSF is likely synthesized in the periphery, not
in the CNS (Whitacre et al., 1982, Whittaker and Whitacre, 1984, Gallo et al., 1989
and Rostrom et al., 2004). Although standard rodent models of Lyme disease have
been developed (Barthold et al., 1988, Barthold et al., 1993 and Pachner, 1990), and
inoculation of animals with B. burgdorferi usually results in chronic infection and
systemic involvement such as carditis and arthritis (Garcia-Monco et al., 1990,
Barthold et al., 1990, Moody and Barthold, 1991, Cadavid et al., 1994 and deSouza et
al., 1993), these models are not suitable to study ITAb production, because the CNS is
not usually infected after spirochete infection in the periphery. Our development of
this model in mice was prompted by the high incidence of ITAb production in human
LNB and the fact that mice infected intracerebrally with neurotrophic viruses have
provided good models of ITAb production (Tyor et al., 1992, Lin et al., 1999 and
Tschen et al., 2002). While viruses are difficult to clear once systemically
disseminated, B. burgdorferi is a treatable pathogen, capable of being cleared by
antibiotic treatment. Thus, mLNB is a potentially excellent model for addressing the
issues of interactions between ITAb production and the pathogen.
In order to optimize mLNB model for ITAb production, we first investigated the
conditions for chronic infection induced by the spirochetes. A surprising finding in
our study was that i.c. injection outperformed the i.d. route in leading to the maximal
dissemination and growth of spirochetes. This correlates with the antibody
quantitation results which demonstrated that the i.c. route resulted in higher systemic
levels of spirochete-specific antibodies (p < 0.05). This finding, that antigen or
pathogen delivered into the brain provokes a higher level of infection or a higher level
of anti-pathogen antibodies, has been previously seen with other antigens and
pathogens (Gordon et al., 1992, Kovacevic-Jovanovic et al., 1997 and Cserr et al.,
1992). Some variables other than route of infection did not substantially affect the
magnitude of ITAb production. Varying the mouse strains infected in this study did
not appear to affect the outcome. Since C57BL/6 and C3HeJ are very commonly used
strains in the murine models of Lyme disease (Barthold et al., 1993), we used these
two inbred mice, as well as outbred Swiss–Webster in this study, and comparable
spirochete distribution and ITAb production were found among these strains. Given
previous data that European strains of B. burgdorferi are more neuroinvasive than
American strains (Pachner et al., 2004, Lin et al., 2001 and van Dam et al., 1993), we
tried infecting mice with the European B. burgdorferi strains Pbi and Pli in this mouse
model, but direct injection of these strains into the brain did not produce a more
neuropersistent disease than the American strains.
I.c. injection of B. burgdorferi induced humoral immune responses not only in the
CNS but also in infected peripheral tissues such as heart, bladder, and in professional
immune organs such as the spleen, lymph nodes, and bone marrow. In all of these
tissues, the IgG produced during bacterial infection included antigen-specific antibody
as well as antibodies that had no specificity to the antigens. Studies on patients with
LNB have indicated that the intrathecally produced IgG fraction accounted for more
than 90% of total IgG in CSF (Reiber and Peter, 2001). In the blood compartment, in
contrast, total IgG might increase only a few percent in response to an infection. In
our mLNB model, however, serological results revealed over a 3-fold increase in total
IgG both in CSF and in blood. These data are consistent with the observation that B.
burgdorferi infection of mice induces polyclonal B cell activation, which results in
production of a broad array of antibodies (Schoenfeld et al., 1992, Yang et al., 1992
and Tai et al., 1994).
We detected ITAb production in mice initially by measurement of the antibody index,
AI. IgG AI is a standard measurement of ITAb production and is used in Europe as
the primary diagnostic assay for LNB (Hansen and Lebech, 1992) (Steere et al., 1990).
In our mouse model, the AI value was 1.4 at week 9 in Group I-A mice (Fig. 2A),
whereas in control groups this number was 0.3–0.7. Our data suggests that ITAb
synthesis occurred in mice with i.c. infection, while the antibody detected in CSF of
control mice was transferred passively from blood. The AI values induced by
spirochetal infection in the mouse brain are relatively lower than that of other models
(Knopf et al., 1998), likely due to the lack of persistence of large numbers of
spirochetes in the brain. We also noticed that the AI curves of intracerebrally infected
mice were still sloping up at week 9, and elevated IgG mRNA level persisted too.
This suggests that ITAb is not able to completely clear the brain of spirochetes and
low concentrations of B. burgdorferi or B. burgdorferi antigens are present
persistently to drive the antibody production in the brain. Our experimental procedure
for spirochetal distribution measurement may also have underestimated the actual
spirochetal load in the CNS. Our previous experiments found spirochete localized to
leptomeninges and duramater of non-human primates (Bai et al., 2004), areas which
we did not include in mouse tissue analysis because they are difficult to isolate. Our
results support the hypotheses about the importance of humoral immunity in virus
infection within the CNS in which low levels of virus persist in the brain during
chronic infection and drive antibody production (Ramakrishna et al., 2002, Tyor et al.,
1992 and Tyor and Griffin, 1993). More detailed study of long term spirochetal
infection is in progress in our laboratory. Since IgM has been reported as the
dominant intrathecal antibody class in LNB (Reiber and Peter, 2001), studies on IgM
in mLNB are in progress in the lab.
Our data suggest that analysis of CSF for AI significantly underestimates the degree
of ITAb production. Evidence comes from the immunoblotting results for antibody
deposition analysis in the brain. IgG deposited in the infected brain parenchyma is
significantly higher than in normal brain (p < 0.01), and the amount is highest in the
site of injection. This finding indicates that some IgG produced locally in the brain
may be deposited in brain parenchyma and would thus not be detected in CSF
analysis. This reasoning prompted us to develop new methods in the laboratory to
analyze ITAb production in the model. The Ig RT–PCR and the ELISPOT data from
our studies are highly consistent with the hypothesis that these direct measures are
more robust indicators of ITAb production than the indirect measurement of ITAb
production by CSF analysis. IgG mRNA level was up-regulated in the brain during
the early course of spirochetal infection, and started to drop off after 9 weeks. In the
systemic target organ of heart, in contrast, IgG mRNA kept increasing even after 14
weeks. The similar patterns of responses were also observed when ASCs were
detected by ELISPOT. These observations support our hypothesis that pathogen
drives the antibody responses in this mLNB model. The ELISPOT data also confirms
the results of Bergmann and Stohlman and co-workers (Tschen et al., 2002 and
Ramakrishna et al., 2002) who studied ITAb in mouse hepatitis virus infection. They
found ELISPOT to be an excellent measure of ITAb production, which developed
slowly over weeks. We detected a high percentage of ASCs specific to B. burgdorferi
WCS in the early phase of infection in the brain, indicating that an antigen-specific
humoral immune response is involved in pathogen clearance from the CNS. Further
studies in our laboratory will continue to use this sensitive technique to enumerate
antigen-specific ASCs, and to identify which isotypes are being produced. We also
are investigating whether measuring oligoclonal banding of CSF immunoglobulin
may be a better measure than AI for analysis of ITAb production.
Under normal circumstances of CNS infection, ITAb production can be a very slowly
developing process. Initial antigen processing within the brain is considered to be
poor, and lymphatic drainage from the brain into cervical lymph nodes is not highly
efficient (Cserr et al., 1992). Our studies in mLNB certainly were consistent with this,
with antibody production slowly increasing in animals naïve to the spirochete. It is
hypothesized that in animals with i.c. infection, an initial Th2-type antibody response
to CNS-derived antigen slowly develops first in cervical lymph nodes and spleen.
Antigen-specific B lymphoblasts from these lymph nodes then can traffic back into
CNS and develop their effector function (Knopf et al., 1998). Our data confirms
Knopf's previous observations that this immune process can be substantially
accelerated if the animal is preimmunized peripherally.
However, one finding we could not confirm in this murine study was the importance
of CXCL13 in the establishment of antibody production outside of lymphoid tissue in
Lyme borreliosis, which in the initial observation involved work in humans and
non-human primates (Narayan et al., 2005). Given our findings in mice, it appears
likely that mice and primates have different uses for this chemokine in chronic B.
burgdorferi infection.
Thus, ITAb production is a feature of mLNB, induced by i.c. infection. To our
knowledge, this is the first demonstration of ITAb in a mouse model by an agent other
than viruses. Our initial identification of ITAb by CSF measurement was confirmed
by the detection of parenchymal antibody, elevated IgG expression and ASCs in the
brain. The cluster of ASCs in tissues other than peripheral lymphoid organs, called
ectopic germinal centers, has become increasingly recognized in a variety of
infectious and autoimmune diseases (Prineas, 1979, Salomonsson et al., 2003,
Magliozzi et al., 2004 and Narayan et al., 2005). The presence of certain cytokines
and chemokines necessary for B cell differentiation and lymphoid germinal center
maintenance is required for the formation of ectopic germinal center (Hjelmstrom,
2001 and Weyand and Goronzy, 2003). Work is ongoing in our laboratory to further
define the cellular and molecular requirements for sustained antibody production
within the nervous system.
Acknowledgements
This work was funded by the NIH-NIAID (NO1-AI 95358 to ARP). We thank Dr.
Cadavid for helpful discussions.
References
Andersson et al., 1994 M. Andersson, J. Alvarez-Cermeno, G. Bernardi, I. Cogato, P.
Fredman, J. Frederiksen, S. Fredrikson, P. Gallo, L.M. Grimaldi and M. Gronning et
al., Cerebrospinal fluid in the diagnosis of multiple sclerosis: a consensus report, J.
Neurol. Neurosurg. Psychiatry 57 (1994), pp. 897–902. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Attanasio et al., 2002 R. Attanasio, L. Jayashankar, C.N. Engleman and F.
Scinicariello, Baboon immunoglobulin constant region heavy chains: identification of
four IGHG genes, Immunogenetics 54 (2002), pp. 556–561. Abstract-EMBASE |
Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order Document | Full Text via
CrossRef
Bai et al., 2004 Y. Bai, K. Narayan, D. Dail, M. Sondey, E. Hodzic, S.W. Barthold,
A.R. Pachner and D. Cadavid, Spinal cord involvement in the nonhuman primate
model of Lyme disease, Lab. Invest. 84 (2004), pp. 160–172. Abstract-Elsevier
BIOBASE | Abstract-MEDLINE | Abstract-EMBASE | Order Document | Full Text
via CrossRef
Barbour et al., 1996 A.G. Barbour, C.J. Carter, V. Bundoc and J. Hinnebusch, The
nucleotide sequence of a linear plasmid of Borrelia burgdorferi reveals similarities to
those of circular plasmids of other prokaryotes, J. Bacteriol. 178 (1996), pp. 6635–
6639. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE |
Order Document
Barthold et al., 1988 S.W. Barthold, K.D. Moody, G.A. Terwilliger, R.O. Jacoby and
A.C. Steere, An animal model for Lyme arthritis, Ann. N.Y. Acad. Sci. 539 (1988),
pp. 264–273. Abstract-MEDLINE | Order Document
Barthold et al., 1990 S.W. Barthold, D.S. Beck, G.M. Hansen, G.A. Terwilliger and
K.D. Moody, Lyme borreliosis in selected strains and ages of laboratory mice, J.
Infect. Dis. 162 (1990), pp. 133–138. Abstract-EMBASE | Order Document
Barthold et al., 1993 S.W. Barthold, M.S. deSouza, J.L. Janotka, A.L. Smith and D.H.
Persing, Chronic Lyme borreliosis in the laboratory mouse, Am. J. Pathol. 143
(1993), pp. 959–972. Abstract-EMBASE | Order Document
Bockenstedt et al., 2003 L.K. Bockenstedt, M.C. Shanafelt, A. Belperron, J. Mao and
S.W. Barthold, Humoral immunity reflects altered T helper cell bias in Borrelia
burgdorferi-infected gamma delta T-cell-deficient mice, Infect. Immun. 71 (2003), pp.
2938–2940. Abstract-Elsevier BIOBASE | Abstract-EMBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Cadavid et al., 1994 D. Cadavid, D.D. Thomas, R. Crawley and A.G. Barbour,
Variability of a bacterial surface protein and disease expression in a possible mouse
model of systemic Lyme borreliosis, J. Exp. Med. 179 (1994), pp. 631–642.
Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Abstract-EMBASE | Order
Document | Full Text via CrossRef
Cadavid et al., 2003 D. Cadavid, Y. Bai, D. Dail, M. Hurd, K. Narayan, E. Hodzic,
S.W. Barthold and A.R. Pachner, Infection and inflammation in skeletal muscle from
nonhuman primates infected with different genospecies of the Lyme disease
spirochete Borrelia burgdorferi, Infect. Immun. 71 (2003), pp. 7087–7098. AbstractMEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Cassatt et al., 1998 D.R. Cassatt, N.K. Patel, N.D. Ulbrandt and M.S. Hanson, DbpA,
but not OspA, is expressed by Borrelia burgdorferi during spirochetemia and is a
target for protective antibodies, Infect. Immun. 66 (1998), pp. 5379–5387. AbstractMEDLINE | Order Document
Cserr et al., 1992 H.F. Cserr, C.J. Harling-Berg and P.M. Knopf, Drainage of brain
extracellular fluid into blood and deep cervical lymph and its immunological
significance, Brain Pathol. 2 (1992), pp. 269–276. Abstract-MEDLINE | Order
Document
DeMattos et al., 2002 R.B. DeMattos, K.R. Bales, M. Parsadanian, M.A. O'Dell, E.M.
Foss, S.M. Paul and D.M. Holtzman, Plaque-associated disruption of CSF and plasma
amyloid-beta (Abeta) equilibrium in a mouse model of Alzheimer's disease, J.
Neurochem. 81 (2002), pp. 229–236. Abstract-Elsevier BIOBASE | AbstractMEDLINE | Abstract-EMBASE | Order Document | Full Text via CrossRef
deSouza et al., 1993 M.S. deSouza, A.L. Smith, D.S. Beck, G.A. Terwilliger, E.
Fikrig and S.W. Barthold, Long-term study of cell-mediated responses to Borrelia
burgdorferi in the laboratory mouse, Infect. Immun. 61 (1993), pp. 1814–1822.
Abstract-MEDLINE | Order Document
Dever et al., 1992 L. Dever, J.H. Jorgensen and A.G. Barbour, In vitro antimicrobial
susceptibility testing of B. burgdorferi: a microdilution MIC method and time-kill
studies, J. Clin. Microbiol. 30 (1992), pp. 2692–2697. Abstract-EMBASE | AbstractMEDLINE | Order Document
Fleming et al., 1983 J. Fleming, J. Ting, S. Stohlman and L. Weiner, Improvements in
obtaining and characterizing mouse cerebrospinal fluid, J. Neuroimmunol. 4 (1983),
pp. 129–140. Abstract | Abstract + References | PDF (625 K)
Fung et al., 1994 B.P. Fung, G.L. McHugh, J.M. Leong and A.C. Steere, Humoral
immune response to outer surface protein C of Borrelia burgdorferi in Lyme
disease: role of the immunoglobulin M response in the serodiagnosis of early
infection, Infect. Immun. 62 (1994), pp. 3213–3221. Abstract-MEDLINE | AbstractEMBASE | Abstract-Elsevier BIOBASE | Order Document
Gallo et al., 1989 P. Gallo, D. Cupic, F. Bracco, L. Krzalic, B. Tavolato and L.
Battistin, Experimental allergic encephalomyelitis in the monkey: humoral immunity
and blood–brain barrier function, Ital. J. Neurol. Sci. 10 (1989), pp. 561–565.
Abstract-MEDLINE | Order Document | Full Text via CrossRef
Garcia-Monco et al., 1990 J.C. Garcia-Monco, B.F. Villar, J.C. Alen and J.L. Benach,
Borrelia burgdorferi in the central nervous system: experimental and clinical
evidence for early invasion, J. Infect. Dis. 161 (1990), pp. 1187–1193. AbstractEMBASE | Order Document
Goodman et al., 1991 J.L. Goodman, P. Jurkovich, C. Kodner and R.C. Johnson,
Persistent cardiac and urinary tract infections with Borrelia burgdorferi in
experimentally infected Syrian hamsters, J. Clin. Microbiol. 29 (1991), pp. 894–896.
Abstract-EMBASE | Abstract-MEDLINE | Order Document
Gordon et al., 1992 L.G. Gordon, P.M. Knopf and H.F. Cserr, Ovalbumin is more
immunogenic when introduced into brain or cerebrospinal fluid than into
extracerebral sites, J. Nueroimmunol. 40 (1992).
Guerkov et al., 2003 R.E. Guerkov, O.S. Targoni, C.R. Kreher, B.O. Boehm, M.T.
Herrera, M. Tary-Lehmann, P.V. Lehmann and S.K. Schwander, Detection of lowfrequency antigen-specific IL-10-producing CD4(+) T cells via ELISPOT in PBMC:
cognate vs. nonspecific production of the cytokine, J. Immunol. Methods 279 (2003),
pp. 111–121. SummaryPlus | Full Text + Links | PDF (382 K)
Habicht et al., 1991 G.S. Habicht, L.I. Katona and J.L. Benach, Cytokines and the
pathogenesis of neuroborreliosis: Borrelia burgdorferi induces glioma cells to secrete
interleukin-6, J. Infect. Dis. 164 (1991), pp. 568–574. Abstract-EMBASE | AbstractMEDLINE | Order Document
Hansen and Lebech, 1992 K. Hansen and A.M. Lebech, The clinical and
epidemiological profile of Lyme neuroborreliosis in Denmark 1985–1990. A
prospective study of 187 patients with Borrelia burgdorferi specific intrathecal
antibody production, Brain 115 (1992), pp. 399–423. Abstract-MEDLINE | Order
Document
Harling-Berg et al., 1999 C.J. Harling-Berg, T.J. Park and P.M. Knopf, Role of the
cervical lymphatics in the Th2-type hierarchy of CNS immune regulation, J.
Neuroimmunol. 101 (1999), pp. 111–127. SummaryPlus | Full Text + Links | PDF
(308 K)
Hjelmstrom, 2001 P. Hjelmstrom, Lymphoid neogenesis: de novo formation of
lymphoid tissue in chronic inflammation through expression of homing chemokines, J.
Leukoc. Biol. 69 (2001), pp. 331–339. Abstract-MEDLINE | Order Document
Jauris-Heipke et al., 1993 S. Jauris-Heipke, R. Fuchs, M. Motz, V. Preac-Mursic, E.
Schwab, E. Soutschek, G. Will and B. Wilske, Genetic heterogeneity of the genes
coding for the outer surface protein C (OspC) and the flagellin of Borrelia
burgdorferi, Med. Microbiol. Immunol. (Berl.) 182 (1993), pp. 37–50. AbstractMEDLINE | Abstract-EMBASE | Order Document
Johnson et al., 1986 R.C. Johnson, C. Kodner and M. Russell, Passive immunization
of hamsters against experimental infection with the Lyme disease spirochete, Infect.
Immun. 53 (1986), pp. 713–714. Abstract-EMBASE | Abstract-MEDLINE | Order
Document
Kaiser, 1995 R. Kaiser, Intrathecal immune response in patients with
neuroborreliosis: specificity of antibodies for neuronal proteins, J. Neurol. 242 (1995),
pp. 319–325. Abstract-MEDLINE | Abstract-EMBASE | Order Document | Full
Text via CrossRef
Kaiser and Lucking, 1993 R. Kaiser and C.H. Lucking, Intrathecal synthesis of
specific antibodies in neuroborreliosis. Comparison of different ELISA techniques
and calculation methods, J. Neurol. Sci. 118 (1993), pp. 64–72. Abstract | Abstract +
References | PDF (697 K)
Kaiser et al., 1993 R. Kaiser, C. Rasiah, G. Gassmann, A. Vogt and C.H. Lucking,
Intrathecal antibody synthesis in Lyme neuroborreliosis: use of recombinant p41
and a 14-kDa flagellin fragment in ELISA, J. Med. Microbiol. 39 (1993), pp. 290–297.
Abstract-EMBASE | Abstract-MEDLINE | Order Document
Knopf et al., 1998 P.M. Knopf, C.J. Harling-Berg, H.F. Cserr, D. Basu, E.J. Sirulnick,
S.C. Nolan, J.T. Park, G. Keir, E.J. Thompson and W.F. Hickey, Antigen-dependent
intrathecal antibody synthesis in the normal rat brain: tissue entry and local retention
of antigen-specific B cells, J. Immunol. 161 (1998), pp. 692–701. Abstract-MEDLINE
| Abstract-Elsevier BIOBASE | Abstract-EMBASE | Order Document
Kovacevic-Jovanovic et al., 1997 V. Kovacevic-Jovanovic, O. Laban, S. Stanojevic, T.
Miletic, M. Dimitrijevic and J. Radulovic, Changes in immunological and neuronal
conditions markedly altered antibody response to intracerebroventricularly injected
ovalbumin in the rat, Neuroimmunomodulation 4 (1997), pp. 181–187. AbstractEMBASE | Order Document
Lin et al., 1999 M.T. Lin, D.R. Hinton, N.W. Marten, C.C. Bergmann and S.A.
Stohlman, Antibody prevents virus reactivation within the central nervous system, J.
Immunol. 162 (1999), pp. 7358–7368. Abstract-MEDLINE | Abstract-EMBASE |
Abstract-Elsevier BIOBASE | Order Document
Lin et al., 2001 T. Lin, J.H. Oliver Jr., L. Gao, T.M. Kollars Jr. and K.L. Clark,
Genetic heterogeneity of Borrelia burgdorferi sensu lato in the southern United States
based on restriction fragment length polymorphism and sequence analysis, J. Clin.
Microbiol. 39 (2001), pp. 2500–2507. Abstract-Elsevier BIOBASE | AbstractMEDLINE | Abstract-EMBASE | Order Document | Full Text via CrossRef
Magliozzi et al., 2004 R. Magliozzi, S. Columba-Cabezas, B. Serafini and F. Aloisi,
Intracerebral expression of CXCL13 and BAFF is accompanied by formation of
lymphoid follicle-like structures in the meninges of mice with relapsing experimental
autoimmune encephalomyelitis, J. Neuroimmunol. 148 (2004), pp. 11–23.
SummaryPlus | Full Text + Links | PDF (913 K)
McKisic and Barthold, 2000 M.D. McKisic and S.W. Barthold, T-cell-independent
responses to Borrelia burgdorferi are critical for protective immunity and resolution
of Lyme disease, Infect. Immun. 68 (2000), pp. 5190–5197. Abstract-EMBASE |
Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order Document | Full Text via
CrossRef
Moody and Barthold, 1991 K.D. Moody and S.W. Barthold, Relative infectivity of
Borrelia burgdorferi in Lewis rats by various routes of inoculation, Am. J. Trop. Med.
Hyg. 44 (1991), pp. 135–139. Abstract-EMBASE | Abstract-MEDLINE | Order
Document
Narayan et al., 2005 K. Narayan, D. Dail, L. Li, D. Cadavid, S. Amrute, P. FitzgeraldBocarsly and A. Pachner, The nervous system as ectopic germinal center: CXCL13
and IgG in Lyme neuroborreliosis, Ann. Neurol. 57 (2005), pp. 813–823. AbstractMEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document |
Full Text via CrossRef
Pachner, 1990 A.R. Pachner, Neurological manifestations of Lyme disease, N. J.
Med. Rep. Transact. N. J. Med. Soc. 87 (1990), pp. 563–564.
Pachner and Itano, 1990 A.R. Pachner and A. Itano, Borrelia burgdorferi infection of
the brain: characterization of the organism and response to antibiotics and immune
sera in the mouse model, Neurology 40 (1990), pp. 1535–1540. Abstract-EMBASE |
Order Document
Pachner and Steere, 1984 A.R. Pachner and A.C. Steere, Neurological findings of
Lyme disease, Yale J. Biol. Med. 57 (1984), pp. 481–483. Abstract-EMBASE |
Abstract-MEDLINE | Order Document
Pachner et al., 1992 A.R. Pachner, E. Delaney and N.S. Ricalton, Murine Lyme
borreliosis: route of inoculation determines immune response and infectivity, Reg.
Immunol. 4 (1992), pp. 345–351. Abstract-EMBASE | Abstract-MEDLINE | Order
Document
Pachner et al., 1998 A.R. Pachner, H. Schaefer, K. Amemiya, D. Cadavid, W.F.
Zhang, K. Reddy and T. O'Neill, Pathogenesis of neuroborreliosis—lessons from a
monkey model, Wien Klin Wochenschr 110 (1998), pp. 870–873. Abstract-MEDLINE
| Abstract-EMBASE | Order Document
Pachner et al., 2001 A.R. Pachner, H. Gelderblom and D. Cadavid, The rhesus model
of Lyme neuroborreliosis, Immunol. Rev. 183 (2001), pp. 186–204. AbstractMEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Pachner et al., 2002a A.R. Pachner, D. Dail, L. Li, L. Gurey, S. Feng, E. Hodzic and S.
Barthold, Humoral immune response associated with Lyme borreliosis in
nonhuman primates: analysis by immunoblotting and enzyme-linked immunosorbent
assay with sonicates or recombinant proteins, Clin. Diagn. Lab. Immunol. 9 (2002),
pp. 1348–1355. Abstract-Elsevier BIOBASE | Abstract-EMBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Pachner et al., 2002b A.R. Pachner, D. Dail, K. Narayan, K. Dutta and D. Cadavid,
Increased expression of B-lymphocyte chemoattractant, but not pro-inflammatory
cytokines, in muscle tissue in rhesus chronic Lyme borreliosis, Cytokine 19 (2002),
pp. 297–307. Abstract | Abstract + References | PDF (345 K)
Pachner et al., 2004 A.R. Pachner, D. Dail, Y. Bai, M. Sondey, L. Pak, K. Narayan
and D. Cadavid, Genotype determines phenotype in experimental Lyme borreliosis,
Ann. Neurol. 56 (2004), pp. 361–370. Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Abstract-MEDLINE | Order Document | Full Text via CrossRef
Picha et al., 2000 D. Picha, L. Moravcova, E. Zdarsky and J. Benes, Clinical
comparison of immunoblot and antibody index for detection of intrathecal synthesis
of specific antibodies in Lyme neuroborreliosis, Eur. J. Clin. Microbiol. Infect. Dis.
19 (2000), pp. 805–806. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Order Document
Prineas, 1979 J.W. Prineas, Multiple sclerosis: presence of lymphatic capillaries and
lymphoid tissue in the brain and spinal cord, Science 203 (1979), pp. 1123–1125.
Abstract-MEDLINE | Abstract-EMBASE | Order Document
Ramakrishna et al., 2002 C. Ramakrishna, S.A. Stohlman, R.D. Atkinson, M.J.
Shlomchik and C.C. Bergmann, Mechanisms of central nervous system viral
persistence: the critical role of antibody and B cells, J. Immunol. 168 (2002), pp.
1204–1211. Abstract-Elsevier BIOBASE | Abstract-MEDLINE | AbstractEMBASE | Order Document
Reiber and Peter, 2001 H. Reiber and J.B. Peter, Cerebrospinal fluid analysis: diseaserelated data patterns and evaluation programs, J. Neurol. Sci. 184 (2001), pp. 101–122.
SummaryPlus | Full Text + Links | PDF (1001 K)
Rostrom et al., 2004 B. Rostrom, A. Grubb and R. Holmdahl, Oligoclonal IgG bands
synthesized in the central nervous system are present in rats with experimental
autoimmune encephalomyelitis, Acta Neurol. Scand. 109 (2004), pp. 106–112.
Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Abstract-EMBASE | Order
Document | Full Text via CrossRef
Salomonsson et al., 2003 S. Salomonsson, M.V. Jonsson, K. Skarstein, K.A. Brokstad,
P. Hjelmstrom, M. Wahren-Herlenius and R. Jonsson, Cellular basis of ectopic
germinal center formation and autoantibody production in the target organ of patients
with Sjogren's syndrome, Arthritis Rheum. 48 (2003), pp. 3187–3201. AbstractMEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Schoenfeld et al., 1992 R. Schoenfeld, B. Araneo, Y. Ma, L.M. Yang and J.J. Weis,
Demonstration of a B-lymphocyte mitogen produced by the Lyme disease pathogen,
Borrelia burgdorferi, Infect. Immun. 60 (1992), pp. 455–464. Abstract-MEDLINE |
Order Document
Steere et al., 1990 A.C. Steere, V.P. Berardi, K.E. Weeks, E.L. Logigian and R.
Ackermann, Evaluation of the intrathecal antibody response to Borrelia burgdorferi
as a diagnostic test for Lyme neuroborreliosis, J. Infect. Dis. 161 (1990), pp. 1203–
1209. Abstract-EMBASE | Order Document
Tai et al., 1994 K.F. Tai, Y. Ma and J.J. Weis, Normal human B-lymphocytes and
mononuclear cells respond to the mitogenic and cytokine-stimulatory activities of
Borrelia burgdorferi and its lipoprotein OspA, Infect. Immun. 62 (1994), pp. 520–528.
Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order
Document
Tschen et al., 2002 S.I. Tschen, C.C. Bergmann, C. Ramakrishna, S. Morales, R.
Atkinson and S.A. Stohlman, Recruitment kinetics and composition of antibodysecreting cells within the central nervous system following viral encephalomyelitis, J.
Immunol. 168 (2002), pp. 2922–2929. Abstract-MEDLINE | Abstract-EMBASE |
Abstract-Elsevier BIOBASE | Order Document
Tyor and Griffin, 1993 W.R. Tyor and D.E. Griffin, Virus specificity and isotype
expression of intraparenchymal antibody-secreting cells during Sindbis virus
encephalitis in mice, J. Neuroimmunol. 48 (1993), pp. 37–44. Abstract | Abstract +
References | PDF (675 K)
Tyor et al., 1992 W.R. Tyor, S. Wesselingh, B. Levine and D.E. Griffin, Long term
intraparenchymal Ig secretion after acute viral encephalitis in mice, J. Immunol. 149
(1992), pp. 4016–4020. Abstract-MEDLINE | Abstract-EMBASE | Order Document
van Dam et al., 1993 A.P. van Dam, H. Kuiper, K. Vos, A. Widjojokusumo, B.M. de
Jongh, L. Spanjaard, A.C. Ramselaar, M.D. Kramer and J. Dankert, Different
genospecies of Borrelia burgdorferi are associated with distinct clinical
manifestations of Lyme borreliosis, Clin. Infect. Dis. 17 (1993), pp. 708–717.
Abstract-MEDLINE | Order Document
Weyand and Goronzy, 2003 C.M. Weyand and J.J. Goronzy, Ectopic germinal center
formation in rheumatoid synovitis, Ann. N.Y. Acad. Sci. 987 (2003), pp. 140–149.
Abstract-MEDLINE | Abstract-EMBASE | Order Document
Whitacre et al., 1982 C.C. Whitacre, D.H. Mattson, E.D. Day, D.J. Peterson, P.Y.
Paterson, R.P. Roos and B.G. Arnason, Oligoclonal IgG in rabbits with experimental
allergic encephalomyelitis: non-reactivity of the bands with sensitizing neural
antigens, Neurochem. Res. 7 (1982), pp. 1209–1221. Abstract-MEDLINE | AbstractEMBASE | Order Document
Whittaker and Whitacre, 1984 K.M. Whittaker and C.C. Whitacre, Oligoclonal IgG in
Lewis rats with experimental allergic encephalomyelitis, Prog. Clin. Biol. Res. 146
(1984), pp. 335–340. Abstract-MEDLINE | Order Document
Wilske et al., 1991 B. Wilske, L. Bader, H.W. Pfister and V. Preac-Mursic,
[Diagnosis of Lyme neuroborreliosis. Detection of intrathecal antibody formation],
Fortschr. Med. 109 (1991), pp. 441–446. Abstract-MEDLINE | Order Document
Wilske et al., 1992 B. Wilske, A. Barbour, S. Bergstrom, N. Burman, B. Restrepo, P.
Rosa, T. Schwan, E. Soutschek and R. Wallich, Antigenic variation and strain
heterogeneity in Borrelia spp., Res. Microbiol. 143 (1992), pp. 583–596. Abstract |
Abstract + References | PDF (1118 K)
Wolniak et al., 2004 K.L. Wolniak, S.M. Shinall and T.J. Waldschmidt, The germinal
center response, Crit. Rev. Immunol. 24 (2004), pp. 39–65. Abstract-EMBASE |
Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document
Wooten et al., 1996 R.M. Wooten, V.R. Modur, T.M. McIntyre and J.J. Weis,
Borrelia burgdorferi outer membrane protein A induces nuclear translocation of
nuclear factor-kappa B and inflammatory activation in human endothelial cells, J.
Immunol. 157 (1996), pp. 4584–4590. Abstract-MEDLINE | Order Document
Yang et al., 1992 L. Yang, Y. Ma, R. Schoenfeld, M. Griffiths, E. Eichwald, B.
Araneo and J.J. Weis, Evidence for B-lymphocyte mitogen activity in Borrelia
burgdorferi-infected mice, Infect. Immun. 60 (1992), pp. 3033–3041. AbstractMEDLINE | Abstract-EMBASE | Order Document
Yao et al., 2001 S.Y. Yao, C.W. Stratton, W.M. Mitchell and S. Sriram, CSF
oligoclonal bands in MS include antibodies against Chlamydophila antigens,
Neurology 56 (2001), pp. 1168–1176. Abstract-MEDLINE | Abstract-EMBASE |
Abstract-Elsevier BIOBASE | Order Document
1
Corresponding author. Tel.: +1 973 972 7395; fax: +1 973 972 5059.
Tel.: +1 973 972 7395; fax: +1 973 972 5059. Journal of Neuroimmunology
Volume 173, Issues 1-2 , April 2006, Pages 56-68
Anaplasma phagocytophilum-infected neutrophils
enhance transmigration of Borrelia burgdorferiacross
the human blood brain barrier in vitro
E. Nyarkoa, D.J. Graba and J.S. Dumlerb,
,
a
Division of Infectious Diseases, Department of Pediatrics, The Johns Hopkins
University School of Medicine, Baltimore, MD, USA
b
Division of Medical Microbiology, Department of Pathology, The Johns Hopkins
University School of Medicine, 720 Rutland Avenue, Ross 624, Baltimore, MD
21205, USA
Received 6 November 2005; revised 20 January 2006; accepted 30 January
2006. Available online 6 March 2006.
Abstract
The manifestations of Lyme disease, caused by Ixodes spp. tick-transmitted Borrelia
burgdorferi, range from skin infection to bloodstream invasion into the heart, joints
and nervous system. The febrile infection human granulocytic anaplasmosis is caused
by a neutrophilic rickettsia called Anaplasma phagocytophilum, also transmitted by
Ixodes ticks. Previous studies suggest that co-infection with A. phagocytophilum
contributes to increased spirochetal loads and severity of Lyme disease. However, a
common link between these tick-transmitted pathogens is dissemination into blood or
tissues through blood vessels. Preliminary studies show that B. burgdorferi binds and
passes through endothelial barriers in part mediated by host matrix metalloproteases.
Since neutrophils infected by A. phagocytophilum are activated to release bioactive
metalloproteases and chemokines, we examined the enhanced B. burgdorferi
transmigration through vascular barriers with co-infection in vitro. To test whether
endothelial transmigration is enhanced with co-infection, B. burgdorferi and A.
phagocytophilum-infected neutrophils were co-incubated with EA.hy926 cells
(HUVEC-derived) and human brain microvascular endothelial cells in Transwell™
cultures. Transmigration of B. burgdorferi through endothelial cell barriers was
determined and endothelial barrier integrity was measured by transendothelial
electrical resistivity. More B. burgdorferi crossed both human BMEC and EA.hy926
cells in the presence of A. phagocytophilum-infected neutrophils than with uninfected
neutrophils without affecting endothelial cell integrity. Such a mechanism may
contribute to increased blood and tissue spirochete loads.
Keywords: Lyme disease; Borrelia burgdorferi; Anaplasma phagocytophilum;
Endothelial cells; Neutrophils; Co-infection
Article Outline
1. Introduction
2. Materials and methods
2.1. Cultivation and preparation of cell-free A. phagocytophilum
2.2. Preparation of A. phagocytophilum-infected neutrophils
2.3. Spirochetes
2.4. Human brain microvascular endothelial cells (human BMEC)
2.5. Human systemic endothelial cells
2.6. Endothelial monolayer transmigration assay
2.7. Quantitative PCR
2.8. Statistical tests
3. Results
3.1. Effects of co-incubation of B. burgdorferi with A. phagocytophilum-infected
neutrophils on the integrity of endothelial cell barriers
3.2. Borrelia burgdorferi traversal of endothelial cells in the presence of A.
phagocytophilum infected-neutrophils or uninfected neutrophils
4. Discussion
5. Uncited references
Acknowledgements
References
1. Introduction
Lyme disease is now the most frequently reported arthropod-borne infection in
North America and Europe (CDC, 2002). The bacteria, Borrelia burgdorferi, which
are transmitted to humans by the bite of infected ticks of the Ixodes persulcatus
complex, can infect many tissues including the skin, heart, joints, eye and in addition,
the peripheral and central nervous systems (Steere, 1989 and Kalish, 1993). As the
diversity of clinical presentations for Lyme disease has been recognised, it has been
suggested that concurrent infections by other tick-borne pathogens may influence the
natural course of disease, leading to more severe infection, persistence, even
refractoriness to effective therapies (Belongia, 2002 and Krause et al., 2002).
Anaplasma phagocytophilum, the causative agent of human granulocytic
anaplasmosis (HGA) is also transmitted by I. persulcatus-complex tick bites and
accumulating data suggest that co-infection is not infrequent. In North America and
also in Europe, approximately 10% of all patients with Lyme disease or HGA have
evidence of co-infection with other pathogens (Thompson et al., 2001). Although it is
unclear whether co-infections contribute to the comorbidity, in mice commitment of
immunity toward Th1 reactions directed against the obligate intracellular A.
phagocytophilum allows higher spirochetemia, tissue loads, longer persistence and
increased disease with simultaneous B. burgdorferi infections (Thomas et al., 2001).
Penetration into the blood and out of the bloodstream into sites of infection is a
necessary component for dissemination of pathogens of Lyme disease and HGA,
hence interactions of both pathogens at the level of blood–endothelial cell interface
are critical determinants of dissemination and disease. Borrelia burgdorferi
penetration of endothelial cells results in part from the actions of endothelial cellderived metalloproteases, after binding of spirochetes to intracellular junctions.
Anaplasma phagocytophilum-infected neutrophils are induced for protracted
degranulation, resulting in the elaboration of biologically active molecules, including
chemokines, cytokines and metalloproteases (Choi et al., 2003). Owing to the
production of metalloproteases from A. phagocytophilum-infected neutrophils, we
hypothesised that concurrent infection with B. burgdorferi enhances penetration of the
spirochete through blood–brain barrier (BBB) and systemic endothelial cell barriers.
We tested this non-immunological mechanism using in vitro models of the human
BBB and systemic endothelial cells.
2. Materials and methods
2.1. Cultivation and preparation of cell-free A. phagocytophilum
The A. phagocytophilum strain Webster was cultivated in HL-60 cells in RPMI 1640
medium (GIBCO-BRL) supplemented with 5% FCS and 2 mM L-glutamine (GIBCOBRL) at 37 °C (Choi et al., 2003; Choi and Dumler, 2004). Cell-free A.
phagocytophilum was prepared by sonication of heavily infected HL-60 cells
(Branson Sonifier, VWR Scientific) at duty cycle of 70 and output control of 3 (Choi
et al., 2003 and Garyu et al., 2005). These bacteria were washed and used
immediately to infect 5×105 to 106 human peripheral blood neutrophils. Mockinfected cells were incubated with medium only.
2.2. Preparation of A. phagocytophilum-infected neutrophils
Human peripheral blood neutrophils and monocytes were isolated from EDTAanticoagulated blood of healthy donors by dextran sedimentation followed by Ficoll
density gradient centrifugation (Histopaque; Sigma). The contaminating residual
erythrocytes present in the neutrophil preparations were lysed by exposure to
hypotonic saline (0.2% NaCl) for 30 s and then adjusted back to isotonic conditions
with hypertonic saline (1.8% NaCl) prior to washing in tissue culture medium.
Neutrophil purity was confirmed to be ≥95% by Ramanowsky staining (Hema-3;
Biochemical Sciences, Inc., Swedesboro, NJ), and the viability of cells was
determined to be >98% by trypan blue dye exclusion. Human neutrophils were
obtained with the approval of the Johns Hopkins University School of Medicine
Institutional Review Board and in compliance with all relevant federal guidelines and
institutional policies. Some of the neutrophils were suspended in medium M199
supplemented in 20% FCS and then incubated at 37 °C in 5% CO2 in a humidified
environment.
2.3. Spirochetes
Low-passage (less than five in vitro passages) B. burgdorferi was cultured at 34 °C in
BSK II medium containing 10% rabbit serum as described by Barbour (1984). In our
study, we used B. burgdorferi 297, a strain originally isolated from human
cerebrospinal fluid (Leveris et al., 1995). The bacteria were examined for motility
with dark-field microscope to verify viability and that the organisms were thoroughly
dispersed at the start of all the assays.
2.4. Human brain microvascular endothelial cells (human BMEC)
Human BMEC primary cultures used in this study were described previously
(Persidsky et al., 1997 and Stins et al., 1997; Grab et al., 2004 and Grab et al., 2005).
The cells were cultured in Medium 199 (GIBCO) supplemented with 20% heatinactivated FCS and 1×Glutamax (GIBCO). The cells were grown to confluence on
6.5-mm-diameter collagen-coated Costar inserts with a pore of size of 3.0 μm until
transendothelial electrical resistance (TEER) measurements exceeded 25 Ω×cm2
(Grab et al., 2004).
2.5. Human systemic endothelial cells
The EAhy926 endothelial cell line derived from fusion of A549 cells with primary
human umbilical vein endothelial cells have also been described previously (Edgell et
al., 1983). These were grown in high-glucose (4.5 g/l) DMEM supplemented with
20% heat-inactivated FCS, 1×HT supplement and 1×Glutamax (all from GIBCO).
The cells were grown to confluence on 6.5-mm-diameter collagen-coated Costar
Transwell™ inserts with a pore of size of 3.0 μm until transendothelial electrical
resistance reached stable values <12 Ω×cm2 (Grab et al., 2004).
2.6. Endothelial monolayer transmigration assay
Triplicate wells with and without endothelial cells received the following: medium
only; B. burgdorferi only (ranging from 2×105 to 107); uninfected neutrophils only
(2×105); A. phagocytophilum-infected neutrophils only (2×105); B. burgdorferi (2×105
to 107) and uninfected neutrophils (2×105); B. burgdorferi (2×105 to 107) and A.
phagocytophilum-infected neutrophils (2×105). After 5 h incubation, the TEER was
re-measured and aliquots were removed from the wells beneath the inserts. The
quantity of transmigrating B. burgdorferi was determined for each well by either
dark-field counting in a haemocytometer for initial experiments and then by
quantitative PCR for subsequent experiments. The net transmigration of each barrier
was calculated as a percentage of the number of spirochetes that crossing inserts with
cells relative to the number crossing inserts without endothelial cells.
2.7. Quantitative PCR
Borrelia burgdorferi DNA in transmigrated culture medium (below Transwells) was
prepared using either the GenoM-48 DNA robot or using the Qiagen DNA extraction
kit, both according to the manufacturers' instructions. Borrelia burgdorferi
quantification was performed using quantitative real-time PCR targeting the single
copy chromosomal flaB gene (Leutenneger et al., 1999) using the primers B.398f
(GGGAAGCAGATTTGTTTGACA) and B.484r
(ATAGAGCAACTTACAGACGAAATTAATAGA) with the fluorescent probe
B.421p (FAM- ATGTGCATTTGGTTATATTGAGCTTGATCAGCAA-TAMRA).
Amplifications were performed using either an ABI Taqman 7700 or a BioRad
iCycler iQ5 Multicolor Real Time PCR detector. For standard curve, the flaB gene
amplicon was cloned, plasmid DNA containing the insert was prepared and the DNA
concentration was carefully measured to allow a precise determination of the copy
number of flaB in each standard. Final concentrations of transmigrated B. burgdorferi
were determined using the CT method as per software of the Taqman or iQ5
instruments.
2.8. Statistical tests
Where appropriate, means of transmigration or TEER values were compared using
one-tailed, unpaired or paired Student's t-tests; a P-value <0.05 was considered
significant.
3. Results
3.1. Effects of co-incubation of B. burgdorferi with A.
phagocytophilum-infected neutrophils on the integrity of endothelial
cell barriers
The integrity of EAhy.926 and the human BMEC barriers after co-incubation of B.
burgdorferi with uninfected neutrophils or A. phagocytophilum-infected neutrophils
was similar as measured by TEER (P=0.216; Fig. 1). However, when all of these
conditions were compared with EAhy.926 cells incubated with medium only, there
was a small but significant reduction in TEER at 5 h (P=0.018).
(17K)
Fig. 1. Change in transendothelial electrical resistance of human brain microvascular endothelial cells
and EA.hy926 endothelial cell cultures after incubation with Borrelia burgdorferi (Bb) and neutrophils
or Anaplasma phagocytophilum (Ap)-infected neutrophils.
3.2. Borrelia burgdorferi traversal of endothelial cells in the presence of
A. phagocytophilum infected-neutrophils or uninfected neutrophils
Borrelia burgdorferi transmigration of human BMEC was enhanced in the presence
of A. phagocytophilum-infected neutrophils as compared with uninfected neutrophils.
We conducted three replicated experiments. When 107 B. burgdorferi was used as
inoculum, approximately two-fold enhanced transmigration of B. burgdorferi across
the human BMEC was observed in the presence of A. phagocytophilum infectedneutrophils compared with uninfected neutrophils (P<0.045; Fig. 2). Incubation with
lower spirochete numbers (2×105) revealed that three-fold (6.7 vs. 2.2%) more B.
burgdorferi transmigrated the human BMEC in the presence of A. phagocytophiluminfected neutrophils (P=0.047) and this result was confirmed in a parallel experiment
(Fig. 3). No enhanced transmigration through the EAhy.926 systemic endothelial cell
barriers was observed with A. phagocytophilum-infected neutrophils vs. uninfected
neutrophils (P=0.426).
(16K)
Fig. 2. Borrelia burgdorferi (Bb) transmigration of human brain microvascular endothelial cells
monolayers with and without A. phagocytophilum (Ap)-infected neutrophils at 5 h quantitated by
dark-field microscopy.
(21K)
Fig. 3. Borrelia burgdorferi (Bb) transmigration of endothelial cell monolayers with and without A.
phagocytophilum (Ap)-infected neutrophils at 5 h. Transmigrated spirochetes were quantitated by real
time PCR (Taqman) targeting the single copy chromosomal target flaB. Significant P values are shown
comparing relevant bars.
4. Discussion
While B. burgdorferi occasionally penetrates through the blood–brain barrier to cause
infection in the central nervous system, including infection such as meningitis, A.
phagocytophilum does not (Bakken and Dumler, 2000). However, co-infection of
humans with B. burgdorferi and A. phagocytophilum is increasingly recognised and
animal models suggest that spirochete titres and tissue injury are exacerbated with coinfection (Thomas et al., 2001, Thompson et al., 2001 and Belongia, 2002).
Immunologic control of B. burgdorferi infection, in the absence of other co-infections,
probably requires the active participation of both Th1 and Th2 responses (Thomas et
al., 2001). The mechanism(s) that account for the increased borrelia loads and tissue
inflammation with A. phagocytophilum co-infection is uncertain, although some
studies imply the inappropriate induction of Th1 immunity that is effective for
obligate intracellular pathogens, but may alter control of B. burgdorferi (Thomas et al.,
2001). Our previous studies showed that B. burgdorferi transmigrate endothelial cell
barriers, including the BBB, in part via the action of endothelial cell-derived matrix
metalloproteases (MMPs) (Grab et al., 2005). With A. phagocytophilum infection,
neutrophils are stimulated to degranulate a variety of vesicular components, including
matrix metalloproteases (Choi et al., 2004). In fact, A. phagocytophilum-infected
neutrophils do not adhere to activated endothelial cells because of the secretion of a
sheddase metalloprotease that cleaves neutrophil surface platelet selectin glycoprotein
ligand (PSGL-1, CD162), and because of MMP-induced loss of L-selectin (CD62L)
(Choi et al., 2003).
Based upon this information, we hypothesised that co-infection with both B.
burgdorferi and A. phagocytophilum can result in increased exposure of endothelial
cell barriers to MMPs would enhance B. burgdorferi penetration into tissues or the
CNS. In keeping with this hypothesis, our results in three repeated experiments,
measured by two different approaches, confirm that B. burgdorferi transmigrate
across endothelial cells more in the presence of A. phagocytophilum-infected
neutrophils than with uninfected neutrophils, even in the absence of any adaptive
immune responses (in vitro).
Although the most likely explanation for these observations is the production of
metalloproteases, there are several additional possibilities that will require further
investigation. First, A. phagocytophilum-infected neutrophils are markedly activated
for production of chemokines and IL-6 (Klein et al., 2000; Choi et al., 2005). These
biologically active compounds have multiple effects, including the potential to
enhance changes in vascular permeability, perhaps related to alterations in the
endothelial cell cytoskeleton. Second, A. phagocytophilum infection of neutrophils
impairs their phagocytic capacity, and this could result in an increased availability of
B. burgdorferi to transmigrate (Garyu et al., 2005). Regardless, the combined effects
of enhanced protease, cytokine/chemokine release and impaired neutrophil
phagocytosis with co-infection could lead to enhanced CNS entry of B. burgdorferi
and worsened clinical manifestations of Lyme disease. Precedent for such enhanced
clinical disease in the CNS exists in sheep infected with louping ill virus, a
concurrently tick-transmitted flavivirus of the tick-borne encephalitis group. Louping
ill virus alone initiates a mild clinical disease in sheep (Brodie et al., 1986 and Reid et
al., 1986,); however, with A. phagocytophilum infection, louping ill virus typically
results in severe or fatal meningoencephalitis, although the mechanism of enhanced
CNS infection is not understood.
In summary, our data show the differential enhancement of B. burgdorferi
transmigration across a human BBB model. Further, investigation will be required to
confirm the hypothesis that enhanced transmigration results from MMP-enhanced
tight junction degradation. Importantly, these data provide an alternative explanation
for the enhanced tissue distributions of Lyme disease spirochetes with co-infection
in animal models and set the stage for further work if concurrent HGA proves to
exacerbate Lyme disease and Lyme meningitis.
5. Uncited references
Davenpeck et al. (2000), Roos and Law (2001).
Acknowledgements
EA.hy926 cells were kindly supplied by C. Edgell, University of North Carolina. This
work was supported by a grant from the National Institutes of Health to D.J.G.
(R21AI04894-01).
References
Barbour, 1984 A.G. Barbour, Isolation and cultivation of lyme disease spirochetes,
Yale J. Biol. Med. 57 (1984), pp. 521–525. Abstract-EMBASE | AbstractMEDLINE | Order Document
Belongia, 2002 E.A. Belongia, Epidemiology and impact of coinfections acquired
from Ixodes ticks, Vector Borne Zoonotic Dis. 1 (2002), pp. 265–273. AbstractMEDLINE | Order Document
Brodie et al., 1986 T.A. Brodie, P.H. Holmes and G.M. Urquart, Some aspects of tickborne diseases of British sheep, Vet. Rec. 118 (1986), pp. 415–418. AbstractMEDLINE | Order Document
Centers, 2002 Centers for Disease Control (2002). Lyme Disease—United States,
MMWR 49, pp. 1–102.
Choi et al., 2003 K.-S. Choi, J. Garyu, J. Park and J.S. Dumler, Diminished adhesion
of Anaplasma phagocytophilum infected neutrophils to endothelial cells is associated
with reduced expression of leukocyte surface selectin, Infect. Immun. 71 (2003), pp.
4586–4594. Abstract-Elsevier BIOBASE | Abstract-EMBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Choi et al., 2004 K.-S. Choi, D.J. Grab and J.S. Dumler, Anaplasma phagocytophilum
infection induces protracted neutrophil degranulation, Infect. Immun. 72 (2004), pp.
3680–3683. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Order Document | Full Text via CrossRef
Davenpeck et al., 2000 K.L. Davenpeck, M.E. Brummet, S.A. Hudson, R.J. Mayer
and B.S. Bochner, Activation of human leukocytes reduces surface P-selectin
glycoprotein ligand-1 (PSGL-1, CD162) and adhesion to P-selectin in vitro, J.
Immunol. 165 (2000) (5), pp. 2764–2772. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document
Edgell et al., 1983 C.J. Edgell, C.C. McDonald and J.B. Graham, Permanent cell-line
expressing human VIII-related antigen established by hybridization, Proc. Natl Acad.
Sci. USA 80 (1983), pp. 3734–3737. Abstract-MEDLINE | Abstract-EMBASE |
Order Document
Garyu et al., 2005 J.W.A. Garyu, K.-S. Choi, D.J. Grab and J.S. Dumler, Defective
phagocytosis in Anaplasma phagocytophilum infected neutrophils, Infect. Immun.
(2005), pp. 1187–1190. Abstract-EMBASE | Abstract-Elsevier BIOBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Grab et al., 2004 D.J. Grab, O. Nikolskaia, Y.V. Kim, J.D. Lonsdale-Eccles, S. Ito, T.
Hara, T. Fukuma, E. Nyarko, K.J. Kim, M.F. Stins, M.J. Delannoy, J. Rodgers and
K.S. Kim, African trypanosome interactions with an in vitro model of the human
blood–brain-barrier, J. Parasitol. 90 (2004) (5), pp. 970–979. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-GEOBASE | Abstract-Elsevier BIOBASE | Order
Document
Grab et al., 2005 D.J. Grab, G. Perides, J.S. Dumler, K.J. Kim, J. Park, Y.V. Kim, O.
Nikolskaia, K.S. Choi, M.F. Stins and K.S. Kim, Borrelia burgdorferi, host-derived
proteases, and the blood–brain barrier, Infect. Immun. 73 (2005) (4), p. 2569.
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Kalish, 1993 R.A. Kalish, Lyme disease, Rheum. Dis. Clin. North Am. 19 (1993),
pp. 399–426. Abstract-EMBASE | Abstract-MEDLINE | Order Document
Krause et al., 2002 P.J. Krause, K. McKay, C.A. Thompson, V.K. Sikand, R. Lentz, T.
Lepore, L. Closter, D. Christianson, S.R. Telford, D. Persing, J.D. Radolf and A.
Spielman, Disease-specific diagnosis of coinfecting tickborne zoonoses: babesiosis,
human granulocytic ehrlichiosis, and Lyme disease, Clin. Infect. Dis. 34 (2002), pp.
1184–1191. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document | Full Text via CrossRef
Leutenneger et al., 1999 C.M. Leutenneger, Pusterla, C.N. Mislin, R. Weber and H.
Lutz, Molecular evidence of coinfection of ticks with Borrelia burgdorferi sensu lato
and the human granulocytic erlichiosis agent in Sitzerland, J. Clin. Microbiol. 37
(1999), pp. 3390–3391.
Leveris et al., 1995 D. Leveris, A. Gazumyan and I. Schwartz, Molecular typing of
Borrelia burgdorferi sensu lato by PCR-restriction fragment length polymorphism
analysis, J. Clin. Microbiol. 33 (1995), pp. 589–595.
Persidsky et al., 1997 Y.M. Persidsky, M. Stins, D. Way, M.H. Witte, M. Weinand,
K.S. Kim, P. Bock, H.E. Gendelman and M. Fiala, A model for monocyte migration
through the blood–brain barrier during HIV-1 encephalitis, J. Immunol. 158 (1997),
pp. 3499–3510. Abstract-MEDLINE | Order Document
Reid et al., 1986 H.W. Reid, D. Buxton, I. Pow, T.A. Brodie, P.H. Holmes and G.M.
Urquart, Response of sheep to experimental concurrent infection with tick-borne fever
(Cytoecetes phagocytophila) and louping-ill virus, Res. Vet. Sci. 41 (1986), pp. 56–62.
Abstract-MEDLINE | Order Document
Roos and Law, 2001 D. Roos and S.K. Law, Hematologically important mutations:
leukocyte adhesion deficiency, Blood Cells. Mol. Dis. 27 (2001), p. 1000. Abstract |
Abstract + References | PDF (42 K)
Steere, 1989 Steere, A.C. Lyme Disease. N. Engl. J. Med. 321, 586–596.
Stins et al., 1997 M.F. Stins, F. Gilles and K.S. Kim, Selective expression of adhesion
molecules on human brain microvascular endothelial cells, J. Neuroimmunol. 76
(1997), pp. 81–90. SummaryPlus | Full Text + Links | PDF (631 K)
Thomas et al., 2001 V. Thomas, J. Anguita, S.W. Barthold and E. Fikrig, Coinfection
with Borrelia burgdorferi and the agent of human granulocytic erhlichioses alters
murine immune responses, pathogen burden, and severity of lyme arthritis, Infect.
Immun. 69 (2001), pp. 3359–3371. Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Abstract-EMBASE | Order Document | Full Text via CrossRef
Thompson et al., 2001 C. Thompson, A. Spielman and P.J. Krause, Coinfecting deerassociated zoonoses: lyme disease, babesioses, erlichioses, Clin. Infect. Dis. 33
(2001), pp. 676–685. Abstract-EMBASE | Abstract-Elsevier BIOBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Corresponding author. Tel.: +1 410 955 8654; fax: +1 443 287 3665
International Journal for Parasitology
Article in Press, Uncorrected Proof
Comparison of isolation rate of Borrelia burgdorferi
sensu lato in MKP and BSK-II medium
Eva Ružić-Sabljića, , , Stanka Lotrič-Furlanb, Vera Maraspinb, Jože
Cimpermanb, Mateja Logarb, Tomaž Jurcab and Franc Strleb
Institute of Microbiology and Immunology, School of Medicine, Zaloška 4, SI-1000
Ljubljana, Slovenia
b
Department of Infectious Diseases, University Medical Centre Ljubljana, Japljeva 2
Ljubljana, Slovenia
a
Available online 10 March 2006.
Abstract
Different media have been utilized for borrelial cultivation. The aim of the present
study was to evaluate the isolation rate of Borrelia burgdorferi sensu lato from two
commonly used media, i.e. modified Kelly–Pettenkofer (MKP) and Barbour–
Stoenner–Kelly II (BSK-II) medium, and to compare the isolated strains with regard
to their phenotypic and genotypic characteristics. Skin biopsy specimens of
2×2×4 mm were taken from the peripheral site of human solitary erythema lesions
and were divided in two pieces, one of which was inoculated into MKP and the other
one into BSK-II medium. Species analysis of the obtained strains was performed and
their plasmid and protein profiles were determined. Borrelia strains were isolated
from 48/96 patients (50%) with erythema migrans. We obtained in 26/48 patients
(54%) from MKP as well as from BSK-II, in 11 patients (23%) only from MKP, and
in another 11 (23%) only from BSK-II medium a positive result. B. afzelii was
isolated from 43 patients (23 were positive in both media, nine in MKP only and 11 in
BSK-II medium only), while B. garinii was isolated from five patients (in three from
both media, in two from MKP only). All strains of the obtained strain pairs were
identical according to species and the type within the species. Plasmid profiles were
identical in 17/21 B. afzelii strain pairs (81%) and in 1/3 B. garinii strain pairs; in 6/24
strain pairs, distinctions in the number of plasmids or in their molecular mass were
present. Differences in the protein profile were found in 7/24 strain pairs (29%). The
distinctions were uniform and were limited to the expression of OspC.
In conclusion, our study showed comparable Borrelia isolation rates from MKP and
BSK-II medium. The results of the present study indicate that human patients with
Lyme borreliosis may simultaneously harbor heterogeneous B. burgdorferi s.l.
strains.
Keywords: Borrelia burgdorferi sensu lato; MKP medium; BSK-II medium;
Isolation rate
Article Outline
Introduction
Materials and methods
Borrelia isolation from patients
Culture media
Patients
Cultivation
Analysis of Borrelia strains
Identification of Borrelia species by pulsed-field gel electrophoresis (PFGE)
Identification of Borrelia species by polymerase chain reaction (PCR)
Analysis of plasmid profile
Analysis of protein profile
Results
Isolation rate
Species identification
Plasmid profile
Protein profile
Discussion
References
Introduction
Lyme borreliosis may exhibit different clinical manifestations, most frequently
erythema migrans, which represents a typical clinical sign early in the course of the
disease (Nadelman et al., 1996; Strle et al., 1996; Nadelman and Wormser, 1998;
Arnež et al., 2003; Stanek and Strle, 2003). From this localized skin infection
borreliae may disseminate to other parts of the human organism and cause different
clinical manifestations (Lotrič-Furlan et al., 1999; Wormser et al., 1999;Maraspin et
al., 2001; Oksi et al., 2001; Stanek and Strle, 2003). Isolation of the etiological agent
from patient's material is the most reliable method for the diagnosis of borrelial
infection (Pfister et al., 1984; Preac-Mursic et al., 1986; Picken et al., 1997; LotričFurlan et al., 1999; Wormser et al., 1999; Maraspin et al., 2002; Arnež et al., 2003).
Numerous Borrelia strains obtained from human tissue and tissue fluids (skin, blood,
cerebrospinal fluid, etc.) have been analyzed by different phenotypic and genotypic
approaches (Wilske et al., 1988 and Wilske et al., 1993; Wang et al., 1999; RužićSabljić et al., 2000, Ružić-Sabljić et al., 2001a and Ružić-Sabljić et al., 2001b). In
comparison to phenotypic assessment, analysis of borrelial genomic DNA provides
more precise information on the genetic relationships among Borrelia strains
(Belfaiza et al., 1993; Busch et al., 1995; Busch and Nitschko, 1999; Olive and Bean,
1999; Wang et al., 1999; Wormser et al., 1999; Ružić-Sabljić et al., 2000, RužićSabljić et al., 2001a and Ružić-Sabljić et al., 2001b). Many studies indicate that B.
burgdorferi sensu lato populations are genetically divergent and phenotypically
heterogeneous, and that Lyme borreliosis in humans is caused by at least three
different species of the B. burgdorferi s.l. complex, viz. B. afzelii, B. garinii, and B.
burgdorferi sensu stricto (Belfaiza et al., 1993; Burgdorfer, 1995; Rijpkema et al.,
1995; Liveris et al., 1996; Picken et al., 1996; Mathiesen et al., 1997; Wang et al.,
1999; Wormser et al., 1999; Ružić-Sabljić et al., 2000, Ružić-Sabljić et al., 2001a and
Ružić-Sabljić et al., 2001b).
Isolation of B. burgdorferi s.l. from clinical materials is a golden standard for
confirming borrelial infection. Borrelia cultivation and isolation is quite a demanding
procedure with limited sensitivity (Jobe et al., 1993; Nadelman et al., 1996; Strle et al.,
1996; Kollars et al., 1997, Picken et al., 1997; Lotrič-Furlan et al., 1999; Wormser et
al., 2000; Maraspin et al., 2001). Different media for borrelial cultivation have been
reported. For routine work, modified Kelly–Pettenkofer (MKP), Barbour–Stoenner–
Kelly II (BSK-II) medium and commercially available BSK-H (Sigma, USA) medium
have been utilized most frequently (Barbour, 1984; Preac-Mursic et al., 1986; Pollack
et al., 1993). The majority of the components of the three media are equivalent and
present in similar concentrations (e.g. CMRL, N–acetyl glucosamine, bovine serum
albumin, rabbit serum, etc.) but the origin of components may be dissimilar (e.g.
bought from different commercial firms). However, media may differ in certain
constituents. For example, MKP lacks yeast extract present in BSK–II and BSK-H,
but–in contrast to BSK-II and BSK-H–contains gelatin (Barbour, 1984; Preac-Mursic
et al., 1986; Pollack et al., 1993). To be useful for laboratory purposes, the medium
must be stable, available and efficacious in supporting the growth of all human
pathogenic Borrelia strains. In addition to medium ingredients, several other factors
including temperature of incubation, pH of the medium, capacity of particular
borrelial species to grow and number of Borrelia strains in the sample can influence
borrelial growth and the outcome of cultivation (Hubalek et al., 1998; Ružić-Sabljić
and Strle, 2004).
The aim of the present study was to evaluate and compare the isolation rate of B.
burgdorferi s.l. from the skin of patients with erythema migrans using MKP and
BSK-II medium, and to compare phenotypic and genotypic characteristics of the
strain pairs, i.e. the strains isolated in the two media from the skin biopsy of an
individual patient.
Materials and methods
Borrelia isolation from patients
Culture media
In the present study MKP and BSK-II medium were used for Borrelia isolation. Both
media were prepared in our laboratory after the original recipes (Barbour, 1984;
Preac-Mursic et al., 1986). The two media differ with regard to the glucose
concentration (3 versus 5 g/l in MKP and BSK-II, respectively), the origin and
concentration of bovine serum albumin (35% solution with a final concentration of
1 g/ml in MKP versus fraction V powder with final concentration 4 g/ml in BSK-II),
the concentration and preparation of rabbit sera (7.2% heat-inactivated versus 6%
non-inactivated in MKP and BSK-II, respectively). Additionally, yeastolate (2 g/l)
was added to BSK-II but not to MKP medium. After preparing and testing the quality
of each medium lot, the media were distributed to clinicians.
Patients
Ninety-six consecutive adult patients diagnosed with erythema migrans at the
Department of Infectious Diseases, University Medical Center Ljubljana, in spring of
2000 represented the basis for the present study. In each patient, a skin biopsy was
taken from the peripheral site of erythema migrans after prior cleaning the skin with
70% alcohol and local anesthesia with 2% xylocaine (Jurca et al., 1998). Each
specimen (2×2×4 mm) was dissected in two pieces: one was immediately inoculated
into MKP, the other one into BSK-II medium. The inoculated media were sent to the
laboratory at room temperature.
Cultivation
Samples were incubated at 33 °C and examined weekly for up to 9 weeks for the
presence of spirochetes by dark-field microscopy. Isolated strains were grown in
the same medium for 2–4 subcultures.
Analysis of Borrelia strains
For the large majority of isolates, strain identification was carried out by pulsed-field
gel electrophoresis (PFGE). Identification by polymerase chain reaction (PCR) was
performed only for cultures with borrelial concentration not high enough for PFGE.
Identification of Borrelia species by pulsed-field gel electrophoresis (PFGE)
Strain identification by PFGE was performed as described previously (Busch et al.,
1995; Ružić-Sabljić et al., 2000, Ružić-Sabljić et al., 2001a and Ružić-Sabljić et al.,
2001b). Briefly, Borrelia strains were mixed in agarose, and whole blocks were lysed
in lysis buffer containing lysozyme (1 mg/ml) and ribonuclease (10 μg/ml), and
digested in digestion buffer containing proteinase K (0.5 mg/ml). After exhaustive
block washing, DNA was restricted with 30 U of MluI restriction enzyme. Restricted
patterns were separated for 24 h with ramping pulse times of 1–40 s. Molecular mass
marker of 50–1000 kb (Sigma, USA) was added to each electrophoresis. Borrelia
species as well as the type within the particular species were determined by restriction
fragment length polymorphism (RFLP) as described by Belfaiza et al. (1993) and
Picken et al. (1996). Fragments interpreted as being species specific were those with
molecular weights 440, 320 and 90 kb for B. afzelii, 220 and 80 kb for B. garinii and
145 kb for B. burgdorferi s.s. Types within species (Mla for B. afzelii, Mlg for B.
garinii and Mlb for B. burgdorferi s.s.) were determined according to additional
fragments of different molecular weights (Belfaiza et al., 1993; Picken et al., 1996).
Identification of Borrelia species by polymerase chain reaction (PCR)
Tubes with culture were centrifuged at 10,000 rpm and borrelial DNA was isolated
from the sediment using commercial kit (QIAamp DNA mini kit, Qiagen cat. no.
51306, Germany). Interspace 5S-23S DNA region was amplified. The amplified
products were restricted by restriction enzyme MseI and electrophoresed in 16%
polyacrylamide gel. Borrelia species were determined by RFLP as described by
Postic et al. (1994). Fragments interpreted as being species specific were those with
molecular weights 108, 68, 50 and 20 bp for B. afzelii, 108, 95 and 50 bp for B.
garinii and 108, 51, 38, 29 and 28 bp for B. burgdorferi s.s.
Analysis of plasmid profile
The procedure was limited to cultures with a sufficient Borrelia density to allow the
execution of PFGE, and was determined only in patients in whom borreliae were
isolated from an erythema migrans lesion concurrently in MKP and in BSK-II
medium (when two isolates were obtained from an individual skin biopsy sample). To
compare plasmid profiles within such strain pairs, we performed electrophoresis of
both strains on the same gel. Plasmid profiles were determined by PFGE. Blocks with
borrelial DNA were prepared identically as for species identification but
electrophoresis was performed without previous restriction of DNA. Chromosomal
and plasmid DNA were separated for 37 h in ramping pulse time of 0.9–3 s as
described previously (Busch et al., 1995; Ružić-Sabljić et al., 1999, Ružić-Sabljić et
al., 2000, Ružić-Sabljić et al., 2001a and Ružić-Sabljić et al., 2001b). Molecular mass
marker of 0.1–200 kb (Sigma, USA) was added to each separation.
Analysis of protein profile
Protein profile analysis of borrelial strains was performed only in patients in whom
borreliae were isolated in MKP as well as in BSK-II medium. To compare protein
profiles of concurrently isolated strains, we performed electrophoresis of both strains
on the same gel. For the determination of protein profiles, strains were harvested,
washed and lysed in buffer containing sodium dodecyl sulfate (2.5%) and 2mercaptoethanol (2.5%), as described elsewhere (Wilske et al., 1988; Busch et al.,
1995; Ružić-Sabljić et al., 2000, Ružić-Sabljić et al., 2001a and Ružić-Sabljić et al.,
2001b). Electrophoresis was performed in 12% polyacrylamide gel. Low molecular
mass marker of 21–106 kD (BioRad, Germany) was used as size marker in each
protein profile determination.
Results
Isolation rate
Skin biopsy specimens were obtained from 96 consecutive adult patients with typical
solitary erythema migrans. Borrelia strains were isolated from 48/96 skin lesions
(patients) (50%). There was no difference in the isolation rate when comparing MKP
and BSK-II medium (37 positive cultures in each particular medium). In 26/48
patients (54%) borreliae were isolated in MKP as well as in BSK-II medium, while in
11/48 patients (23%) borreliae were isolated either in MKP or BSK-II (Table 1).
Table 1.
Borrelia burgdorferi sensu lato isolation rate from human erythema migrans skin biopsy sample
divided in two specimens–comparison of modified Kelly–Pettenkofer (MKP) and Barbour–Stoenner–
Kelly II (BSK-II) medium
Culture-positive samples
Culture negative
Total
In MKP and BSK-II
In MKP only
In BSK-II only
26
11
11
48
48
96
Species identification
Out of the 74 isolated Borrelia strains, 69 (93%) were typed using PFGE, while in 5
strains (3 in MKP and 2 in BSK-II medium) that did not grow sufficiently, species
identification was preformed by PCR. Sixty-six strains (89%) were identified as B.
afzelii (in 23 patients, the strains were isolated in both media, in 9 patients in MKP
only, and in 11 patients in BSK-II only) and 8 as B. garinii (in 3 patients isolated in
both media, and in 2 patients isolated in MKP only). Data are shown in Table 2.
Table 2.
Species identification of Borrelia strains isolated from human erythema migrans skin biopsies divided
in two specimens – comparison of modified Kelly–Pettenkofer (MKP) and Barbour–Stoenner–Kelly II
(BSK-II) medium
Positive culture in medium
B. afzelii
B. garinii
No. of isolated strains
PFGEa
PCRb
PFGE
PCR
MKP and
22
1
3
–
26
BSK-II
22
1
3
–
26
MKP only
7
2
2
–
11
BSK-II only
10
1
–
–
11
Subtotal
61
5
8
0
Total
66
a
b
8
74
Identification of Borrelia species with pulsed-field gel electrophoresis.
Identification of Borrelia species with polymerase chain reaction.
From 48 skin-culture-positive patients with erythema migrans (Table 1), there were
26 patients with borreliae isolated in both media. Of these 26 strain pairs (52 strains),
24 strain pairs were suitable for further PFGE identification and were used for
analyzing and comparing PFGE types within the species as well as plasmid and
protein profiles. Each individual strain pair was congruent according to the species as
well as to the PFGE type. Regarding PFGE type, strain pairs consisted of either B.
afzelii Mla1 (21 pairs) or B. garinii Mlg2 (3 pairs).
Plasmid profile
Identical plasmid profiles were found in 17/21 B. afzelii strain pairs (81%) and in 1/3
B. garinii strain pairs, while in 6/24 patients, the two strains differed either in the
number of plasmids or their molecular mass. The plasmid profiles of some strain pairs
are shown in Fig. 1.
(50K)
Fig. 1. Plasmid profile of Borrelia strains (1 and 2) isolated in both modified Kelly–Pettenkofer (MKP)
and Barbour–Stoenner–Kelly II (BSK-II) medium. Strains were isolated from skin biopsies of patients
with erythema migrans (A–J). MW: molecular mass marker; B. afzelii strains: A–F and J; B. garinii
strains: G–I. Plasmid profile of strain pairs differs in patients A–D and G.
Protein profile
Protein profiles of strain pairs obtained from patients in whom borreliae were isolated
in MKP as well as in BSK-II medium differed in 7/24 cases (29%). All those strains
were identified as B. afzelii and showed identical distinction–one strain of each pair
expressed OspC, whereas the other did not. Protein profiles differed in six strain pairs
which were identical according to the species and the plasmid profile, and in one
strain pair both strains belonged to the same species but were distinct in their plasmid
profile (patient D from the Fig. 1).
Discussion
Although erythema migrans represents a pathognomonic clinical sign of Lyme
borreliosis, the isolation rate of Borrelia strains from the skin lesions was only 50%
(48/96 patients) in the present study, corroborating previous findings from Slovenia
(Strle et al., 1996; Jurca et al., 1998; Zore et al., 2002). The fastidious nature of the
organism and changes that Borrelia must undergo to adapt the transition from living
biological material to an artificial medium probably limit the isolation rate (Picken et
al., 1996; Norris et al., 1997). Additionally, ingenious characteristics of the individual
Borrelia species such as a tendency of better growth or overgrowth of certain Borrelia
species over the other(s) (Ružić-Sabljić and Strle, 2004) might influence borrelial
isolation rate. Several other factors, for example, the quantity of spirochetes in a given
sample, previous antibiotic treatment, local anesthesia at the site of biopsy, conditions
of sample transport to the laboratory, medium used for Borrelia cultivation, aseptic
environment of culture maintenance, etc. can also influence the isolation rate (Kollars
et al., 1997; Wormser et al., 2000). The relatively low isolation rate of Borrelia strains
in our patients with erythema migrans might have been caused by the rather small size
of skin biopsy specimens (e.g. 2×2×4 mm) that was additionally divided in two pieces.
Some previous studies suggested that borreliae are present in erythema migrans
lesions in only low concentration and are irregularly distributed (Pachner et al., 1993;
Picken et al., 1997; Zore et al., 2002). With larger samples, the isolation rate would
probably be higher (Wormser et al., 2000).
The main interest of the present study was to compare the isolation rate of B.
burgdorferi s.l. from erythema migrans skin samples in two commonly used media,
MKP and BSK-II. We had anticipated that our approach of taking one skin biopsy
from an individual patient, dissecting it in two pieces and inoculating each single
piece in a particular medium, would lead to identical (positive or negative) results in
the large majority of cases. The unexpected discrepancy may be explained by unequal
distribution of Borrelia strains within individual samples. Our findings and proposed
explanations are in accordance with the results of some previous studies which
suggested that borreliae are present in erythema migrans lesions in low concentration
and are irregularly distributed (Pachner et al., 1993; Picken et al., 1997; Zore et al.,
2002).
Sixty-six out of 74 isolates (89%) were typed as B. afzelii and 8 as B. garinii; no B.
burgdorferi s.s. strain was isolated (Table 2). These findings corroborate the results of
several European studies on the predominance of B. afzelii strains in skin
manifestations of Lyme borreliosis (Picken et al., 1996; Rijpkema et al., 1997;
Ružić-Sabljić et al., 2000; Ciceroni et al., 2001; Ornstein et al., 2001; Logar et al.,
2004).
Twenty-four strain pairs (out of 26 double isolates) grew well enough to allow RFLP
analysis (Table 2) and to carry out a comparison of the phenotypic and genotypic
characteristics of the isolates within the individual pairs (species identification,
plasmid and protein profiles). Either strain of each strain pair contained the same
Borrelia genospecies (21 pairs: B. afzelii; 3 pairs: B. garinii) and the same type (all B.
afzelii strains were determined as Mla1, and all B. garinii strains as Mlg2), whereas
some distinctions in plasmid and protein profiles were found.
A plasmid profile analysis revealed 6/24 strain pairs (25%) composed of strains with
distinct plasmid outlines. Some of these strains are shown in Fig. 1. The plasmid
profile is an excellent tool for strain discrimination particularly when comparing
strains within the same species. Many conditions can affect the borrelial plasmid
content including the possibility that plasmids can be lost upon cultivation (Xu and
Johnson, 1995; Busch et al., 1997; Ružić-Sabljić et al., 1999, Ružić-Sabljić et al.,
2000, Ružić-Sabljić et al., 2001a and Ružić-Sabljić et al., 2001b; Wang et al., 1999;
Iyer et al., 2003). We would like to stress that strains compared in our study were
subjected to quite identical circumstances. They were isolated, multiplied and
analyzed using analogous approaches and procedures but only differed in the culture
medium. However, the potential impact of a particular medium (MKP versus BSK-II)
on the plasmid content is not known. Differences in the plasmid content within
particular strain pairs have been described previously (Ružić-Sabljić et al., 2005). We
believe that the plasmid content of our strains most probably represents the natural
situation and that differing plasmid profiles of strains may be quite safely interpreted
as an infection with different clones of the same type of an identical Borrelia species.
Differences in the protein profile were found within 7/24 strain pairs (29%). All strain
pairs with dissimilar protein profiles belonged to B. afzelii. The distinctions were
uniform and limited to the expression of OspC. It is of interest that 6/7 strain pairs
with distinct protein profiles had congruent plasmid profiles. Besides the adaptive
mechanisms of the spirochetes that influence protein expression, each strain has its
own potential to express (or not to express) a particular protein. The latter statement is
supported by the finding that populations of B. afzelii and B. garinii generally differ in
their potential to express some important proteins such as OspB and OspC (Wilske et
al., 1988 and Wilske et al., 1996; Ružić-Sabljić et al., 2000, Ružić-Sabljić et al.,
2001a and Ružić-Sabljić et al., 2001b). Therefore, it is possible that proteins
expressed by the strains presented in the present study reflect their own genuine status.
In conclusion, our study showed comparable Borrelia isolation rates in MKP versus
BSK-II medium indicating their similar suitability for routine clinical work. The
results of the present study indicate that human patients with Lyme borreliosis may
simultaneously harbor heterogeneous B. burgdorferi s.l. strains.
References
Arnež et al., 2003 M. Arnež, D. Pleterski-Rigler, T. Lužnik-Bufon, E. Ružić-Sabljić
and F. Strle, Solitary and multiple erythema migrans in children: comparison of
demographic, clinical, and laboratory findings, Infection 31 (2003), pp. 404–409.
Abstract-MEDLINE | Order Document
Barbour, 1984 A.G. Barbour, Isolation and cultivation of Lyme disease spirochetes,
Yale J. Biol. Med. 57 (1984), pp. 521–525. Abstract-EMBASE | AbstractMEDLINE | Order Document
Belfaiza et al., 1993 J. Belfaiza, D. Postic, E. Bellenger, G. Baranton and I. Saint
Girons, Genomic fingerprinting of Borrelia burgdorferi sensu lato by pulsed-field gel
electrophoresis, J. Clin. Microbiol. 31 (1993), pp. 2873–2877. Abstract-MEDLINE |
Abstract-EMBASE | Order Document
Burgdorfer, 1995 W. Burgdorfer, Lyme disease (borreliosis): a global perspective,
Alpe Adria Microbiol. J. 3 (1995), pp. 227–233. Abstract-EMBASE | Order
Document
Busch and Nitschko, 1999 U. Busch and H. Nitschko, Methods for the differentiation
of microorganisms, J. Chromatogr. B 722 (1999), pp. 236–278.
Busch et al., 1995 U. Busch, C. Hizo-Teufel, R. Boehmer, B. Wilske and V. PreacMursic, Molecular characterization of Borrelia burgdorferi sensu lato strains by
pulsed-field electrophoresis, Electrophoresis 16 (1995), pp. 744–747. AbstractMEDLINE | Abstract-EMBASE | Order Document | Full Text via CrossRef
Busch et al., 1997 U. Busch, G. Will, C. Hizo-Teufel, B. Wilske and V. Preac-Mursic,
Long-term in vitro cultivation of Borrelia burgdorferi sensu lato strains: influence on
plasmid patterns, genome stability, and expression of proteins, Res. Microbiol. 148
(1997), pp. 109–111.
Ciceroni et al., 2001 L. Ciceroni, S. Ciarrochi, A. Ciervo, V. Mondarini, F. Guzzo, G.
Caruso, R. Murgia and M. Cinco, Isolation and characterization of Borrelia
burgdorferi sensu lato strains in an area of Italy where Lyme borreliosis is endemic,
J. Clin. Microbiol. 39 (2001), pp. 2254–2260. Abstract-Elsevier BIOBASE | AbstractEMBASE | Abstract-MEDLINE | Order Document | Full Text via CrossRef
Hubalek et al., 1998 Z. Hubalek, J. Halouzka and M. Heroldova, Growth temperature
ranges of Borrelia burgdorferi sensu lato strains, J. Med. Microbiol. 47 (1998), pp.
929–932. Abstract-MEDLINE | Abstract-EMBASE | Order Document
Iyer et al., 2003 R. Iyer, O. Kalu, J. Purser, S. Norris, B. Stevenson and I. Schwartz,
Linear and circular plasmid content in Borrelia burgdorferi clinical isolates, Infect.
Immun. 71 (2003), pp. 3699–3706. Abstract-Elsevier BIOBASE | Abstract-EMBASE
| Abstract-MEDLINE | Order Document | Full Text via CrossRef
Jobe et al., 1993 D.A. Jobe, S.M. Callister and R.F. Schell, Recovery of Borrelia
burgdorferi by filtration, J. Clin. Microbiol. 31 (1993), pp. 1896–1898. AbstractEMBASE | Abstract-MEDLINE | Order Document
Jurca et al., 1998 T. Jurca, E. Ružić-Sabljić, S. Lotrič-Furlan, V. Maraspin, J.
Cimperman, R.N. Picken and F. Strle, Comparison of peripheral and central biopsy
sites for the isolation of Borrelia burgdorferi sensu lato from erythema migrans
lesions, Clin. Infect. Dis. 27 (1998), pp. 636–638. Abstract-MEDLINE | AbstractEMBASE | Order Document
Kollars et al., 1997 T.M. Kollars, P.G. Kollars, J.H. Oliver, E.J. Masters and D. Miles,
Effects of two commonly used anesthetics on the in vitro growth of Borrelia
burgdorferi and B. garinii, J. Spirochet. Tick-borne Dis. 4 (1997), pp. 21–23.
Liveris et al., 1996 D. Liveris, G.P. Wormser, J. Nowakowski, R. Nadelman, S.
Bittker, D. Cooper, S. Varde, F.H. Moy, G. Forseter, C.S. Pavia and I. Schwartz,
Molecular typing of Borrelia burgdorferi from Lyme disease patients by PCRrestriction fragment length polymorphism analysis, J. Clin. Microbiol. 34 (1996), pp.
1306–1309. Abstract-MEDLINE | Abstract-EMBASE | Order Document
Logar et al., 2004 M. Logar, E. Ružić-Sabljić, S. Lotrič-Furlan, J. Cimperman, T.
Jurca and F. Strle, Comparison of erythema migrans caused by Borrelia afzelii and
Borrelia garinii, Infection 32 (2004), pp. 15–19. Abstract-MEDLINE | AbstractElsevier BIOBASE | Abstract-EMBASE | Order Document | Full Text via CrossRef
Lotrič-Furlan et al., 1999 S. Lotrič-Furlan, J. Cimperman, V. Maraspin, E. RužićSabljić, M. Logar, T. Jurca and F. Strle, Lyme borreliosis and peripheral facial
palsy, Wien. Klin. Wschr. 111 (1999), pp. 970–975. Abstract-MEDLINE | AbstractEMBASE | Order Document
Maraspin et al., 2001 V. Maraspin, E. Ružić-Sabljić, J. Cimperman, S. Lotrič-Furlan,
T. Jurca, R.N. Picken and F. Strle, Isolation of Borrelia burgdorferi sensu lato from
blood of patients with erythema migrans, Infection 29 (2001), pp. 65–70. AbstractEMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order Document |
Full Text via CrossRef
Maraspin et al., 2002 V. Maraspin, J. Cimperman, S. Lotrič-Furlan, E. Ružić-Sabljić,
T. Jurca and F. Strle, Cerebrospinal fluid findings in adult patients with multiple
erythema migrans, Wien. Klin. Wschr. 114 (2002), pp. 505–509. Abstract-MEDLINE
| Abstract-EMBASE | Order Document
Mathiesen et al., 1997 D.A. Mathiesen, J.H. Oliver, C.P. Kolbert, E.D. Tullson, B.J.B.
Johnson, G.L. Campbell, P.D. Mitchell, K.D. Reed, S.R. Telford III, J.F. Anderson,
R.S. Lane and D.H. Persing, Genetic heterogeneity of Borrelia burgdorferi in the
United States, J. Infect. Dis. 175 (1997), pp. 98–107. Abstract-MEDLINE | Order
Document
Nadelman and Wormser, 1998 R.B. Nadelman and G.P. Wormser, Lyme
borreliosis, Lancet 352 (1998), pp. 557–565. SummaryPlus | Full Text + Links | PDF
(362 K)
Nadelman et al., 1996 R.B. Nadelman, J. Nowakowski, G. Forseter, N.S. Goldberg, S.
Bittker, D. Cooper, M. Auguero-Rosenfeld and G. Wormser, The clinical spectrum of
early Lyme borreliosis in patients with culture confirmed erythema migrans, Am. J.
Med. 100 (1996), pp. 502–508. Abstract | PDF (738 K)
Norris et al., 1997 D.E. Norris, B.J.B. Johnson, J. Piesman, G.O. Maupin, J.L. Clark
and W.C. Black IV, Culturing select for specific genotypes of Borrelia burgdorferi in
the enzootic cycle in Colorado, J. Clin. Microbiol. 35 (1997), pp. 2359–2364.
Abstract-MEDLINE | Abstract-EMBASE | Order Document
Oksi et al., 2001 J. Oksi, H. Marttila, H. Soini, H. Aho, J. Uksila and M.K. Viljanen,
Early dissemination of Borrelia burgdorferi without generalized symptoms in patients
with erythema migrans, APMIS 109 (2001), pp. 581–588. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Olive and Bean, 1999 D.M. Olive and P. Bean, Principles and applications of methods
for DNA-based typing of microbial organism, J. Clin. Microbiol. 37 (1999), pp.
1661–1669. Abstract-Elsevier BIOBASE | Abstract-MEDLINE | AbstractEMBASE | Order Document
Ornstein et al., 2001 K. Ornstein, J. Berglund, I. Nilsson, R. Norrby and S. Bergström,
Characterization of Lyme borreliosis isolates from patients with erythema migrans
and neuroborreliosis in southern Sweden, J. Clin. Microbiol. 39 (2001), pp. 1294–
1298. Abstract-Elsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE |
Order Document | Full Text via CrossRef
Pachner et al., 1993 A.R. Pachner, N. Ricalton and E. Delanez, Comparison of
polymerase chain reaction with culture and serology for diagnosis of murine
experimental Lyme borreliosis, J. Clin. Microbiol. 31 (1993), pp. 208–214.
Abstract-MEDLINE | Abstract-EMBASE | Order Document
Pfister et al., 1984 H.W. Pfister, K. Einhäupl, V. Preac-Mursic, B. Wilske and G.
Schierz, The spirochetal etiology of lymphocytic meningoradiculitis of Bannwarth
(Bannwarth's syndrome), J. Neurol. 231 (1984), pp. 141–144. Abstract-MEDLINE |
Abstract-EMBASE | Order Document | Full Text via CrossRef
Picken et al., 1996 R.N. Picken, Y. Cheng, F. Strle, J. Cimperman, V. Maraspin, S.
Lotrič-Furlan, E. Ružić-Sabljić, D. Han, J.A. Nelson, M.M. Picken and G.M.
Trenholme, Molecular characterization of Borrelia burgdorferi sensu lato from
Slovenia revealing significant differences between tick and human isolates, Eur. J.
Clin. Microbiol. Infect. Dis. 15 (1996), pp. 313–323. Abstract-MEDLINE | AbstractEMBASE | Order Document | Full Text via CrossRef
Picken et al., 1997 M.M. Picken, R.N. Picken, D. Han, Y. Cheng, E. Ružić-Sabljić, J.
Cimperman, V. Maraspin, S. Lotrič-Furlan and F. Strle, A two year prospective study
to compare culture and polymerase chain reaction amplification for the detection and
diagnosis of Lyme borreliosis, J. Clin. Pathol.: Mol. Pathol. 50 (1997), pp. 186–
193. Abstract-EMBASE | Abstract-MEDLINE | Order Document
Pollack et al., 1993 R.J. Pollack, S.R. Telford III and A. Spielman, Standardization of
medium for culturing Lyme disease spirochetes, J. Clin. Microbiol. 31 (1993), pp.
1251–1255. Abstract-EMBASE | Order Document
Postic et al., 1994 D. Postic, M.V. Assous, P.A.D. Grimont and G. Baranton,
Diversity of Borrelia burgdorferi sensu lato evidenced by restriction fragment length
polymorphism of rrf (5S)–rrl (23S) intergenic spacer amplicons, Int. J. Syst. Bacteriol.
44 (1994), pp. 743–752. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document
Preac-Mursic et al., 1986 V. Preac-Mursic, B. Wilske and G. Schierz, European
Borrelia burgdorferi isolated from humans and ticks: culture conditions and antibiotic
susceptibility, Zbl. Bakt. Hyg. A 263 (1986), pp. 112–118. Abstract-EMBASE |
Abstract-MEDLINE | Order Document
Rijpkema et al., 1995 S.G.T. Rijpkema, M.J.C.H. Molkenboer, L.M. Schouls, F.
Jongejan and J.F.P. Schellekens, Simultaneous detection and genotyping of three
genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by
characterization of the amplified intergenic spacer region between 5S and 23S rRNA
genes, J. Clin. Microbiol. 33 (1995), pp. 3091–3095. Abstract-MEDLINE | AbstractEMBASE | Order Document
Rijpkema et al., 1997 S.G.T. Rijpkema, D.J. Tazelaar, M.J.C.H. Molkenboer, G.T.
Noordhoek, G. Plantinga, L.M. Schouls and J.F.P. Schellekens, Detection of Borrelia
afzelii, Borrelia burgdorferi sensu stricto, Borrelia garinii and group VS116 by PCR
in skin biopsies of patients with erythema migrans and acrodermatitis chronica
atrophicans, Clin. Microbiol. Inf. 3 (1997), pp. 109–116. Abstract-EMBASE | Order
Document
Ružić-Sabljić and Strle, 2004 E. Ružić-Sabljić and F. Strle, Comparison of growth of
Borrelia afzelii, B. garinii, and B. burgdorferi sensu stricto in MKP and BSK-II
medium, Int. J. Med. Microbiol. 294 (2004), pp. 407–412. Full Text via CrossRef
Ružić-Sabljić et al., 1999 E. Ružić-Sabljić, F. Strle, S. Lotrič-Furlan, J. Cimperman
and V. Maraspin, Linear plasmid profile analysis of Borrelia burgdorferi sensu lato
strains, Zbl. Bakt. 289 (1999), pp. 740–741. Abstract-Elsevier BIOBASE | Order
Document
Ružić-Sabljić et al., 2000 E. Ružić-Sabljić, F. Strle, J. Cimperman, V. Maraspin, S.
Lotrič-Furlan and D. Pleterski-Rigler, Characterization of Borrelia burgdorferi sensu
lato strains isolated from patients with skin manifestations of Lyme borreliosis
residing in Slovenia, J. Med. Microbiol. 49 (2000), pp. 47–53. Abstract-EMBASE |
Abstract-Elsevier BIOBASE | Order Document
Ružić-Sabljić et al., 2001a E. Ružić-Sabljić, M. Arnež, S. Lotrič-Furlan, V. Maraspin,
J. Cimperman and F. Strle, Genotypic and phenotypic characterization of Borrelia
burgdorferi sensu lato strains isolated from human blood, J. Med. Microbiol. 50
(2001), pp. 896–901.
Ružić-Sabljić et al., 2001b E. Ružić-Sabljić, S. Lotrič-Furlan, V. Maraspin, J.
Cimperman, D. Pleterski-Rigler and F. Strle, Analysis of Borrelia burgdorferi sensu
lato isolated from cerebrospinal fluid, APMIS 109 (2001), pp. 707–709.
Ružić-Sabljić et al., 2005 E. Ružić-Sabljić, M. Arnež, M. Logar, V. Maraspin, S.
Lotrič-Furlan, J. Cimperman and F. Strle, Comparison of Borrelia burgdorferi sensu
lato strains isolated from specimens obtained simultaneously from two different sites
of infection in individual patients, J. Clin. Microbiol. 43 (2005), pp. 2194–2200. Full
Text via CrossRef
Stanek and Strle, 2003 G. Stanek and F. Strle, Lyme borreliosis, Lancet 362 (2003),
pp. 1639–1647. SummaryPlus | Full Text + Links | PDF (1581 K)
Strle et al., 1996 F. Strle, A. Nelson, E. Ružić-Sabljić, J. Cimperman, V. Maraspin, S.
Lotrič-Furlan, Y. Cheng, M.M. Picken, G.M. Trenholme and R.N. Picken, European
Lyme borreliosis: 231 culture-confirmed cases involving patients with erythema
chronicum migrans, Clin. Infect. Dis. 23 (1996), pp. 61–65. Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document
Wang et al., 1999 Q. Wang, A.P. van Dam, I. Schwartz and J. Dankert, Molecular
typing of Borrelia burgdorferi sensu lato: taxonomic, epidemiological, and clinical
implications, Clin. Microbiol. Rev. 12 (1999), pp. 633–653. Abstract | PDF (540 K)
Wilske et al., 1988 B. Wilske, V. Preac Mursic, G. Schierz, R. Huhbeck, A.G.
Barbour and M. Kramer, Antigenic variability of Borrelia burgdorferi, Ann. N.Y.
Acad. Sci. 539 (1988), pp. 126–143. Abstract-MEDLINE | Abstract-EMBASE |
Order Document
Wilske et al., 1993 B. Wilske, V. Preac Mursic, U.B. Göbel, B. Graf, S. Jauris-Heipke,
E. Soutschek, E. Schwab and G. Zumstein, An OspA serotyping system for Borrelia
burgdorferi based on reactivity with monoclonal antibodies and OspA sequence
analysis, J. Clin. Microbiol. 31 (1993), pp. 340–350. Abstract-MEDLINE | AbstractEMBASE | Order Document
Wilske et al., 1996 B. Wilske, U. Busch, H. Eiffert, V. Fingerle, H.W. Pfister, D.
Rössler and V. Preac-Mursic, Diversity of OspA and OspC among cerebrospinal fluid
isolates of Borrelia burgdorferi sensu lato from patients with neuroborreliosis in
Germany, Med. Microbiol. Immunol. 184 (1996), pp. 195–201. AbstractMEDLINE | Order Document | Full Text via CrossRef
Wormser et al., 1999 G.P. Wormser, D. Liveris, J. Nowakowski, R.B. Nadelman, L.F.
Cavaliere, D. McKenna, D. Holmgren and I. Schwartz, Association of specific
subtypes of Borrelia burgdorferi with hematogenous dissemination in early Lyme
disease, J. Infect. Dis. 180 (1999), pp. 720–725. Abstract-MEDLINE | AbstractEMBASE | Abstract-Elsevier BIOBASE | Order Document | Full Text via CrossRef
Wormser et al., 2000 G.P. Wormser, S. Bittker, D. Cooper, J. Nowakowski, R.B.
Nadelman and C. Pavia, Comparison of yields of blood cultures using serum or
plasma from patients with early Lyme disease, J. Clin. Microbiol. 38 (2000), pp.
1648–1650. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document
Xu and Johnson, 1995 Y. Xu and R.C. Johnson, Analysis and comparison of plasmid
profiles of Borrelia burgdorferi sensu lato strains, J. Clin. Microbiol. 33 (1995), pp.
2679–2685. Abstract-MEDLINE | Abstract-EMBASE | Order Document
Zore et al., 2002 A. Zore, E. Ružić-Sabljić, V. Maraspin, J. Cimperman, S. LotričFurlan, A. Pikelj, T. Jurca, M. Logar and F. Strle, Sensitivity of culture and
polymerase chain reaction for the etiologic diagnosis of erythema migrans, Wien. Klin.
Wschr. 114 (2002), pp. 606–609. Abstract-MEDLINE | Abstract-EMBASE | Order
Document
International Journal of Medical Microbiology
Article in Press, Corrected Proof
Anaplasma phagocytophilum-infected neutrophils
enhance transmigration of Borrelia burgdorferiacross
the human blood brain barrier in vitro
E. Nyarkoa, D.J. Graba and J.S. Dumlerb,
,
a
Division of Infectious Diseases, Department of Pediatrics, The Johns Hopkins
University School of Medicine, Baltimore, MD, USA
b
Division of Medical Microbiology, Department of Pathology, The Johns Hopkins
University School of Medicine, 720 Rutland Avenue, Ross 624, Baltimore, MD
21205, USA
Received 6 November 2005; revised 20 January 2006; accepted 30 January
2006. Available online 6 March 2006.
Abstract
The manifestations of Lyme disease, caused by Ixodes spp. tick-transmitted Borrelia
burgdorferi, range from skin infection to bloodstream invasion into the heart, joints
and nervous system. The febrile infection human granulocytic anaplasmosis is caused
by a neutrophilic rickettsia called Anaplasma phagocytophilum, also transmitted by
Ixodes ticks. Previous studies suggest that co-infection with A. phagocytophilum
contributes to increased spirochetal loads and severity of Lyme disease. However, a
common link between these tick-transmitted pathogens is dissemination into blood or
tissues through blood vessels. Preliminary studies show that B. burgdorferi binds and
passes through endothelial barriers in part mediated by host matrix metalloproteases.
Since neutrophils infected by A. phagocytophilum are activated to release bioactive
metalloproteases and chemokines, we examined the enhanced B. burgdorferi
transmigration through vascular barriers with co-infection in vitro. To test whether
endothelial transmigration is enhanced with co-infection, B. burgdorferi and A.
phagocytophilum-infected neutrophils were co-incubated with EA.hy926 cells
(HUVEC-derived) and human brain microvascular endothelial cells in Transwell™
cultures. Transmigration of B. burgdorferi through endothelial cell barriers was
determined and endothelial barrier integrity was measured by transendothelial
electrical resistivity. More B. burgdorferi crossed both human BMEC and EA.hy926
cells in the presence of A. phagocytophilum-infected neutrophils than with uninfected
neutrophils without affecting endothelial cell integrity. Such a mechanism may
contribute to increased blood and tissue spirochete loads.
Keywords: Lyme disease; Borrelia burgdorferi; Anaplasma phagocytophilum;
Endothelial cells; Neutrophils; Co-infection
Article Outline
1. Introduction
2. Materials and methods
2.1. Cultivation and preparation of cell-free A. phagocytophilum
2.2. Preparation of A. phagocytophilum-infected neutrophils
2.3. Spirochetes
2.4. Human brain microvascular endothelial cells (human BMEC)
2.5. Human systemic endothelial cells
2.6. Endothelial monolayer transmigration assay
2.7. Quantitative PCR
2.8. Statistical tests
3. Results
3.1. Effects of co-incubation of B. burgdorferi with A. phagocytophilum-infected
neutrophils on the integrity of endothelial cell barriers
3.2. Borrelia burgdorferi traversal of endothelial cells in the presence of A.
phagocytophilum infected-neutrophils or uninfected neutrophils
4. Discussion
5. Uncited references
Acknowledgements
References
1. Introduction
Lyme disease is now the most frequently reported arthropod-borne infection in
North America and Europe (CDC, 2002). The bacteria, Borrelia burgdorferi, which
are transmitted to humans by the bite of infected ticks of the Ixodes persulcatus
complex, can infect many tissues including the skin, heart, joints, eye and in addition,
the peripheral and central nervous systems (Steere, 1989 and Kalish, 1993). As the
diversity of clinical presentations for Lyme disease has been recognised, it has been
suggested that concurrent infections by other tick-borne pathogens may influence the
natural course of disease, leading to more severe infection, persistence, even
refractoriness to effective therapies (Belongia, 2002 and Krause et al., 2002).
Anaplasma phagocytophilum, the causative agent of human granulocytic
anaplasmosis (HGA) is also transmitted by I. persulcatus-complex tick bites and
accumulating data suggest that co-infection is not infrequent. In North America and
also in Europe, approximately 10% of all patients with Lyme disease or HGA have
evidence of co-infection with other pathogens (Thompson et al., 2001). Although it is
unclear whether co-infections contribute to the comorbidity, in mice commitment of
immunity toward Th1 reactions directed against the obligate intracellular A.
phagocytophilum allows higher spirochetemia, tissue loads, longer persistence and
increased disease with simultaneous B. burgdorferi infections (Thomas et al., 2001).
Penetration into the blood and out of the bloodstream into sites of infection is a
necessary component for dissemination of pathogens of Lyme disease and HGA,
hence interactions of both pathogens at the level of blood–endothelial cell interface
are critical determinants of dissemination and disease. Borrelia burgdorferi
penetration of endothelial cells results in part from the actions of endothelial cellderived metalloproteases, after binding of spirochetes to intracellular junctions.
Anaplasma phagocytophilum-infected neutrophils are induced for protracted
degranulation, resulting in the elaboration of biologically active molecules, including
chemokines, cytokines and metalloproteases (Choi et al., 2003). Owing to the
production of metalloproteases from A. phagocytophilum-infected neutrophils, we
hypothesised that concurrent infection with B. burgdorferi enhances penetration of the
spirochete through blood–brain barrier (BBB) and systemic endothelial cell barriers.
We tested this non-immunological mechanism using in vitro models of the human
BBB and systemic endothelial cells.
2. Materials and methods
2.1. Cultivation and preparation of cell-free A. phagocytophilum
The A. phagocytophilum strain Webster was cultivated in HL-60 cells in RPMI 1640
medium (GIBCO-BRL) supplemented with 5% FCS and 2 mM L-glutamine (GIBCOBRL) at 37 °C (Choi et al., 2003; Choi and Dumler, 2004). Cell-free A.
phagocytophilum was prepared by sonication of heavily infected HL-60 cells
(Branson Sonifier, VWR Scientific) at duty cycle of 70 and output control of 3 (Choi
et al., 2003 and Garyu et al., 2005). These bacteria were washed and used
immediately to infect 5×105 to 106 human peripheral blood neutrophils. Mockinfected cells were incubated with medium only.
2.2. Preparation of A. phagocytophilum-infected neutrophils
Human peripheral blood neutrophils and monocytes were isolated from EDTAanticoagulated blood of healthy donors by dextran sedimentation followed by Ficoll
density gradient centrifugation (Histopaque; Sigma). The contaminating residual
erythrocytes present in the neutrophil preparations were lysed by exposure to
hypotonic saline (0.2% NaCl) for 30 s and then adjusted back to isotonic conditions
with hypertonic saline (1.8% NaCl) prior to washing in tissue culture medium.
Neutrophil purity was confirmed to be ≥95% by Ramanowsky staining (Hema-3;
Biochemical Sciences, Inc., Swedesboro, NJ), and the viability of cells was
determined to be >98% by trypan blue dye exclusion. Human neutrophils were
obtained with the approval of the Johns Hopkins University School of Medicine
Institutional Review Board and in compliance with all relevant federal guidelines and
institutional policies. Some of the neutrophils were suspended in medium M199
supplemented in 20% FCS and then incubated at 37 °C in 5% CO2 in a humidified
environment.
2.3. Spirochetes
Low-passage (less than five in vitro passages) B. burgdorferi was cultured at 34 °C in
BSK II medium containing 10% rabbit serum as described by Barbour (1984). In our
study, we used B. burgdorferi 297, a strain originally isolated from human
cerebrospinal fluid (Leveris et al., 1995). The bacteria were examined for motility
with dark-field microscope to verify viability and that the organisms were thoroughly
dispersed at the start of all the assays.
2.4. Human brain microvascular endothelial cells (human BMEC)
Human BMEC primary cultures used in this study were described previously
(Persidsky et al., 1997 and Stins et al., 1997; Grab et al., 2004 and Grab et al., 2005).
The cells were cultured in Medium 199 (GIBCO) supplemented with 20% heatinactivated FCS and 1×Glutamax (GIBCO). The cells were grown to confluence on
6.5-mm-diameter collagen-coated Costar inserts with a pore of size of 3.0 μm until
transendothelial electrical resistance (TEER) measurements exceeded 25 Ω×cm2
(Grab et al., 2004).
2.5. Human systemic endothelial cells
The EAhy926 endothelial cell line derived from fusion of A549 cells with primary
human umbilical vein endothelial cells have also been described previously (Edgell et
al., 1983). These were grown in high-glucose (4.5 g/l) DMEM supplemented with
20% heat-inactivated FCS, 1×HT supplement and 1×Glutamax (all from GIBCO).
The cells were grown to confluence on 6.5-mm-diameter collagen-coated Costar
Transwell™ inserts with a pore of size of 3.0 μm until transendothelial electrical
resistance reached stable values <12 Ω×cm2 (Grab et al., 2004).
2.6. Endothelial monolayer transmigration assay
Triplicate wells with and without endothelial cells received the following: medium
only; B. burgdorferi only (ranging from 2×105 to 107); uninfected neutrophils only
(2×105); A. phagocytophilum-infected neutrophils only (2×105); B. burgdorferi (2×105
to 107) and uninfected neutrophils (2×105); B. burgdorferi (2×105 to 107) and A.
phagocytophilum-infected neutrophils (2×105). After 5 h incubation, the TEER was
re-measured and aliquots were removed from the wells beneath the inserts. The
quantity of transmigrating B. burgdorferi was determined for each well by either
dark-field counting in a haemocytometer for initial experiments and then by
quantitative PCR for subsequent experiments. The net transmigration of each barrier
was calculated as a percentage of the number of spirochetes that crossing inserts with
cells relative to the number crossing inserts without endothelial cells.
2.7. Quantitative PCR
Borrelia burgdorferi DNA in transmigrated culture medium (below Transwells) was
prepared using either the GenoM-48 DNA robot or using the Qiagen DNA extraction
kit, both according to the manufacturers' instructions. Borrelia burgdorferi
quantification was performed using quantitative real-time PCR targeting the single
copy chromosomal flaB gene (Leutenneger et al., 1999) using the primers B.398f
(GGGAAGCAGATTTGTTTGACA) and B.484r
(ATAGAGCAACTTACAGACGAAATTAATAGA) with the fluorescent probe
B.421p (FAM- ATGTGCATTTGGTTATATTGAGCTTGATCAGCAA-TAMRA).
Amplifications were performed using either an ABI Taqman 7700 or a BioRad
iCycler iQ5 Multicolor Real Time PCR detector. For standard curve, the flaB gene
amplicon was cloned, plasmid DNA containing the insert was prepared and the DNA
concentration was carefully measured to allow a precise determination of the copy
number of flaB in each standard. Final concentrations of transmigrated B. burgdorferi
were determined using the CT method as per software of the Taqman or iQ5
instruments.
2.8. Statistical tests
Where appropriate, means of transmigration or TEER values were compared using
one-tailed, unpaired or paired Student's t-tests; a P-value <0.05 was considered
significant.
3. Results
3.1. Effects of co-incubation of B. burgdorferi with A.
phagocytophilum-infected neutrophils on the integrity of endothelial
cell barriers
The integrity of EAhy.926 and the human BMEC barriers after co-incubation of B.
burgdorferi with uninfected neutrophils or A. phagocytophilum-infected neutrophils
was similar as measured by TEER (P=0.216; Fig. 1). However, when all of these
conditions were compared with EAhy.926 cells incubated with medium only, there
was a small but significant reduction in TEER at 5 h (P=0.018).
(17K)
Fig. 1. Change in transendothelial electrical resistance of human brain microvascular endothelial cells
and EA.hy926 endothelial cell cultures after incubation with Borrelia burgdorferi (Bb) and neutrophils
or Anaplasma phagocytophilum (Ap)-infected neutrophils.
3.2. Borrelia burgdorferi traversal of endothelial cells in the presence of
A. phagocytophilum infected-neutrophils or uninfected neutrophils
Borrelia burgdorferi transmigration of human BMEC was enhanced in the presence
of A. phagocytophilum-infected neutrophils as compared with uninfected neutrophils.
We conducted three replicated experiments. When 107 B. burgdorferi was used as
inoculum, approximately two-fold enhanced transmigration of B. burgdorferi across
the human BMEC was observed in the presence of A. phagocytophilum infectedneutrophils compared with uninfected neutrophils (P<0.045; Fig. 2). Incubation with
lower spirochete numbers (2×105) revealed that three-fold (6.7 vs. 2.2%) more B.
burgdorferi transmigrated the human BMEC in the presence of A. phagocytophiluminfected neutrophils (P=0.047) and this result was confirmed in a parallel experiment
(Fig. 3). No enhanced transmigration through the EAhy.926 systemic endothelial cell
barriers was observed with A. phagocytophilum-infected neutrophils vs. uninfected
neutrophils (P=0.426).
(16K)
Fig. 2. Borrelia burgdorferi (Bb) transmigration of human brain microvascular endothelial cells
monolayers with and without A. phagocytophilum (Ap)-infected neutrophils at 5 h quantitated by
dark-field microscopy.
(21K)
Fig. 3. Borrelia burgdorferi (Bb) transmigration of endothelial cell monolayers with and without A.
phagocytophilum (Ap)-infected neutrophils at 5 h. Transmigrated spirochetes were quantitated by real
time PCR (Taqman) targeting the single copy chromosomal target flaB. Significant P values are shown
comparing relevant bars.
4. Discussion
While B. burgdorferi occasionally penetrates through the blood–brain barrier to cause
infection in the central nervous system, including infection such as meningitis, A.
phagocytophilum does not (Bakken and Dumler, 2000). However, co-infection of
humans with B. burgdorferi and A. phagocytophilum is increasingly recognised and
animal models suggest that spirochete titres and tissue injury are exacerbated with coinfection (Thomas et al., 2001, Thompson et al., 2001 and Belongia, 2002).
Immunologic control of B. burgdorferi infection, in the absence of other co-infections,
probably requires the active participation of both Th1 and Th2 responses (Thomas et
al., 2001). The mechanism(s) that account for the increased borrelia loads and tissue
inflammation with A. phagocytophilum co-infection is uncertain, although some
studies imply the inappropriate induction of Th1 immunity that is effective for
obligate intracellular pathogens, but may alter control of B. burgdorferi (Thomas et al.,
2001). Our previous studies showed that B. burgdorferi transmigrate endothelial cell
barriers, including the BBB, in part via the action of endothelial cell-derived matrix
metalloproteases (MMPs) (Grab et al., 2005). With A. phagocytophilum infection,
neutrophils are stimulated to degranulate a variety of vesicular components, including
matrix metalloproteases (Choi et al., 2004). In fact, A. phagocytophilum-infected
neutrophils do not adhere to activated endothelial cells because of the secretion of a
sheddase metalloprotease that cleaves neutrophil surface platelet selectin glycoprotein
ligand (PSGL-1, CD162), and because of MMP-induced loss of L-selectin (CD62L)
(Choi et al., 2003).
Based upon this information, we hypothesised that co-infection with both B.
burgdorferi and A. phagocytophilum can result in increased exposure of endothelial
cell barriers to MMPs would enhance B. burgdorferi penetration into tissues or the
CNS. In keeping with this hypothesis, our results in three repeated experiments,
measured by two different approaches, confirm that B. burgdorferi transmigrate
across endothelial cells more in the presence of A. phagocytophilum-infected
neutrophils than with uninfected neutrophils, even in the absence of any adaptive
immune responses (in vitro).
Although the most likely explanation for these observations is the production of
metalloproteases, there are several additional possibilities that will require further
investigation. First, A. phagocytophilum-infected neutrophils are markedly activated
for production of chemokines and IL-6 (Klein et al., 2000; Choi et al., 2005). These
biologically active compounds have multiple effects, including the potential to
enhance changes in vascular permeability, perhaps related to alterations in the
endothelial cell cytoskeleton. Second, A. phagocytophilum infection of neutrophils
impairs their phagocytic capacity, and this could result in an increased availability of
B. burgdorferi to transmigrate (Garyu et al., 2005). Regardless, the combined effects
of enhanced protease, cytokine/chemokine release and impaired neutrophil
phagocytosis with co-infection could lead to enhanced CNS entry of B. burgdorferi
and worsened clinical manifestations of Lyme disease. Precedent for such enhanced
clinical disease in the CNS exists in sheep infected with louping ill virus, a
concurrently tick-transmitted flavivirus of the tick-borne encephalitis group. Louping
ill virus alone initiates a mild clinical disease in sheep (Brodie et al., 1986 and Reid et
al., 1986,); however, with A. phagocytophilum infection, louping ill virus typically
results in severe or fatal meningoencephalitis, although the mechanism of enhanced
CNS infection is not understood.
In summary, our data show the differential enhancement of B. burgdorferi
transmigration across a human BBB model. Further, investigation will be required to
confirm the hypothesis that enhanced transmigration results from MMP-enhanced
tight junction degradation. Importantly, these data provide an alternative explanation
for the enhanced tissue distributions of Lyme disease spirochetes with co-infection
in animal models and set the stage for further work if concurrent HGA proves to
exacerbate Lyme disease and Lyme meningitis.
5. Uncited references
Davenpeck et al. (2000), Roos and Law (2001).
Acknowledgements
EA.hy926 cells were kindly supplied by C. Edgell, University of North Carolina. This
work was supported by a grant from the National Institutes of Health to D.J.G.
(R21AI04894-01).
References
Barbour, 1984 A.G. Barbour, Isolation and cultivation of lyme disease spirochetes,
Yale J. Biol. Med. 57 (1984), pp. 521–525. Abstract-EMBASE | AbstractMEDLINE | Order Document
Belongia, 2002 E.A. Belongia, Epidemiology and impact of coinfections acquired
from Ixodes ticks, Vector Borne Zoonotic Dis. 1 (2002), pp. 265–273. AbstractMEDLINE | Order Document
Brodie et al., 1986 T.A. Brodie, P.H. Holmes and G.M. Urquart, Some aspects of tickborne diseases of British sheep, Vet. Rec. 118 (1986), pp. 415–418. AbstractMEDLINE | Order Document
Centers, 2002 Centers for Disease Control (2002). Lyme Disease—United States,
MMWR 49, pp. 1–102.
Choi et al., 2003 K.-S. Choi, J. Garyu, J. Park and J.S. Dumler, Diminished adhesion
of Anaplasma phagocytophilum infected neutrophils to endothelial cells is associated
with reduced expression of leukocyte surface selectin, Infect. Immun. 71 (2003), pp.
4586–4594. Abstract-Elsevier BIOBASE | Abstract-EMBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Choi et al., 2004 K.-S. Choi, D.J. Grab and J.S. Dumler, Anaplasma phagocytophilum
infection induces protracted neutrophil degranulation, Infect. Immun. 72 (2004), pp.
3680–3683. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Order Document | Full Text via CrossRef
Davenpeck et al., 2000 K.L. Davenpeck, M.E. Brummet, S.A. Hudson, R.J. Mayer
and B.S. Bochner, Activation of human leukocytes reduces surface P-selectin
glycoprotein ligand-1 (PSGL-1, CD162) and adhesion to P-selectin in vitro, J.
Immunol. 165 (2000) (5), pp. 2764–2772. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document
Edgell et al., 1983 C.J. Edgell, C.C. McDonald and J.B. Graham, Permanent cell-line
expressing human VIII-related antigen established by hybridization, Proc. Natl Acad.
Sci. USA 80 (1983), pp. 3734–3737. Abstract-MEDLINE | Abstract-EMBASE |
Order Document
Garyu et al., 2005 J.W.A. Garyu, K.-S. Choi, D.J. Grab and J.S. Dumler, Defective
phagocytosis in Anaplasma phagocytophilum infected neutrophils, Infect. Immun.
(2005), pp. 1187–1190. Abstract-EMBASE | Abstract-Elsevier BIOBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Grab et al., 2004 D.J. Grab, O. Nikolskaia, Y.V. Kim, J.D. Lonsdale-Eccles, S. Ito, T.
Hara, T. Fukuma, E. Nyarko, K.J. Kim, M.F. Stins, M.J. Delannoy, J. Rodgers and
K.S. Kim, African trypanosome interactions with an in vitro model of the human
blood–brain-barrier, J. Parasitol. 90 (2004) (5), pp. 970–979. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-GEOBASE | Abstract-Elsevier BIOBASE | Order
Document
Grab et al., 2005 D.J. Grab, G. Perides, J.S. Dumler, K.J. Kim, J. Park, Y.V. Kim, O.
Nikolskaia, K.S. Choi, M.F. Stins and K.S. Kim, Borrelia burgdorferi, host-derived
proteases, and the blood–brain barrier, Infect. Immun. 73 (2005) (4), p. 2569.
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Kalish, 1993 R.A. Kalish, Lyme disease, Rheum. Dis. Clin. North Am. 19 (1993),
pp. 399–426. Abstract-EMBASE | Abstract-MEDLINE | Order Document
Krause et al., 2002 P.J. Krause, K. McKay, C.A. Thompson, V.K. Sikand, R. Lentz, T.
Lepore, L. Closter, D. Christianson, S.R. Telford, D. Persing, J.D. Radolf and A.
Spielman, Disease-specific diagnosis of coinfecting tickborne zoonoses: babesiosis,
human granulocytic ehrlichiosis, and Lyme disease, Clin. Infect. Dis. 34 (2002), pp.
1184–1191. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document | Full Text via CrossRef
Leutenneger et al., 1999 C.M. Leutenneger, Pusterla, C.N. Mislin, R. Weber and H.
Lutz, Molecular evidence of coinfection of ticks with Borrelia burgdorferi sensu lato
and the human granulocytic erlichiosis agent in Sitzerland, J. Clin. Microbiol. 37
(1999), pp. 3390–3391.
Leveris et al., 1995 D. Leveris, A. Gazumyan and I. Schwartz, Molecular typing of
Borrelia burgdorferi sensu lato by PCR-restriction fragment length polymorphism
analysis, J. Clin. Microbiol. 33 (1995), pp. 589–595.
Persidsky et al., 1997 Y.M. Persidsky, M. Stins, D. Way, M.H. Witte, M. Weinand,
K.S. Kim, P. Bock, H.E. Gendelman and M. Fiala, A model for monocyte migration
through the blood–brain barrier during HIV-1 encephalitis, J. Immunol. 158 (1997),
pp. 3499–3510. Abstract-MEDLINE | Order Document
Reid et al., 1986 H.W. Reid, D. Buxton, I. Pow, T.A. Brodie, P.H. Holmes and G.M.
Urquart, Response of sheep to experimental concurrent infection with tick-borne fever
(Cytoecetes phagocytophila) and louping-ill virus, Res. Vet. Sci. 41 (1986), pp. 56–62.
Abstract-MEDLINE | Order Document
Roos and Law, 2001 D. Roos and S.K. Law, Hematologically important mutations:
leukocyte adhesion deficiency, Blood Cells. Mol. Dis. 27 (2001), p. 1000. Abstract |
Abstract + References | PDF (42 K)
Steere, 1989 Steere, A.C. Lyme Disease. N. Engl. J. Med. 321, 586–596.
Stins et al., 1997 M.F. Stins, F. Gilles and K.S. Kim, Selective expression of adhesion
molecules on human brain microvascular endothelial cells, J. Neuroimmunol. 76
(1997), pp. 81–90. SummaryPlus | Full Text + Links | PDF (631 K)
Thomas et al., 2001 V. Thomas, J. Anguita, S.W. Barthold and E. Fikrig, Coinfection
with Borrelia burgdorferi and the agent of human granulocytic erhlichioses alters
murine immune responses, pathogen burden, and severity of lyme arthritis, Infect.
Immun. 69 (2001), pp. 3359–3371. Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Abstract-EMBASE | Order Document | Full Text via CrossRef
Thompson et al., 2001 C. Thompson, A. Spielman and P.J. Krause, Coinfecting deerassociated zoonoses: lyme disease, babesioses, erlichioses, Clin. Infect. Dis. 33
(2001), pp. 676–685. Abstract-EMBASE | Abstract-Elsevier BIOBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Corresponding author. Tel.: +1 410 955 8654; fax: +1 443 287 3665.
International Journal for Parasitology
Article in Press, Uncorrected Proof
Functionality of Borrelia burgdorferi LuxS: The
Lyme disease spirochete produces and responds to
the pheromone autoinducer-2 and lacks a complete
activated-methyl cycle
Kate von Lackuma, 1, Kelly Babba, 1, Sean P. Rileya, 1, Rachel L. Wattiera, b, 2,
Tomasz Bykowskia and Brian Stevensona, ,
a
Department of Microbiology, Immunology, and Molecular Genetics, College of
Medicine, University of Kentucky, MS 415 Chandler Medical Center, Lexington,
Kentucky 40536-0298, USA
b
Agricultural Biotechnology Program, College of Agriculture, University of Kentucky,
Lexington, Kentucky, USA
Available online 10 March 2006.
Abstract
Borrelia burgdorferi produces Pfs and LuxS enzymes for breakdown of the toxic
byproducts of methylation reactions, producing 4,5-dihydroxy-2,3-pentanedione
(DPD), adenine, and homocysteine. DPD and its spontaneously rearranged derivatives
constitute a class of bacterial pheromones named autoinducer-2 (AI-2). We describe
that B. burgdorferi produces DPD during laboratory cultivation. Furthermore,
addition of in vitro synthesized DPD to cultured B. burgdorferi resulted in altered
expression levels of a specific set of bacterial proteins, among which is the outer
surface lipoprotein VlsE. While a large number of bacteria utilize homocysteine, the
other LuxS product, for synthesis of methionine as part of the activated-methyl cycle,
B. burgdorferi was found to lack that ability. We propose that the main function of B.
burgdorferi LuxS is to synthesize DPD and that the Lyme disease spirochete
utilizes a form of DPD as a pheromone to control gene expression.
Keywords: Borrelia burgdorferi; Quorum sensing; Pheromone; Bacterial gene
regulation; Homocysteine; Methionine
Article Outline
Introduction
Materials and methods
Bacteria and growth conditions
In vitro synthesis of DPD
Vibrio harveyi bioassay of AI-2
Genomic analyses
Borrelia burgdorferi genomic libraries construction and analyses
Methionine synthase assay
Results
Borrelia burgdorferi synthesizes AI-2 during laboratory cultivation
Borrelia burgdorferi modulates protein expression in response to DPD
Borrelia burgdorferi lacks a complete activated-methyl cycle
Many other pathogenic spirochete species lack activated-methyl cycles
Discussion
Acknowledgements
References
Introduction
As do most other organisms, the Lyme disease spirochete Borrelia burgdorferi
lives in a series of dynamic environments. This bacterium persists in nature through
cycles requiring infection of both vertebrates and ticks. During these infectious cycles,
the spirochete must not only adapt to life in two extremely different types of host, but
must also manage efficient transmission between the two. These constraints require
that for B. burgdorferi to survive, it must precisely control gene expression so that
only appropriate proteins are expressed during each stage of infection (Schwan, 1996;
Indest et al., 2001b; Seshu and Skare, 2001; Anguita et al., 2003). Since disruption of
regulatory networks that control expression of infection-associated proteins is a key
goal for development of novel therapies to prevent and treat Lyme disease,
characterization of those control mechanisms will be of great value.
A growing number of bacteria are known to utilize derivatives of 4,5-dihydroxy-2,3pentanedione (DPD) as a pheromone to control gene expression (Xavier and Bassler,
2003). DPD can spontaneously cyclize and/or interact with borate to form at least two
different, interconvertible molecules collectively described as autoinducer-2 (AI-2,
Fig. 1) (Chen et al., 2002; Miller et al., 2004). Although AI-2 was originally described
as a quorum sensing molecule for measuring bacterial density (Surette et al., 1999), it
appears that many bacteria instead use AI-2 as a pheromone during the exponential
growth phase to signal metabolic status and fitness (Xavier and Bassler, 2003). In a
previous study, our laboratory demonstrated that B. burgdorferi encodes a functional
copy of LuxS, the enzyme that synthesizes DPD (Stevenson and Babb, 2002; Babb et
al., 2005).
(6K)
Fig. 1. Composite diagram of metabolic pathways that constitute activated-methyl cycles.
Abbreviations: SAM, S-adenosylmethionine; SAH, S-adenosylhomocysteine; SRH, Sribosylhomocysteine; DPD, 4,5-dihydroxy-2,3-pentanedione; Me-THF, 5-methyltetrahydrofolate; THF,
tetrahydrofolate. DPD can spontaneously cyclize and/or combine with borate to produce at least two
different, interconvertible forms of AI-2 (Schauder et al., 2001; Chen et al., 2002; Miller et al., 2004).
Most organisms contain either the SAH hydrolase pathway or the Pfs/LuxS pathway for homocysteine
synthesis, although some organisms contain both (Sun et al., 2004). Figure adapted from Babb et al.
(2005).
Many bacteria utilize LuxS as part of the activated-methyl cycle (Fig. 1). This series
of reactions generates a methyl donor molecule, S-adenosylmethionine (SAM) for use
in a wide variety of methylation reactions, then detoxifies byproducts and regenerates
SAM. The second product of LuxS is homocysteine, which many organisms
metabolize to produce methionine. For bacteria with a complete activated-methyl
cycle such as illustrated in Fig. 1, LuxS plays an important role in maintaining a pool
of free methionine in the cell. For example, mutants of Escherichia coli defective in
methionine synthase are unable to grow in minimal media that lack added methionine
(Urbanowski et al., 1987; Matthews, 1996). This function of LuxS has led to
suggestions that the primary role of that enzyme in bacteria is to synthesize
homocysteine for recycling, rather than for synthesis of DPD, and that effects of luxS
mutations on bacterial pathogenicity are due to methionine starvation (Winzer et al.,
2002a, Winzer et al., 2002b and Winzer et al., 2003; Blevins et al., 2004). For this
reason, we examined B. burgdorferi in detail to determine whether that bacterium can
also regenerate methionine from homocysteine, and found that it lacks such an ability,
indicating that the Lyme disease spirochete produces LuxS for a purpose other than
homocysteine synthesis.
Materials and methods
Bacteria and growth conditions
B. burgdorferi were cultured in Barbour–Stoenner–Kelly II broth (Barbour, 1984). B.
burgdorferi strain 297 is an infectious, wild-type bacterium and was originally
isolated from human cerebrospinal fluid in New York, USA (Steere et al., 1983).
Strain AH309 is a luxS-deficient mutant of strain 297 (Hübner et al., 2003) and was
obtained from Michael Norgard (University of Texas Southwestern, Dallas, USA).
For analyses of AI-2 production by B. burgdorferi, cultures of strains 297 and AH309
were grown at 34 °C to densities of approximately 107 bacteria per ml. Those cultures
were then placed at 23 °C, which greatly retards bacterial growth (Stevenson et al.,
1995). Aliquots of each initial culture were diluted 1:1000 into fresh medium on 6
subsequent days, with each secondary culture incubated at 34 °C to allow optimal
growth. On day 7, supernatant was removed from each secondary culture and assayed
for AI-2 content. Through this technique, cultures with essentially the same starting
densities could be grown under the same conditions for 1–7 days and then assayed
simultaneously. Bacterial density of each culture was also determined at that time,
using a Petroff–Hauser counting chamber and dark-field microscopy.
E. coli strain GS162 is wild type for both methionine synthase genes, while GS472 is
defective in both metH and metE. Both were obtained from George Stauffer
(University of Iowa, USA) (Urbanowski et al., 1987). For attempted complementation
of E. coli metE and metH, transformed GS472 was plated on M9 minimal salts agar
supplemented with 1 μg/ml thiamin, with this same medium plus 100 μg/ml
methionine serving as a positive control for growth (Urbanowski et al., 1987;
Sambrook et al., 1989; Zeh et al., 2002). For use as a positive control for methionine
synthase analyses, GS162 was cultured in M9 supplemented with 3.4 μg/ml
hydroxocobalamin, 1 μg/ml thiamin and 100 μg/ml phenylalanine (Urbanowski et al.,
1987; Jarrett et al., 1997).
Vibrio harveyi strain BB170 (Bassler et al., 1997) was obtained from Bonnie Bassler
(Princeton University, USA). V. harveyi were cultivated in modified autoinducer
bioassay medium (Greenberg et al., 1979) containing 40 μM sodium borate (pH=6.8).
Leptospira interrogans serovar pomona type kennewicki strain JEN4 (Nally et al.,
2001) was cultured at 30 °C in Bovuminar PLM-5 medium (Intergen, Purchase, NY).
In vitro synthesis of DPD
DPD was synthesized from S-adenosylhomocysteine nucleosidase (SAH) (Sigma, St.
Louis, MO, USA), using equimolar concentrations of recombinant B. burgdorferi
LuxS and Pfs proteins. Reaction products were quantified using Ellman's reaction, as
previously described (Schauder et al., 2001; Babb et al., 2005).
Vibrio harveyi bioassay of AI-2
V. harveyi strain BB170 autofluoresces in the presence of AI-2 in a dose-dependent
manner, enabling its use in a bioassay specific for AI-2 (Bassler et al., 1997; Taga,
2005). Bioassays were performed as previously described (Surette and Bassler, 1998;
Stevenson and Babb, 2002). AI-2 activities are reported as average luminescence
values of each strain 297 assay minus the average luminescence of equivalent cultures
of strain AH309. Studies were repeated at least three times using independent cultures.
Genomic analyses
Genome databases of B. burgdorferi and three other spirochetal species were queried
for presence of specific gene homologs. Complete genome sequences of B.
burgdorferi strain B31 (Fraser et al., 1997; Casjens et al., 2000), Treponema pallidum
Nichols strain (Fraser et al., 1998), T. denticola ATCC 35405 (Seshadri et al., 2004),
L. interrogans serovar Lai strain 56601 (Ren et al., 2003), and L. interrogans serovar
Copenhageni strain Fiocruz L1-130 (Nascimento et al., 2004a) were accessed through
the Institute for Genomic Research microbial database at http://www.tigr.org. To
search for homologs of enzymes involved in SAH metabolism, each genome was
queried using BLAST-P with the amino acid sequences of the biochemically
characterized V. harveyi and B. burgdorferi LuxS, E. coli Pfs, and Rhodobacter
capsulatus SAH hydrolase proteins, and the hypothetical SAH hydrolase of L.
interrogans (GenBank accession numbers AF120098, AAC66762, U24438, M80630,
and AAN51667, respectively). To search for homologs of methionine synthase
enzymes, the genomes were queried with protein sequences of the MetE homologs of
E. coli, Mycobacterium tuberculosis, the archaeon Methanobacterium
thermoautotrophicum, and the plant Solanum tuberosum; the MetH homologs of E.
coli, L. interrogans, and Synechococcus sp. WH8102; the methylmethioninedependent YagD enzyme of the E. coli CP4-6 prophage; and the human betaine-
dependent methionine synthase (GenBank accession numbers M87625, AAK45422,
X92082, AF082893, P13009, AAN51667, CAE07753, AAC73364, and U50929,
respectively). Each identified spirochetal gene was used to re-query all of the
spirochete genomes, along with the complete GenBank database at
http://www.ncbi.nlm.nih.gov/blast/.
Borrelia burgdorferi genomic libraries construction and analyses
Total genomic DNA of infectious, wild-type B. burgdorferi strain B31 was digested
using either EcoRI or PstI, then ligated with appropriately digested pUC118 (Vieira
and Messing, 1987). Each ligation mixture was used to transform E. coli strain GS472
and bacteria plated on solid M9 medium lacking methionine.
Methionine synthase assay
5-methyltetrahydrofolate-homocysteine S-methyltransferase activity was determined
as described by Jarrett et al. (1997). Produced 14C-labeled methionine was separated
from the reactants by passage through AG 1-X8 columns (Bio-Rad), then measured
using a scintillation counter. Both E. coli strains GS162 and GS472 were analyzed as
controls, and all experiments included a negative control that lacked any bacterial
lysate. Number of decays per minute in the column flow-through of the negative
control reaction was then subtracted from each experimental value.
Results
Borrelia burgdorferi synthesizes AI-2 during laboratory cultivation
Cultured B. burgdorferi appear to utilize SAM in a variety of methylation reactions
(Hughes and Johnson, 1990; Fraser et al., 1997; Charon and Goldstein, 2002). Both
immunoblot analysis and RT-PCR demonstrated that cultured B. burgdorferi also
produce both Pfs and LuxS enzymes (Hübner et al., 2003; Babb et al., 2005).
Although earlier assays failed to detect production of DPD by cultivated B.
burgdorferi (Stevenson and Babb, 2002; Hübner et al., 2003), we have since refined
analysis techniques and found that the spirochete does indeed synthesize DPD, as
described below.
The most sensitive assay available for detection of DPD uses the marine bacterium V.
harveyi as a biosensor (Taga, 2005). V. harveyi recognizes a cyclic, borate derivative
of DPD and responds by autofluorescing at levels proportional to the amount of added
DPD. Generally, unused growth medium of the tested microorganism is utilized as a
negative control, and values obtained for the control then subtracted from
experimental results. However, B. burgdorferi is cultured in a very rich, complex
medium. We observed that addition of unused B. burgdorferi culture medium to V.
harveyi caused the reporter bacteria to grow far more rapidly than did addition of B.
burgdorferi culture supernatant, yielding the artifactual result of greater
bioluminescence levels being attained from unused medium than from spent medium
(Babb et al., 2005). To avoid this artifact, we instead compared bioassay results of
wild-type strain 297 and an isogenic luxS mutant, AH309, using results from the
mutant as background. Equivalent cultures of each strain were simultaneously
examined during early through late exponential phases of growth, as well as after
reaching stationary phase (Fig. 2). Significant levels of DPD were found in the
supernatants of cultured B. burgdorferi 297, reaching a maximum during the midexponential phase and then decreasing as cultures entered stationary phase. The
reduced levels of DPD in stationary phase cultures suggest that B. burgdorferi
actively removes the molecule from the medium, as do several other studied bacteria
(Surette and Bassler, 1999; Taga et al., 2001 and Taga et al., 2003; Hardie et al.,
2003; Xavier and Bassler, 2003).
(20K)
Fig. 2. Production of AI-2 by Borrelia burgdorferi. Strains 297 (wild-type) and AH309 (luxS) were
diluted into fresh medium and grown for 1–7 days at 34 °C. Culture densities are illustrated as a growth
curve (left Y-axis). Vibrio harveyi bioassays were performed for each culture, with luminescence values
obtained for the negative control AH309 being subtracted from corresponding values obtained for
strain 297. Statistically significant (>90% confidence interval by independent sample t-test) mean
luminescence values are illustrated as rectangles (right Y-axis). Error bars represent standard deviations
of 2–5 separate experiments.
Since culture pH may affect bioassay results (DeKeersmaecker and Vanderleyden,
2003), the pH of the B. burgdorferi culture medium was examined at all time points
and found to have dropped only slightly during the studies, from an initial 7.5 to a
final pH of 6.8 after 3 days at stationary phase, so it is unlikely that the pH of the
tested B. burgdorferi culture media influenced these results. However, V. harveyi also
controls bioluminescence in response to cellular levels of cAMP, repressing light
generation in the presence of PTS sugars such as glucose (Chatterjee et al., 2002;
DeKeersmaecker and Vanderleyden, 2003). Unfortunately, all culture media capable
of supporting B. burgdorferi growth include glucose as a primary carbon source, as
well as other, essential PTS carbohydrates such as N-acetylglucosamine (Barbour,
1984; von Lackum and Stevenson, 2005). Furthermore, B. burgdorferi is capable of
high growth rates for 3–4 days in media lacking glucose, due to energy provided by
other medium components (von Lackum and Stevenson, 2005). Media capable of
supporting growth of these fastidious spirochetes but lack trace carbohydrates do not
exist. The unavoidable effects of catabolite repression on V. harveyi reporter strain
bioluminescence lead us to suspect that the DPD synthesis results reported for B.
burgdorferi may be artificially low (Babb et al., 2005).
Borrelia burgdorferi modulates protein expression in response to DPD
Results of the above-described studies indicated that B. burgdorferi can and does
synthesize DPD. Two additional studies indicated that B. burgdorferi utilizes DPD (or
a derivative of that molecule) as an AI-2 pheromone to control protein expression.
First, a luxS-deficient mutant of E. coli was complemented with the B. burgdorferi
luxS gene, and demonstrated to synthesize DPD (Stevenson and Babb, 2002).
Addition of sterile culture supernatant from those complemented bacteria to B.
burgdorferi influenced expression levels of more than 50 B. burgdorferi proteins,
including the factor H-binding Erp outer surface proteins (Stevenson and Babb, 2002).
Culture supernatants from the uncomplemented E. coli luxS mutant had no detectable
effects.
Second, DPD was synthesized in vitro and B. burgdorferi cultures examined for
effects of the added compound (Babb et al., 2005). Again, expression levels of a
specific subset of B. burgdorferi proteins were measurably affected by addition of
reaction products to cultures (Babb et al., 2005). Furthermore, the effect of DPD
addition was dose dependent, as would be expected for a pheromone. Control assays
in which only homocysteine or SAH were added did not yield detectable changes to
expression levels of any B. burgdorferi protein. The effects of adenine, the third
product of the Pfs and LuxS reactions were not examined, since B. burgdorferi is an
auxotroph for that molecule (Wyss and Ermert, 1996) and culture medium contains a
substantial concentration of adenine (Barbour, 1984). These control experiments
demonstrated that the effects of adding reaction products to culture medium were due
to DPD alone. Parallel studies of wild-type strain 297 and its isogenic luxS mutant
AH309 revealed that some proteins were detectable in lysates of uninduced strain 297,
but were not visible in lysates of AH309, suggesting that the amounts of DPD
produced by wild-type B. burgdorferi during laboratory cultivation cause significant
effects on protein levels. Additionally, AH309 responded to addition of DPD in
manners similar to the wild-type strain, indicating that responses to that molecule can
occur independently of LuxS (Babb et al., 2005).
Both proteomic and microarray analyses were utilized to identify B. burgdorferi
proteins and genes that are controlled through DPD (Babb et al., 2005). Most of the
tentatively identified proteins have yet to be characterized. We are in the process of
developing reagents to confirm those preliminary data and further characterize DPDregulated genes and proteins.
Previously characterized proteins whose expression levels have been demonstrated to
be influenced by DPD include the Erp protein family (Stevenson and Babb, 2002).
These outer membrane lipoproteins are expressed during transmission between ticks
and mammals and during persistent mammalian infection, but not during tick
infection (Lam et al., 1994; Akins et al., 1995; Stevenson et al., 1995 and Stevenson
et al., 1998; Suk et al., 1995; Wallich et al., 1995; Das et al., 1997; El-Hage et al.,
2001; Gilmore et al., 2001; Hefty et al., 2001 and Hefty et al., 2002; McDowell et al.,
2001; Miller et al., 2003 and Miller et al., 2005; Miller and Stevenson, 2004). Many
members of the Erp protein family have been demonstrated to bind the host
complement regulator molecule factor H, suggestive of roles in establishment and
maintenance of mammalian infection (Hellwage et al., 2001; Kraiczy et al., 2001a,
Kraiczy et al., 2001b, Kraiczy et al., 2003 and Kraiczy et al., 2004; Alitalo et al.,
2002; Stevenson et al., 2002; McDowell et al., 2003; Metts et al., 2003). Along with
the effects of DPD, erp genes are also controlled by environmental temperature and
uncharacterized chemical signals (Stevenson et al., 1995; Akins et al., 1998; Babb et
al., 2001 and Babb et al., 2004; Hefty et al., 2001; El-Hage and Stevenson, 2002). In
other studies, we identified DNA sequences involved in control of erp gene
transcription (Babb et al., 2004) and are continuing to explore the mechanism by
which DPD affects Erp expression.
We also identified that B. burgdorferi increases expression of the polymorphic surface
protein VlsE in directly proportional response to DPD concentration (Babb et al.,
2005). VlsE is expressed during mammalian infection, where it protects the bacterium
from host antibodies through an antigenic variation mechanism (Zhang et al., 1997;
Zhang and Norris, 1998a and Zhang and Norris, 1998b; Liang et al., 1999).
Regulatory mechanisms controlling vlsE expression are also quite complex, and
include environmental signals such as temperature and pH and interactions with
mammalian cell membranes (Hudson et al., 2001; Indest et al., 2001a; Ohnishi et al.,
2003; K. von Lackum, K. Babb, S.P. Riley, R.L. Wattier, T. Bykowski, B. Stevenson,
unpublished results). As with the erp loci, the vlsE promoter/operator region
specifically binds multiple B. burgdorferi cytoplasmic proteins (T. Bykowski, K.
Babb, and B. Stevenson, unpublished results), one or more of which may be
responsible for the effects of DPD on gene expression.
Borrelia burgdorferi lacks a complete activated-methyl cycle
As noted above, evidence indicates that B. burgdorferi utilizes SAM as a methyl
donor for many cellular reactions. We have demonstrated that the Lyme disease
spirochete expresses functional Pfs and LuxS enzymes, and can therefore detoxify
SAH to yield DPD, adenine, and homocysteine (Babb et al., 2005). Additional studies
demonstrated that B. burgdorferi also encodes a functional MetK for synthesis of
SAM from methionine (S.P. Riley and B. Stevenson, unpublished results). Almost all
examined organisms, from bacteria to plants to animals, possess complete activatedmethyl cycles and regenerate methionine from homocysteine (Fig. 1) (Sun et al.,
2004). For this reason, it has been suggested that the major, and possibly the only,
reason bacteria possess LuxS is to produce homocysteine for re-synthesis of
methionine (Winzer et al., 2002a, Winzer et al., 2002b and Winzer et al., 2003;
Blevins et al., 2004). However, the following studies indicated that B. burgdorferi
lacks the ability to synthesize methionine.
The genome sequence of B. burgdorferi strain B31 was examined for an open reading
frame (ORF) homologous to a previously characterized methionine synthase. The two
major classes of this enzyme use 5-methyltetrahydrofolate or its derivatives as the
methyl donor. The best characterized methionine synthases are the MetH and MetE
proteins of E. coli. Proteins homologous to one or both these enzymes have been
found in nearly every examined prokaryote and eukaryote (Sun et al., 2004). MetH
and MetE enzymes are commonly referred to as cobalamin-dependent and cobalaminindependent methionine synthases, respectively (González et al., 1992). Two other
identified types of methionine synthase use either betaine or methylmethionine as the
methyl donor (Garrow, 1996; Neuhierl et al., 1999; Thanbichler et al., 1999). Both
those enzymes share very similar amino acid sequences with cobalamin-dependent
methionine synthases (Garrow, 1996; Thanbichler et al., 1999). BLAST-P queries
against the predicted proteins of B. burgdorferi indicated that this bacterium lacks a
protein with recognizable homology to any known methionine synthase.
To examine the possibility that B. burgdorferi may encode a completely novel
methionine synthase, we used plasmid libraries of B. burgdorferi DNA in attempts to
complement an E. coli metE metH mutant. While this technique had previously been
used to clone methionine synthase genes from organisms as evolutionarily distant
from E. coli as the potato (Zeh et al., 2002), all attempts have failed to identify such a
gene in B. burgdorferi.
Finally, we biochemically analyzed cellular extracts of B. burgdorferi for methionine
synthase activity. Consistent with data from our genomic and cloning analyses, no
enzymatic activity could be detected in cell-free extracts of this spirochete (data not
shown). Control studies with wild-type E. coli detected enzyme activity, as expected.
Many other pathogenic spirochete species lack activated-methyl cycles
Results of our studies on B. burgdorferi prompted us to examine other species of
spirochetes for possible methionine synthases. Examination of the unpublished
genome sequences of the relapsing fever spirochetes B. hermsii and B. turicatae
indicates that both possess luxS homologs, yet lack homologs of any known
methionine synthase (Tom Schwan, pers. comm.). The causative agent of syphilis, T.
pallidum, contains a homolog of pfs, ORF TP0170. However, T. pallidum lacks genes
for either LuxS or methionine synthase, and so probably does not encode a complete
activated-methyl cycle (Fig. 3). The periodontal disease-associated spirochete T.
denticola likewise contains a pfs homolog (ORF TDE0105) and lacks both luxS and a
methionine synthase gene. Hence, none of these Treponema species is predicted to
synthesize DPD. Related to the lack of methionine synthase genes in these spirochetes,
neither B. burgdorferi nor T. pallidum encode homologs of any cobalamin-dependent
enzyme or any proteins involved in either cobalamin synthesis or transport (Rodionov
et al., 2003). These data indicate that an activated-methyl cycle is completely
unnecessary for any of these pathogenic spirochetes to survive in nature.
(5K)
Fig. 3. Experimentally determined metabolic pathways found in Borrelia burgdorferi. The Lyme
disease spirochete utilizes methionine to produce SAM and detoxifies SAH to DPD, adenine, and
homocysteine via Pfs and LuxS. This bacterium is unable to regenerate methionine from homocysteine.
Among the six spirochete species for which genome sequence data are available, only
L. interrogans encodes a potential homocysteine salvage enzyme, an ortholog of
MetH (Fig. 4). Consistent with that observation, analysis of L. interrogans lysates
detected levels of methionine synthase activity that were comparable to wild-type E.
coli controls (data not shown). L. interrogans contains a gene homologous to SAH
hydrolases (ORF LB106), but lacks homologs of either pfs or luxS. Infectious
leptospires also encode homologs of many other biosynthetic enzymes, as well as
proteins involved with cobalamin metabolism (Picardeau et al., 2003; Ren et al.,
2003; Rodionov et al., 2003; Nascimento et al., 2004a and Nascimento et al., 2004b;
Sekowska et al., 2004). We conclude that L. interrogans, alone among the examined
spirochete species, encodes a complete activated-methyl cycle, and can regenerate
methionine from homocysteine (Fig. 5). It is also apparent that the leptospirosis
spirochete cannot synthesize DPD.
(4K)
Fig. 4. Metabolic pathways of the syphilis spirochete Treponema pallidum and the peridontitisassociated spirochete T. denticola, as determined by genomic analyses. These spirochetes produce
SAM from methionine for methylation reactions, then detoxify SAH to SRH and adenine via Pfs.
Neither bacterium is predicted to regenerate methionine or to produce DPD.
(6K)
Fig. 5. Metabolic pathways of the leptospirosis agent, Leptospira interrogans, as determined by
genomic analyses. This spirochete species is predicted to encode a complete activated-methyl cycle,
with a single-step detoxification of SAH to homocysteine and adenosine. L. interrogans lacks a
homolog of LuxS and is not predicted to synthesize DPD.
Discussion
Our studies demonstrated that B. burgdorferi detoxifies SAH by converting that
molecule into DPD, adenine, and homocysteine. The Pfs- and LuxS-catalyzed
reactions occur during laboratory cultivation, with DPD accumulating during the
exponential phase of growth. However, biochemical and genomic analyses indicated
that B. burgdorferi lacks a complete activated-methyl cycle, and is unable to
regenerate methionine from homocysteine. These data lead us to conclude that the
Lyme disease spirochete synthesizes LuxS for a purpose other than production of
homocysteine for regeneration of methionine.
We propose that B. burgdorferi produces a LuxS enzyme for the express purpose of
synthesizing DPD. Several species of bacteria utilize DPD or a derivative as an AI-2
pheromone to control gene expression, and our studies indicate that B. burgdorferi is
to be included among that list. The finding that relapsing fever Borrelia species also
contain luxS raises the possibility that those infectious spirochetes may likewise use
DPD as a signal. The mechanism by which B. burgdorferi senses DPD as a signal
molecule is not yet known, as the sequenced genome does not encode recognizable
homologs of proteins known to function in DPD sensing by other bacteria (Stevenson
et al., 2003). However, we note that the two Gram-negative bacterial species for
which the AI-2 sensors have been defined use extremely different mechanisms, so it is
quite possible that the distantly related spirochetes use a completely novel
sensor/regulatory mechanism (Bassler et al., 1994; Taga et al., 2001; Stevenson et al.,
2003). We are continuing studies to characterize the mechanisms by which AI-2dependent regulation occurs in B. burgdorferi, as well as examining other spirochetes
for use of this pheromone.
Two recent publications reported that a luxS mutant of B. burgdorferi was capable of
infecting both mice and ticks, leading those authors to suggest that neither LuxS nor
AI-2 are necessary for infection processes (Hübner et al., 2003; Blevins et al., 2004).
However, there are significant questions about how to interpret results of those
experiments due to the process by which the mutant bacteria were derived: Bacteria
were transformed by electroporation, briefly cultured in liquid medium with a
selective antibiotic, placed in a dialysis bag that was then implanted in the peritoneum
of a rat for 15 days, then removed from the dialysis bag, injected into a mouse, and,
after 2 weeks of infection, a skin biopsy was cultured in liquid medium and, finally,
plated in solid medium (Hübner et al., 2003). Bacteria from two resulting colonies
were then tested for ability to infect mice. Since this complicated selection scheme
mandated that bacteria maintain infectivity, it is impossible to know whether bacteria
that survived the process contain only the introduced luxS lesion or if spontaneous
mutations arose at additional loci to compensate for the loss of luxS. Moreover, none
of those earlier studies compared relative levels of infectivity of mutant and wild-type
bacteria. For these reasons, it is not yet known how critical AI-2-mediated genetic
regulation is for B. burgdorferi pathogenesis.
That B. burgdorferi does not regenerate methionine from homocysteine is consistent
with other indications that it is an auxotroph for all amino acids. Culture media
capable of supporting B. burgdorferi growth must contain all amino acids and many
other nutrients (Barbour, 1984; Pollack et al., 1993). Growth of relapsing fever
borreliae and oral treponemes also requires very complex culture media (Kelly, 1971;
Wyss, 1992). The genome sequences of borreliae and treponemes indicate homologs
of proteases and transporters of polypeptides and amino acids, but few or no
biosynthetic enzymes (Fraser et al., 1997 and Fraser et al., 1998; Seshadri et al., 2004).
This probably explains why all identified species of Borrelia or Treponema are found
only in close association with host animals. In contrast, the sole spirochete known to
possess a complete activated-methyl cycle, L. interrogans, is a water-borne pathogen
capable of survival outside animal hosts. Additionally, L. interrogans encodes a great
many amino acid biosynthetic enzymes (Picardeau et al., 2003; Ren et al., 2003;
Nascimento et al., 2004a and Nascimento et al., 2004b). These observations indicate
that while the free-living leptospires probably require a complete activated-methyl
cycle in order to survive in methionine-deficient environments, the obligatory
parasitic borreliae and treponemes do not need that pathway since they can scavenge
sufficient quantities of methionine from their hosts for all metabolic processes.
B. burgdorferi produces maximum levels of DPD during the exponential phase of
growth, as is also found with many other bacteria (Xavier and Bassler, 2003). DPD
synthesis increases during rapid bacterial growth, presumably due to increased
number of methylation reactions, and is thereby thought to serve as a signal of
bacterial fitness (Xavier and Bassler, 2003). DPD/AI-2 may thus function to
coordinate growth-related processes throughout a population or serve as a form of
positive feedback to the cell that produced it, or a combination of those two
possibilities. Since DPD synthesis is often unrelated to culture density, it is probably
more accurate to think of AI-2 as a pheromone than as a ‘quorum sensing’ molecule.
In conclusion, B. burgdorferi can and does synthesize DPD. Furthermore, B.
burgdorferi uses either DPD or a derivative thereof as an AI-2 pheromone to control
expression levels of a specific subset of bacterial proteins. Those observations, along
with the lack of a complete activated-methyl cycle, lead us to hypothesize that the
Lyme disease spirochete produces LuxS for the express purpose of synthesizing
DPD pheromone. Since maximal synthesis of DPD during cultivation was observed
during the exponential phase of growth, it is likely that the pheromone also functions
during periods of rapid growth in the natural infectious cycle. B. burgdorferi within
the midguts of infected, feeding ticks experience dramatic increases in growth rate
(Benach et al., 1987; de Silva and Fikrig, 1995; Piesman et al., 2001 and Piesman et
al., 2003). Bacteria within feeding ticks also increase synthesis of LuxS (Narasimhan
et al., 2002), consistent with our hypothesis and suggesting a role for AI-2 in
coordinating bacterial gene expression during transmission (Stevenson and Babb,
2002; Miller et al., 2003; Stevenson et al., 2003; Miller and Stevenson, 2004). It is
possible that B. burgdorferi may also use DPD/AI-2 to regulate gene expression
during other stages of its infectious cycle, perhaps through self-induction (Redfield,
2002; Koerber et al., 2004).
Acknowledgements
This work was supported by National Institutes of Health Grants R01-AI53101 and
5T32-AI49795. We thank Bonnie Bassler, Michael Norgard, George Stauffer, and
Xiaofeng Yang for providing bacterial strains; Tom Schwan for sharing unpublished
results; Bonnie Bassler, Kenneth Cornell, Klaus Winzer, and Wolfram Zückert for
helpful discussions; Sarah Wackerbarth for statistical analyses; and Sara Bair, Sarah
Kearns, Natalie Mickelsen, Jennifer Miller, Ashutosh Verma, and Michael Woodman
for assistance in this research.
References
Akins et al., 1995 D.R. Akins, S.F. Porcella, T.G. Popova, D. Shevchenko, S.I. Baker,
M. Li, M.V. Norgard and J.D. Radolf, Evidence for in vivo but not in vitro expression
of a Borrelia burgdorferi outer surface protein F (OspF) homologue, Mol. Microbiol.
18 (1995), pp. 507–520. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Order Document
Akins et al., 1998 D.R. Akins, K.W. Bourell, M.J. Caimano, M.V. Norgard and J.D.
Radolf, A new animal model for studying Lyme disease spirochetes in a
mammalian host-adapted state, J. Clin. Invest. 101 (1998), pp. 2240–2250. AbstractEMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order Document
Alitalo et al., 2002 A. Alitalo, T. Meri, H. Lankinen, I. Seppälä, P. Lahdenne, P.S.
Hefty, D. Akins and S. Meri, Complement inhibitor factor H binding to Lyme
disease spirochetes is mediated by inducible expression of multiple plasmid-encoded
outer surface protein E paralogs, J. Immunol. 169 (2002), pp. 3847–3853. AbstractElsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | Order Document
Anguita et al., 2003 J. Anguita, M.N. Hedrick and E. Fikrig, Adaptation of Borrelia
burgdorferi in the tick and the mammalian host, FEMS Microbiol. Rev. 27 (2003), pp.
493–504. Abstract | Order Document
Babb et al., 2001 K. Babb, N. El-Hage, J.C. Miller, J.A. Carroll and B. Stevenson,
Distinct regulatory pathways control the synthesis of Borrelia burgdorferi infectionassociated OspC and Erp surface proteins, Infect. Immun. 69 (2001), pp. 4146–4153.
Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
Babb et al., 2004 K. Babb, J.D. McAlister, J.C. Miller and B. Stevenson, Molecular
characterization of Borrelia burgdorferi erp promoter/operator elements, J. Bacteriol.
186 (2004), pp. 2745–2756. Abstract-MEDLINE | Abstract-Elsevier BIOBASE |
Abstract-EMBASE | Order Document | Full Text via CrossRef
Babb et al., 2005 K. Babb, K. von Lackum, R.L. Wattier, S.P. Riley and B. Stevenson,
Synthesis of autoinducer-2 by the Lyme disease spirochete, Borrelia burgdorferi, J.
Bacteriol. 187 (2005), pp. 3079–3087. Abstract-Elsevier BIOBASE | AbstractEMBASE | Abstract-MEDLINE | Order Document | Full Text via CrossRef
Barbour, 1984 A.G. Barbour, Isolation and cultivation of Lyme disease spirochetes,
Yale J. Biol. Med. 57 (1984), pp. 521–525. Abstract-EMBASE | AbstractMEDLINE | Order Document
Bassler et al., 1994 B.L. Bassler, M. Wright and M.R. Silverman, Multiple signalling
systems controlling expression of luminescence in Vibrio harveyi: sequence and
function of genes encoding a second sensory pathway, Mol. Microbiol. 13 (1994), pp.
273–286. Abstract-EMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE |
Order Document
Bassler et al., 1997 B.L. Bassler, E.P. Greenberg and A.M. Stevens, Cross-species
induction of luminescence in the quorum-sensing bacterium Vibrio harveyi, J.
Bacteriol. 179 (1997), pp. 4043–4045. Abstract-MEDLINE | Abstract-EMBASE |
Order Document
Benach et al., 1987 J.L. Benach, J.L. Coleman, R.A. Skinner and E.M. Bosler, Adult
Ixodes dammini on rabbits: a hypothesis for the development and transmission of
Borrelia burgdorferi, J. Infect. Dis. 155 (1987), pp. 1300–1306. Abstract-EMBASE |
Abstract-MEDLINE | Order Document
Blevins et al., 2004 J.S. Blevins, A.T. Revel, M.J. Caimano, X.F. Yang, J.A.
Richardson, K.E. Hagman and M.V. Norgard, The luxS gene is not required for
Borrelia burgdorferi tick colonization, transmission to a mammalian host, or
induction of disease, Infect. Immun. 72 (2004), pp. 4862–4867.
Casjens et al., 2000 S. Casjens, N. Palmer, R. van Vugt, W.M. Huang, B. Stevenson,
P. Rosa, R. Lathigra, G. Sutton, J. Peterson, R.J. Dodson, D. Haft, E. Hickey, M.
Gwinn, O. White and C. Fraser, A bacterial genome in flux: the twelve linear and nine
circular extrachromosomal DNAs of an infectious isolate of the Lyme disease
spirochete Borrelia burgdorferi, Mol. Microbiol. 35 (2000), pp. 490–516. AbstractEMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document |
Full Text via CrossRef
Charon and Goldstein, 2002 N.W. Charon and S.F. Goldstein, Genetics of motility
and chemotaxis of a fascinating group of bacteria: the spirochetes, Annu. Rev. Genet.
36 (2002), pp. 47–73. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Order Document | Full Text via CrossRef
Chatterjee et al., 2002 J. Chatterjee, C.M. Miyamoto, A. Zouzoulas, B.F. Lang, N.
Skouris and E.A. Meighan, MetR and CRP bind to the Vibrio harveyi lux promoters
and regulate luminescence, Mol. Microbiol. 46 (2002), pp. 101–111. AbstractEMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document |
Full Text via CrossRef
Chen et al., 2002 X. Chen, S. Schauder, N. Potier, A. Van Dorsselaer, I. Pelczer, B.L.
Bassler and F.M. Hughson, Structural identification of a bacterial quorum-sensing
signal containing boron, Nature 415 (2002), pp. 545–549. Abstract-GEOBASE |
Abstract-Elsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | AbstractCompendex | Abstract-INSPEC | Order Document | Full Text via CrossRef
Das et al., 1997 S. Das, S.W. Barthold, S. Stocker Giles, R.R. Montgomery, S.R.
Telford and E. Fikrig, Temporal pattern of Borrelia burgdorferi p21 expression in
ticks and the mammalian host, J. Clin. Invest. 99 (1997), pp. 987–995. AbstractMEDLINE | Abstract-EMBASE | Order Document
DeKeersmaecker and Vanderleyden, 2003 S.C.J. DeKeersmaecker and J.
Vanderleyden, Constraints on detection of autoinducer-2 (AI-2) signalling molecules
using Vibrio harveyi as a reporter, Microbiology 149 (2003), pp. 1953–1956.
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
de Silva and Fikrig, 1995 A.M. de Silva and E. Fikrig, Growth and migration of
Borrelia burgdorferi in Ixodes ticks during blood feeding, Am. J. Trop. Med. Hyg. 53
(1995), pp. 397–404. Abstract-MEDLINE | Order Document
El-Hage and Stevenson, 2002 N. El-Hage and B. Stevenson, Simultaneous
coexpression of Borrelia burgdorferi Erp proteins occurs through a specific, erp
locus-directed regulatory mechanism, J. Bacteriol. 184 (2002), pp. 4536–4543.
Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
El-Hage et al., 2001 N. El-Hage, K. Babb, J.A. Carroll, N. Lindstrom, E.R. Fischer,
J.C. Miller, R.D. Gilmore Jr., M.L. Mbow and B. Stevenson, Surface exposure and
protease insensitivity of Borrelia burgdorferi Erp (OspEF-related) lipoproteins,
Microbiology 147 (2001), pp. 821–830. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document
Fraser et al., 1997 C.M. Fraser, S. Casjens, W.M. Huang, G.G. Sutton, R. Clayton, R.
Lathigra, O. White, K.A. Ketchum, R. Dodson, E.K. Hickey, M. Gwinn, B.
Dougherty, J.-F. Tomb, R.D. Fleischmann, D. Richardson, J. Peterson, A.R.
Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M.D.
Adams, J. Gocayne, J. Weidmann, T. Utterback, L. Watthey, L. McDonald, P. Artiach,
C. Bowman, S. Garland, C. Fujii, M.D. Cotton, K. Horst, K. Roberts, B. Hatch, H.O.
Smith and J.C. Venter, Genomic sequence of a Lyme disease spirochaete, Borrelia
burgdorferi, Nature 390 (1997), pp. 580–586. Abstract-EMBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Fraser et al., 1998 C.M. Fraser, S.J. Norris, G.M. Weinstock, O. White, G.G. Sutton,
R. Dodson, M. Gwinn, E.K. Hickey, R. Clayton, K.A. Ketchum, E. Sodergren, J.M.
Hardham, M.P. McLeod, S. Salzberg, J. Peterson, H. Khalak, D. Richardson, J.K.
Howell, M. Chidambaram, T. Utterback, L. McDonald, P. Artiach, C. Bowman, M.D.
Cotton, C. Fujii, S. Garland, B. Hatch, K. Horst, K. Roberts, L. Watthey, J. Weidman,
H.O. Smith and J.C. Venter, Complete genome sequence of Treponema pallidum, the
syphilis spirochete, Science 281 (1998), pp. 375–388. Abstract-Elsevier BIOBASE |
Abstract-MEDLINE | Abstract-EMBASE | Order Document | Full Text via
CrossRef
Garrow, 1996 T.A. Garrow, Purification, kinetic properties, and cDNA cloning of
mammalian betaine-homocysteine methyltransferase, J. Biol. Chem. 271 (1996), pp.
22831–22838. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document
Gilmore et al., 2001 R.D. Gilmore Jr., M.L. Mbow and B. Stevenson, Analysis of
Borrelia burgdorferi gene expression during life cycle phases of the tick vector Ixodes
scapularis, Microbes Infect. 3 (2001), pp. 799–808. Abstract-MEDLINE | AbstractEMBASE | Abstract-Elsevier BIOBASE | Order Document
González et al., 1992 J.C. González, R.V. Banerjee, S. Huang, J.S. Sumner and R.G.
Matthews, Comparison of cobalamin-independent and cobalamin-dependent
methionine synthases from Escherichia coli: two solutions to the same chemical
problem, Biochemistry 31 (1992), pp. 6045–6056. Abstract-MEDLINE | AbstractEMBASE | Order Document | Full Text via CrossRef
Greenberg et al., 1979 E.P. Greenberg, J.W. Hastings and S. Ulitzur, Induction of
luciferase synthesis in Beneckea harveyi by other marine bacteria, Arch. Microbiol.
120 (1979), pp. 87–91. Abstract-EMBASE | Order Document | Full Text via
CrossRef
Hardie et al., 2003 K.R. Hardie, C. Cooksley, A.D. Green and K. Winzer,
Autoinducer 2 activity in Escherichia coli culture supernatants can be actively
reduced despite maintenance of an active synthase, LuxS, Microbiology 149 (2003),
pp. 715–728. Abstract-EMBASE | Abstract-Elsevier BIOBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Hefty et al., 2001 P.S. Hefty, S.E. Jolliff, M.J. Caimano, S.K. Wikel, J.D. Radolf and
D.R. Akins, Regulation of OspE-related, OspF-related, and Elp lipoproteins of
Borrelia burgdorferi strain 297 by mammalian host-specific signals, Infect. Immun.
69 (2001), pp. 3618–3627. Abstract-MEDLINE | Abstract-EMBASE | AbstractElsevier BIOBASE | Order Document | Full Text via CrossRef
Hefty et al., 2002 P.S. Hefty, C.S. Brooks, A.M. Jett, G.L. White, S.K. Wikel, R.C.
Kennedy and D.R. Akins, OspE-related, OspF-related, and Elp lipoproteins are
immunogenic in baboons experimentally infected with Borrelia burgdorferi and in
human Lyme disease patients, J. Clin. Microbiol. 40 (2002), pp. 4256–4265.
Abstract-Elsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | Order
Document | Full Text via CrossRef
Hellwage et al., 2001 J. Hellwage, T. Meri, T. Heikkilä, A. Alitalo, J. Panelius, P.
Lahdenne, I.J.T. Seppälä and S. Meri, The complement regulatory factor H binds to
the surface protein OspE of Borrelia burgdorferi, J. Biol. Chem. 276 (2001), pp.
8427–8435. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | AbstractCompendex | Order Document | Full Text via CrossRef
Hübner et al., 2003 A. Hübner, A.T. Revel, D.M. Nolen, K.E. Hagman and M.V.
Norgard, Expression of a luxS gene is not required for Borrelia burgdorferi infection
of mice via needle inoculation, Infect. Immun. 71 (2003), pp. 2892–2896. AbstractMEDLINE | Order Document | Full Text via CrossRef
Hudson et al., 2001 C.R. Hudson, J.G. Frye, F.D. Quinn and F.C. Gherardini,
Increased expression of Borrelia burgdorferi vlsE in response to human endothelial
cell membranes, Mol. Microbiol. 41 (2001), pp. 229–239. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Hughes and Johnson, 1990 C.A.N. Hughes and R.C. Johnson, Methylated DNA in
Borrelia species, J. Bacteriol. 172 (1990), pp. 6602–6604. Abstract-MEDLINE |
Order Document
Indest et al., 2001a K.J. Indest, J.K. Howell, M.B. Jacobs, D. Scholl-Meeker, S.J.
Norris and M.T. Philipp, Analysis of Borrelia burgdorferi vlsE gene expression and
recombination in the tick vector, Infect. Immun. 69 (2001), pp. 7083–7090. AbstractElsevier BIOBASE | Abstract-MEDLINE | Abstract-EMBASE | Order Document |
Full Text via CrossRef
Indest et al., 2001b K.J. Indest, R. Ramamoorthy and M.T. Philipp, Transcriptional
regulation in spirochetes of medical importance. In: M.H. Saier and J. García-Lara,
Editors, The Spirochetes: Molecular and Cellular Biology, Horizon Press, Oxford,
UK (2001), pp. 159–170.
Jarrett et al., 1997 J.T. Jarrett, C.W. Goulding, K. Fluhr, S. Huang and R.G. Matthews,
Purification and assay of cobalamin-dependent methionine synthase from Escherichia
coli, Methods Enzymol. 281 (1997), pp. 196–213. Abstract-EMBASE | AbstractMEDLINE | Order Document
Kelly, 1971 R. Kelly, Cultivation of Borrelia hermsi, Science 173 (1971), pp. 443–
444. Abstract-MEDLINE | Order Document
Koerber et al., 2004 A.J. Koerber, J.R. King and P. Williams, Deterministic and
stochastic modelling of endosome escape by Staphylococcus aureus: “quorum”
sensing by a single bacterium, J. Math. Biol. 50 (2004), pp. 440–488.
Kraiczy et al., 2001a P. Kraiczy, C. Skerka, V. Brade and P.F. Zipfel, Further
characterization of complement regulator-acquiring surface proteins of Borrelia
burgdorferi, Infect. Immun. 69 (2001), pp. 7800–7809. Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Abstract-EMBASE | Order Document | Full Text via
CrossRef
Kraiczy et al., 2001b P. Kraiczy, C. Skerka, M. Kirschfink, V. Brade and P.F. Zipfel,
Immune evasion of Borrelia burgdorferi by acquisition of human complement
regulators FHL-1/reconectin and factor H, Eur. J. Immunol. 31 (2001), pp. 1674–1684.
Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
Kraiczy et al., 2003 P. Kraiczy, J. Hellwage, C. Skerka, M. Kirschfink, V. Brade, P.F.
Zipfel and R. Wallich, Immune evasion of Borrelia burgdorferi: mapping of a
complement inhibitor factor H-binding site of BbCRASP-3, a novel member of the
Erp protein family, Eur. J. Immunol. 33 (2003), pp. 697–707. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Kraiczy et al., 2004 P. Kraiczy, K. Hartmann, J. Hellwage, C. Skerka, V. Brade, P.F.
Zipfel, R. Wallich and B. Stevenson, Immunological characterization of the
complement regulator factor H-binding CRASP and Erp proteins of Borrelia
burgdorferi, Int. J. Med. Microbiol. 293 (2004) (Suppl. 37), pp. 152–157. Abstract |
PDF (802 K)
Lam et al., 1994 T.T. Lam, T.-P.K. Nguyen, R.R. Montgomery, F.S. Kantor, E. Fikrig
and R.A. Flavell, Outer surface proteins E and F of Borrelia burgdorferi, the agent of
Lyme disease, Infect. Immun. 62 (1994), pp. 290–298. Abstract-EMBASE |
Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document
Liang et al., 1999 F.T. Liang, A.L. Alvarez, Y. Gu, J.M. Nowling, R. Ramamoorthy
and M.T. Philipp, An immunodominant conserved region within the variable domain
of VlsE, the variable surface antigen of Borrelia burgdorferi, J. Immunol. 163 (1999),
pp. 5566–5573. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document
Matthews, 1996 R.G. Matthews, One-carbon metabolism. In: F.C. Neidhart, Editor,
Escherichia coli and Salmonella, ASM Press, Washington, DC, USA (1996), pp.
600–611.
McDowell et al., 2001 J.V. McDowell, S.Y. Sung, G. Price and R.T. Marconi,
Demonstration of the genetic stability and temporal expression of select members of
the Lyme disease spirochete OspF protein family during infection in mice, Infect.
Immun. 69 (2001), pp. 4831–4838. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document | Full Text via CrossRef
McDowell et al., 2003 J.V. McDowell, J. Wolfgang, E. Tran, M.S. Metts, D.
Hamilton and R.T. Marconi, Comprehensive analysis of the factor H binding
capabilities of Borrelia species associated with Lyme disease: delineation of two
distinct classes of factor H binding proteins, Infect. Immun. 71 (2003), pp. 3597–3602.
Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
Metts et al., 2003 M.S. Metts, J.V. McDowell, M. Theisen, P.R. Hansen and R.T.
Marconi, Analysis of the OspE determinants involved in binding of factor H and
OspE-targeting antibodies elicited during Borrelia burgdorferi infection, Infect.
Immun. 71 (2003), pp. 3587–3596. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document | Full Text via CrossRef
Miller and Stevenson, 2004 J.C. Miller and B. Stevenson, Increased expression of
Borrelia burgdorferi factor H-binding surface proteins during transmission from ticks
to mice, Int. J. Med. Microbiol. 293 (2004) (Suppl. 37), pp. 120–125. Abstract | PDF
(732 K)
Miller et al., 2003 J.C. Miller, K. von Lackum, K. Babb, J.D. McAlister and B.
Stevenson, Temporal analysis of Borrelia burgdorferi Erp protein expression
throughout the mammal-tick infectious cycle, Infect. Immun. 71 (2003), pp. 6943–
6952. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full
Text via CrossRef
Miller et al., 2005 J.C. Miller, K. Narayan, B. Stevenson and A.R. Pachner,
Expression of Borrelia burgdorferi erp genes during infection of non-human primates,
Microb. Pathog. 39 (2005), pp. 27–33. SummaryPlus | Full Text + Links | PDF (137
K)
Miller et al., 2004 S.T. Miller, K.B. Xavier, S.R. Campagna, M.E. Taga, M.F.
Semmelhack, B.L. Bassler and F.M. Hughson, Salmonella typhimurium recognizes a
chemically distinct form of the bacterial quorum-sensing signal AI-2, Mol. Cell. 15
(2004), pp. 677–687. SummaryPlus | Full Text + Links | PDF (911 K)
Nally et al., 2001 J.E. Nally, J.F. Timoney and B. Stevenson, Temperature-regulated
protein synthesis by Leptospira interrogans, Infect. Immun. 69 (2001), pp. 400–404.
Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Abstract-EMBASE | Order
Document | Full Text via CrossRef
Narasimhan et al., 2002 S. Narasimhan, F. Santiago, R.A. Koski, B. Brei, J.F.
Anderson, D. Fish and E. Fikrig, Examination of the Borrelia burgdorferi
transcriptome in Ixodes scapularis during feeding, J. Bacteriol. 184 (2002), pp. 3122–
3125. Abstract-Elsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE |
Order Document | Full Text via CrossRef
Nascimento et al., 2004a A.L.T.O. Nascimento, A.I. Ko, E.A. Martins, C.B.
Monteiro-Vitorello, P.L. Ho, D.A. Haake, S. Verjovski-Almeida, R.A. Hartskeerl,
M.V. Marques, M.C. Oliveira, C.F. Menck, L.C. Leite, H. Carrer, L.L. Coutinho,
W.M. Degrave, O.A. Dellagostin, H. El-Dorry, E.S. Ferro, M.I. Ferro, L.R. Furlan, M.
Gamberini, E.A. Giglioti, A. Goes-Neto, G.H. Goldman, M.H. Goldman, R. Harakava,
S.M. Jeronimo, I.L.M. Junqueira-de-Azevedo, E.T. Kimura, E.E. Kuramae, E.G.
Lemos, M.V. Lemos, C.L. Marino, L.R. Nunes, R.C. de Oliveira, G.G. Pereira, M.S.
Reis, A. Schriefer, W.J. Siqueira, P. Sommer, S.M. Tsai, A.J. Simpson, J.A. Ferro,
L.E. Camargo, J.P. Kitajima, J.C. Setubal and M.A. Van Sluys, Comparative
genomics of two Leptospira interrogans serovars reveals novel insights into
physiology and pathogenesis, J. Bacteriol. 186 (2004), pp. 2164–2172. AbstractMEDLINE | Abstract-Elsevier BIOBASE | Abstract-EMBASE | Order Document |
Full Text via CrossRef
Nascimento et al., 2004b A.L.T.O. Nascimento, S. Verjovski-Almeida, M.A. Van
Sluys, C.B. Monteiro-Vitorello, L.E.A. Camargo, L.A. Digiampietri, R.A. Hartskeerl,
P.L. Ho, M.V. Marques, M.C. Oliveira, J.C. Setubal, D.A. Haake and E.A.L. Martins,
Genome features of Leptospira interrogans serovar Copenhageni, Braz. J. Med. Biol.
Res. 37 (2004), pp. 459–478. Abstract-EMBASE | Order Document
Neuhierl et al., 1999 B. Neuhierl, M. Thanbichler, F. Lottspeich and A. Böck, A
family of S-methylmethionine-dependent thiol/selenol methyltransferases, J. Biol.
Chem. 274 (1999), pp. 5407–5414. Abstract-EMBASE | Abstract-MEDLINE | Order
Document | Full Text via CrossRef
Ohnishi et al., 2003 J. Ohnishi, B. Schneider, W.B. Messer, J. Piesman and A.M. de
Silva, Genetic variation at the vlsE locus of Borrelia burgdorferi within ticks and
mice over the course of a single transmission cycle, J. Bacteriol. 185 (2003), pp.
4432–4441. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document | Full Text via CrossRef
Picardeau et al., 2003 M. Picardeau, H. Bauby and I. Saint Girons, Genetic evidence
for the existence of two pathways for biosynthesis of methionine in the Leptospira
spp, FEMS Microbiol. Lett. 225 (2003), pp. 257–262. SummaryPlus | Full Text +
Links | PDF (321 K)
Piesman et al., 2001 J. Piesman, B.S. Schneider and N.S. Zeidner, Use of quantitative
PCR to measure density of Borrelia burgdorferi in the midgut and salivary glands of
feeding tick vectors, J. Clin. Microbiol. 39 (2001), pp. 4145–4148. Abstract-Elsevier
BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | Order Document | Full Text
via CrossRef
Piesman et al., 2003 J. Piesman, N.S. Zeidner and B.S. Schneider, Dynamic changes
in Borrelia burgdorferi populations in Ixodes scapularis (Acari: Ixodidae) during
transmission: studies at the mRNA level, Vector-Borne Zoonotic Dis. 3 (2003), pp.
125–132. Abstract-MEDLINE | Order Document
Pollack et al., 1993 R.J. Pollack, S.R. Telford and A. Spielman, Standardization of
medium for culturing Lyme disease spirochetes, J. Clin. Microbiol. 31 (1993), pp.
1251–1255. Abstract-EMBASE | Order Document
Redfield, 2002 R.J. Redfield, Is quorum sensing a side effect of diffusion sensing?,
Trends Microbiol. 10 (2002), pp. 365–370. SummaryPlus | Full Text + Links | PDF
(90 K)
Ren et al., 2003 S.-X. Ren, G. Fu, X.-G. Jiang, R. Zeng, Y.-G. Miao, H. Xu, Y.-X.
Zhang, H. Xiong, G. Lu, L.-F. Lu, H.-Q. Jiang, J. Jia, Y.-F. Tu, J.-X. Jiang, W.-Y. Gu,
Y.-Q. Zhang, Z. Cai, H.-H. Sheng, H.-F. Yin, Y. Zhang, G.-F. Zhu, M. Wan, H.-L.
Huang, Z. Qian, S.-Y. Wang, W. Ma, Z.-J. Yao, Y. Shen, B.-Q. Qiang, Q.-C. Xia, X.K. Guo, A. Danchin, I. Saint Girons, R.L. Somerville, Y.-M. Wen, M.-H. Shi, Z.
Chen, J.-G. Xu and G.-P. Zhao, Unique physiological and pathogenic features of
Leptospira interrogans revealed by whole-genome sequencing, Nature 422 (2003), pp.
888–893. Abstract-GEOBASE | Abstract-MEDLINE | Abstract-Compendex |
Abstract-Elsevier BIOBASE | Abstract-EMBASE | Order Document | Full Text via
CrossRef
Rodionov et al., 2003 D.A. Rodionov, A.G. Vitreschak, A.A. Mironov and M.S.
Gelfand, Comparative genomics of the vitamin B12 metabolism and regulation in
prokaryotes, J. Biol. Chem. 278 (2003), pp. 41148–41159. Abstract-Elsevier
BIOBASE | Abstract-Compendex | Abstract-MEDLINE | Order Document | Full
Text via CrossRef
Sambrook et al., 1989 J. Sambrook, E.F. Fritsch and T. Maniatis, Molecular Cloning.
A Laboratory Manual (second ed), Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York, USA (1989).
Schauder et al., 2001 S. Schauder, S. Shokat, M.G. Surette and B.L. Bassler, The
LuxS family of bacterial autoinducers: biosynthesis of a novel quorum-sensing signal
molecule, Mol. Microbiol. 41 (2001), pp. 463–476. Abstract-Elsevier BIOBASE |
Abstract-EMBASE | Abstract-MEDLINE | Order Document | Full Text via
CrossRef
Schwan, 1996 T.G. Schwan, Ticks and Borrelia: model systems for investigating
pathogen-arthropod interactions, Infect. Agents Dis. 5 (1996), pp. 167–181. AbstractMEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Sekowska et al., 2004 A. Sekowska, V. Denervaud, H. Ashida, K. Michoud, D. Haas,
A. Yokota and A. Danchin, Bacterial variations on the methionine salvage pathway,
BMC Microbiol. 4 (2004), p. 9. Abstract-MEDLINE | Order Document | Full Text
via CrossRef
Seshadri et al., 2004 R. Seshadri, G.S.A. Myers, H. Tettelin, J.A. Eisen, J.F.
Heidelberg, R.J. Dodson, T.M. Davidsen, R.T. DeBoy, D.E. Fouts, D.H. Haft, J.
Selengut, Q. Ren, L.M. Brinkac, R. Madupu, J. Kolonay, S.A. Durkin, S.C.
Daugherty, J. Shetty, A. Shvartsbeyn, E. Gebregeorgis, K. Geer, G. Tsegaye, J. Malek,
B. Ayodeji, S. Shatsman, M.P. McLeod, D. Smajs, J.K. Howell, S. Pal, A. Amin, P.
Vashisth, T.Z. McNeill, Q. Xiang, E. Sodergren, E. Baca, G.M. Weinstock, S.J.
Norris, C.M. Fraser and I.T. Paulsen, Comparison of the genome of the oral pathogen
Treponema denticola with other spirochete genomes, Proc. Natl. Acad. Sci. USA 101
(2004), pp. 5646–5651. Abstract-Elsevier BIOBASE | Abstract-EMBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Seshu and Skare, 2001 J. Seshu and J.T. Skare, The many faces of Borrelia
burgdorferi. In: M.H. Saier and J. García-Lara, Editors, The Spirochetes: Molecular
and Cellular Biology, Horizon Press, Oxford, UK (2001), pp. 147–158.
Steere et al., 1983 A.C. Steere, R.L. Grodzicki, A.N. Kornblatt, J.E. Craft, A.G.
Barbour, W. Burgdorfer, G.P. Schmid, E. Johnson and S.E. Malawista, The
spirochetal etiology of Lyme disease, N. Engl. J. Med. 308 (1983), pp. 733–740.
Abstract-MEDLINE | Abstract-EMBASE | Order Document
Stevenson and Babb, 2002 B. Stevenson and K. Babb, LuxS-mediated quorum
sensing in Borrelia burgdorferi, the Lyme disease spirochete, Infect. Immun. 70
(2002), pp. 4099–4105. Abstract-EMBASE | Abstract-Elsevier BIOBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Stevenson et al., 1995 B. Stevenson, T.G. Schwan and P.A. Rosa, Temperaturerelated differential expression of antigens in the Lyme disease spirochete, Borrelia
burgdorferi, Infect. Immun. 63 (1995), pp. 4535–4539. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Stevenson et al., 1998 B. Stevenson, J.L. Bono, T.G. Schwan and P. Rosa, Borrelia
burgdorferi Erp proteins are immunogenic in mammals infected by tick bite, and their
synthesis is inducible in cultured bacteria, Infect. Immun. 66 (1998), pp. 2648–2654.
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order
Document
Stevenson et al., 2002 B. Stevenson, N. El-Hage, M.A. Hines, J.C. Miller and K.
Babb, Differential binding of host complement inhibitor factor H by Borrelia
burgdorferi Erp surface proteins: a possible mechanism underlying the expansive host
range of Lyme disease spirochetes, Infect. Immun. 70 (2002), pp. 491–497.
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order
Document | Full Text via CrossRef
Stevenson et al., 2003 B. Stevenson, K. von Lackum, R.L. Wattier, J.D. McAlister,
J.C. Miller and K. Babb, Quorum sensing by the Lyme disease spirochete,
Microbes Infect. 5 (2003), pp. 991–997. SummaryPlus | Full Text + Links | PDF (189
K)
Suk et al., 1995 K. Suk, S. Das, W. Sun, B. Jwang, S.W. Barthold, R.A. Flavell and E.
Fikrig, Borrelia burgdorferi genes selectively expressed in the infected host, Proc.
Natl. Acad. Sci. USA 92 (1995), pp. 4269–4273. Abstract-MEDLINE | AbstractEMBASE | Abstract-Elsevier BIOBASE | Order Document
Sun et al., 2004 J. Sun, R. Daniel, I. Wagner-Dobler and A.P. Zeng, Is autoinducer-2
a universal signal for interspecies communication: a comparative genomic and
phylogenetic analysis of the synthesis and signal transduction pathways, BMC Evol.
Biol. 4 (2004), p. 36. Abstract-MEDLINE | Order Document | Full Text via
CrossRef
Surette and Bassler, 1998 M.G. Surette and B.L. Bassler, Quorum sensing in
Escherichia coli and Salmonella typhimurium, Proc. Natl. Acad. Sci. USA 95 (1998),
pp. 7046–7050. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | AbstractEMBASE | Order Document | Full Text via CrossRef
Surette and Bassler, 1999 M.G. Surette and B.L. Bassler, Regulation of autoinducer
production in Salmonella typhimurium, Mol. Microbiol. 31 (1999), pp. 585–595.
Abstract-MEDLINE | Abstract-EMBASE | Order Document | Full Text via
CrossRef
Surette et al., 1999 M.G. Surette, M.B. Miller and B.L. Bassler, Quorum sensing in
Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of genes
responsible for autoinducer production, Proc. Natl. Acad. Sci. USA 96 (1999), pp.
1639–1644. Abstract-MEDLINE | Abstract-EMBASE | Order Document | Full Text
via CrossRef
Taga, 2005 M.E. Taga, Methods for analysis of bacterial autoinducer-2 production.
In: R.T. Coico, T.F. Kowalik, J. Quarles, B. Stevenson and R. Taylor, Editors,
Current Protocols in Microbiology, Wiley, Hoboken, NJ (2005), p. 1C.1.
Taga et al., 2001 M.E. Taga, J.L. Semmelhack and B.L. Bassler, The LuxS-dependent
autoinducer AI-2 controls the expression of an ABC transporter that functions in AI-2
uptake in Salmonella typhimurium, Mol. Microbiol. 42 (2001), pp. 777–793. AbstractElsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | Order Document |
Full Text via CrossRef
Taga et al., 2003 M.E. Taga, S.T. Miller and B.L. Bassler, Lsr-mediated transport and
processing of AI-2 in Salmonella typhimurium, Mol. Microbiol. 50 (2003), pp. 1411–
1427. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full
Text via CrossRef
Thanbichler et al., 1999 M. Thanbichler, B. Neuhierl and A. Böck, Smethylmethionine metabolism in Escherichia coli, J. Bacteriol. 181 (1999), pp. 662–
665. Abstract-MEDLINE | Abstract-EMBASE | Order Document
Urbanowski et al., 1987 M.L. Urbanowski, L.T. Stauffer, L.S. Plamann and G.V.
Stauffer, A new methionine locus, metR, that encodes a trans-acting protein required
for activation of metE and metH in Escherichia coli and Salmonella typhimurium, J.
Bacteriol. 169 (1987), pp. 1391–1397. Abstract-MEDLINE | Abstract-EMBASE |
Order Document
Vieira and Messing, 1987 J. Vieira and J. Messing, Production of single-stranded
plasmid DNA, Methods Enzymol. 153 (1987), pp. 3–11. Abstract-EMBASE |
Abstract-MEDLINE | Order Document
von Lackum and Stevenson, 2005 K. von Lackum and B. Stevenson, Carbohydrate
utilization by the Lyme borreliosis spirochete, Borrelia burgdorferi, FEMS
Microbiol. Lett. 243 (2005), pp. 173–179. SummaryPlus | Full Text + Links | PDF
(139 K)
Wallich et al., 1995 R. Wallich, C. Brenner, M.D. Kramer and M.M. Simon,
Molecular cloning and immunological characterization of a novel linear-plasmid-
encoded gene, pG, of Borrelia burgdorferi expressed only in vivo, Infect. Immun. 63
(1995), pp. 3327–3335. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | AbstractEMBASE | Order Document
Winzer et al., 2002a K. Winzer, K.R. Hardie, N. Burgess, N. Doherty, D. Kirke,
M.T.G. Holden, R. Linforth, K.A. Cornell, A.J. Taylor, P.J. Hill and P. Williams,
LuxS: its role in central metabolism and the in vitro synthesis of 4-hydroxy-5-methyl3(2H)-furanone, Microbiology 148 (2002), pp. 909–922. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Winzer et al., 2002b K. Winzer, K.R. Hardie and P. Williams, Bacterial cell-to-cell
communication: sorry, can’t talk now—gone to lunch!, Curr. Opin. Microbiol. 5
(2002), pp. 216–222. SummaryPlus | Full Text + Links | PDF (106 K)
Winzer et al., 2003 K. Winzer, K.R. Hardie and P. Williams, LuxS and autoinducer-2:
their contribution to quorum sensing and metabolism in bacteria, Adv. Appl. Microbiol.
53 (2003), pp. 291–396. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order
Document
Wyss, 1992 C. Wyss, Growth of Porphyromonas gingivalis, Treponema denticola, T.
pectinovorum, T. socranskii, and T. vincentii in a chemically defined medium, J. Clin.
Microbiol. 30 (1992), pp. 2225–2229. Abstract-MEDLINE | Abstract-EMBASE |
Order Document
Wyss and Ermert, 1996 C. Wyss and P. Ermert, Borrelia burgdorferi is an adenine
and spermidine auxotroph, Microb. Ecol. Health Dis. 9 (1996), pp. 181–185.
Abstract-Elsevier BIOBASE | Order Document
Xavier and Bassler, 2003 K.B. Xavier and B.L. Bassler, LuxS quorum sensing: more
than just a numbers game, Curr. Opin. Microbiol. 6 (2003), pp. 191–197.
SummaryPlus | Full Text + Links | PDF (353 K)
Zeh et al., 2002 M. Zeh, G. Leggewie, R. Hoefgren and H. Hesse, Cloning and
characterization of a cDNA encoding a cobalamin-independent methionine synthase
from potato (Solanum tuberosum L.), Plant Mol. Biol. 48 (2002), pp. 255–265.
Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Zhang and Norris, 1998a J.-R. Zhang and S.J. Norris, Genetic variation of the
Borrelia burgdorferi gene vlsE involves cassette-specific, segmental gene conversion,
Infect. Immun. 66 (1998), pp. 3698–3704. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document
Zhang and Norris, 1998b J.-R. Zhang and S.J. Norris, Kinetics and in vivo induction
of genetic variation of vlsE in Borrelia burgdorferi, Infect. Immun. 66 (1998), pp.
3689–3697. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Order Document
Zhang et al., 1997 J.-R. Zhang, J.M. Hardham, A.G. Barbour and S.J. Norris,
Antigenic variation in Lyme disease borreliae by promiscuous recombination of
VMP-like sequence cassettes, Cell 89 (1997), pp. 1–20.
Comparison of isolation rate of Borrelia burgdorferi
sensu lato in MKP and BSK-II medium
Eva Ružić-Sabljića, , , Stanka Lotrič-Furlanb, Vera Maraspinb, Jože
Cimpermanb, Mateja Logarb, Tomaž Jurcab and Franc Strleb
Institute of Microbiology and Immunology, School of Medicine, Zaloška 4, SI-1000
Ljubljana, Slovenia
b
Department of Infectious Diseases, University Medical Centre Ljubljana, Japljeva 2
Ljubljana, Slovenia
a
Available online 10 March 2006.
Abstract
Different media have been utilized for borrelial cultivation. The aim of the present
study was to evaluate the isolation rate of Borrelia burgdorferi sensu lato from two
commonly used media, i.e. modified Kelly–Pettenkofer (MKP) and Barbour–
Stoenner–Kelly II (BSK-II) medium, and to compare the isolated strains with regard
to their phenotypic and genotypic characteristics. Skin biopsy specimens of
2×2×4 mm were taken from the peripheral site of human solitary erythema lesions
and were divided in two pieces, one of which was inoculated into MKP and the other
one into BSK-II medium. Species analysis of the obtained strains was performed and
their plasmid and protein profiles were determined. Borrelia strains were isolated
from 48/96 patients (50%) with erythema migrans. We obtained in 26/48 patients
(54%) from MKP as well as from BSK-II, in 11 patients (23%) only from MKP, and
in another 11 (23%) only from BSK-II medium a positive result. B. afzelii was
isolated from 43 patients (23 were positive in both media, nine in MKP only and 11 in
BSK-II medium only), while B. garinii was isolated from five patients (in three from
both media, in two from MKP only). All strains of the obtained strain pairs were
identical according to species and the type within the species. Plasmid profiles were
identical in 17/21 B. afzelii strain pairs (81%) and in 1/3 B. garinii strain pairs; in 6/24
strain pairs, distinctions in the number of plasmids or in their molecular mass were
present. Differences in the protein profile were found in 7/24 strain pairs (29%). The
distinctions were uniform and were limited to the expression of OspC.
In conclusion, our study showed comparable Borrelia isolation rates from MKP and
BSK-II medium. The results of the present study indicate that human patients with
Lyme borreliosis may simultaneously harbor heterogeneous B. burgdorferi s.l.
strains.
Keywords: Borrelia burgdorferi sensu lato; MKP medium; BSK-II medium;
Isolation rate
Article Outline
Introduction
Materials and methods
Borrelia isolation from patients
Culture media
Patients
Cultivation
Analysis of Borrelia strains
Identification of Borrelia species by pulsed-field gel electrophoresis (PFGE)
Identification of Borrelia species by polymerase chain reaction (PCR)
Analysis of plasmid profile
Analysis of protein profile
Results
Isolation rate
Species identification
Plasmid profile
Protein profile
Discussion
References
Introduction
Lyme borreliosis may exhibit different clinical manifestations, most frequently
erythema migrans, which represents a typical clinical sign early in the course of the
disease (Nadelman et al., 1996; Strle et al., 1996; Nadelman and Wormser, 1998;
Arnež et al., 2003; Stanek and Strle, 2003). From this localized skin infection
borreliae may disseminate to other parts of the human organism and cause different
clinical manifestations (Lotrič-Furlan et al., 1999; Wormser et al., 1999;Maraspin et
al., 2001; Oksi et al., 2001; Stanek and Strle, 2003). Isolation of the etiological agent
from patient's material is the most reliable method for the diagnosis of borrelial
infection (Pfister et al., 1984; Preac-Mursic et al., 1986; Picken et al., 1997; LotričFurlan et al., 1999; Wormser et al., 1999; Maraspin et al., 2002; Arnež et al., 2003).
Numerous Borrelia strains obtained from human tissue and tissue fluids (skin, blood,
cerebrospinal fluid, etc.) have been analyzed by different phenotypic and genotypic
approaches (Wilske et al., 1988 and Wilske et al., 1993; Wang et al., 1999; RužićSabljić et al., 2000, Ružić-Sabljić et al., 2001a and Ružić-Sabljić et al., 2001b). In
comparison to phenotypic assessment, analysis of borrelial genomic DNA provides
more precise information on the genetic relationships among Borrelia strains
(Belfaiza et al., 1993; Busch et al., 1995; Busch and Nitschko, 1999; Olive and Bean,
1999; Wang et al., 1999; Wormser et al., 1999; Ružić-Sabljić et al., 2000, RužićSabljić et al., 2001a and Ružić-Sabljić et al., 2001b). Many studies indicate that B.
burgdorferi sensu lato populations are genetically divergent and phenotypically
heterogeneous, and that Lyme borreliosis in humans is caused by at least three
different species of the B. burgdorferi s.l. complex, viz. B. afzelii, B. garinii, and B.
burgdorferi sensu stricto (Belfaiza et al., 1993; Burgdorfer, 1995; Rijpkema et al.,
1995; Liveris et al., 1996; Picken et al., 1996; Mathiesen et al., 1997; Wang et al.,
1999; Wormser et al., 1999; Ružić-Sabljić et al., 2000, Ružić-Sabljić et al., 2001a and
Ružić-Sabljić et al., 2001b).
Isolation of B. burgdorferi s.l. from clinical materials is a golden standard for
confirming borrelial infection. Borrelia cultivation and isolation is quite a demanding
procedure with limited sensitivity (Jobe et al., 1993; Nadelman et al., 1996; Strle et al.,
1996; Kollars et al., 1997, Picken et al., 1997; Lotrič-Furlan et al., 1999; Wormser et
al., 2000; Maraspin et al., 2001). Different media for borrelial cultivation have been
reported. For routine work, modified Kelly–Pettenkofer (MKP), Barbour–Stoenner–
Kelly II (BSK-II) medium and commercially available BSK-H (Sigma, USA) medium
have been utilized most frequently (Barbour, 1984; Preac-Mursic et al., 1986; Pollack
et al., 1993). The majority of the components of the three media are equivalent and
present in similar concentrations (e.g. CMRL, N–acetyl glucosamine, bovine serum
albumin, rabbit serum, etc.) but the origin of components may be dissimilar (e.g.
bought from different commercial firms). However, media may differ in certain
constituents. For example, MKP lacks yeast extract present in BSK–II and BSK-H,
but–in contrast to BSK-II and BSK-H–contains gelatin (Barbour, 1984; Preac-Mursic
et al., 1986; Pollack et al., 1993). To be useful for laboratory purposes, the medium
must be stable, available and efficacious in supporting the growth of all human
pathogenic Borrelia strains. In addition to medium ingredients, several other factors
including temperature of incubation, pH of the medium, capacity of particular
borrelial species to grow and number of Borrelia strains in the sample can influence
borrelial growth and the outcome of cultivation (Hubalek et al., 1998; Ružić-Sabljić
and Strle, 2004).
The aim of the present study was to evaluate and compare the isolation rate of B.
burgdorferi s.l. from the skin of patients with erythema migrans using MKP and
BSK-II medium, and to compare phenotypic and genotypic characteristics of the
strain pairs, i.e. the strains isolated in the two media from the skin biopsy of an
individual patient.
Materials and methods
Borrelia isolation from patients
Culture media
In the present study MKP and BSK-II medium were used for Borrelia isolation. Both
media were prepared in our laboratory after the original recipes (Barbour, 1984;
Preac-Mursic et al., 1986). The two media differ with regard to the glucose
concentration (3 versus 5 g/l in MKP and BSK-II, respectively), the origin and
concentration of bovine serum albumin (35% solution with a final concentration of
1 g/ml in MKP versus fraction V powder with final concentration 4 g/ml in BSK-II),
the concentration and preparation of rabbit sera (7.2% heat-inactivated versus 6%
non-inactivated in MKP and BSK-II, respectively). Additionally, yeastolate (2 g/l)
was added to BSK-II but not to MKP medium. After preparing and testing the quality
of each medium lot, the media were distributed to clinicians.
Patients
Ninety-six consecutive adult patients diagnosed with erythema migrans at the
Department of Infectious Diseases, University Medical Center Ljubljana, in spring of
2000 represented the basis for the present study. In each patient, a skin biopsy was
taken from the peripheral site of erythema migrans after prior cleaning the skin with
70% alcohol and local anesthesia with 2% xylocaine (Jurca et al., 1998). Each
specimen (2×2×4 mm) was dissected in two pieces: one was immediately inoculated
into MKP, the other one into BSK-II medium. The inoculated media were sent to the
laboratory at room temperature.
Cultivation
Samples were incubated at 33 °C and examined weekly for up to 9 weeks for the
presence of spirochetes by dark-field microscopy. Isolated strains were grown in
the same medium for 2–4 subcultures.
Analysis of Borrelia strains
For the large majority of isolates, strain identification was carried out by pulsed-field
gel electrophoresis (PFGE). Identification by polymerase chain reaction (PCR) was
performed only for cultures with borrelial concentration not high enough for PFGE.
Identification of Borrelia species by pulsed-field gel electrophoresis
(PFGE)
Strain identification by PFGE was performed as described previously (Busch et al.,
1995; Ružić-Sabljić et al., 2000, Ružić-Sabljić et al., 2001a and Ružić-Sabljić et al.,
2001b). Briefly, Borrelia strains were mixed in agarose, and whole blocks were lysed
in lysis buffer containing lysozyme (1 mg/ml) and ribonuclease (10 μg/ml), and
digested in digestion buffer containing proteinase K (0.5 mg/ml). After exhaustive
block washing, DNA was restricted with 30 U of MluI restriction enzyme. Restricted
patterns were separated for 24 h with ramping pulse times of 1–40 s. Molecular mass
marker of 50–1000 kb (Sigma, USA) was added to each electrophoresis. Borrelia
species as well as the type within the particular species were determined by restriction
fragment length polymorphism (RFLP) as described by Belfaiza et al. (1993) and
Picken et al. (1996). Fragments interpreted as being species specific were those with
molecular weights 440, 320 and 90 kb for B. afzelii, 220 and 80 kb for B. garinii and
145 kb for B. burgdorferi s.s. Types within species (Mla for B. afzelii, Mlg for B.
garinii and Mlb for B. burgdorferi s.s.) were determined according to additional
fragments of different molecular weights (Belfaiza et al., 1993; Picken et al., 1996).
Identification of Borrelia species by polymerase chain reaction (PCR)
Tubes with culture were centrifuged at 10,000 rpm and borrelial DNA was isolated
from the sediment using commercial kit (QIAamp DNA mini kit, Qiagen cat. no.
51306, Germany). Interspace 5S-23S DNA region was amplified. The amplified
products were restricted by restriction enzyme MseI and electrophoresed in 16%
polyacrylamide gel. Borrelia species were determined by RFLP as described by
Postic et al. (1994). Fragments interpreted as being species specific were those with
molecular weights 108, 68, 50 and 20 bp for B. afzelii, 108, 95 and 50 bp for B.
garinii and 108, 51, 38, 29 and 28 bp for B. burgdorferi s.s.
Analysis of plasmid profile
The procedure was limited to cultures with a sufficient Borrelia density to allow the
execution of PFGE, and was determined only in patients in whom borreliae were
isolated from an erythema migrans lesion concurrently in MKP and in BSK-II
medium (when two isolates were obtained from an individual skin biopsy sample). To
compare plasmid profiles within such strain pairs, we performed electrophoresis of
both strains on the same gel. Plasmid profiles were determined by PFGE. Blocks with
borrelial DNA were prepared identically as for species identification but
electrophoresis was performed without previous restriction of DNA. Chromosomal
and plasmid DNA were separated for 37 h in ramping pulse time of 0.9–3 s as
described previously (Busch et al., 1995; Ružić-Sabljić et al., 1999, Ružić-Sabljić et
al., 2000, Ružić-Sabljić et al., 2001a and Ružić-Sabljić et al., 2001b). Molecular mass
marker of 0.1–200 kb (Sigma, USA) was added to each separation.
Analysis of protein profile
Protein profile analysis of borrelial strains was performed only in patients in whom
borreliae were isolated in MKP as well as in BSK-II medium. To compare protein
profiles of concurrently isolated strains, we performed electrophoresis of both strains
on the same gel. For the determination of protein profiles, strains were harvested,
washed and lysed in buffer containing sodium dodecyl sulfate (2.5%) and 2mercaptoethanol (2.5%), as described elsewhere (Wilske et al., 1988; Busch et al.,
1995; Ružić-Sabljić et al., 2000, Ružić-Sabljić et al., 2001a and Ružić-Sabljić et al.,
2001b). Electrophoresis was performed in 12% polyacrylamide gel. Low molecular
mass marker of 21–106 kD (BioRad, Germany) was used as size marker in each
protein profile determination.
Results
Isolation rate
Skin biopsy specimens were obtained from 96 consecutive adult patients with typical
solitary erythema migrans. Borrelia strains were isolated from 48/96 skin lesions
(patients) (50%). There was no difference in the isolation rate when comparing MKP
and BSK-II medium (37 positive cultures in each particular medium). In 26/48
patients (54%) borreliae were isolated in MKP as well as in BSK-II medium, while in
11/48 patients (23%) borreliae were isolated either in MKP or BSK-II (Table 1).
Table 1.
Borrelia burgdorferi sensu lato isolation rate from human erythema migrans skin biopsy sample
divided in two specimens–comparison of modified Kelly–Pettenkofer (MKP) and Barbour–Stoenner–
Kelly II (BSK-II) medium
Culture-positive samples
In MKP and BSK-II
In MKP only
In BSK-II only
26
11
11
48
Culture negative
Total
48
96
Species identification
Out of the 74 isolated Borrelia strains, 69 (93%) were typed using PFGE, while in 5
strains (3 in MKP and 2 in BSK-II medium) that did not grow sufficiently, species
identification was preformed by PCR. Sixty-six strains (89%) were identified as B.
afzelii (in 23 patients, the strains were isolated in both media, in 9 patients in MKP
only, and in 11 patients in BSK-II only) and 8 as B. garinii (in 3 patients isolated in
both media, and in 2 patients isolated in MKP only). Data are shown in Table 2.
Table 2.
Species identification of Borrelia strains isolated from human erythema migrans skin biopsies divided
in two specimens – comparison of modified Kelly–Pettenkofer (MKP) and Barbour–Stoenner–Kelly II
(BSK-II) medium
Positive culture in medium
B. afzelii
B. garinii
No. of isolated strains
PFGEa
PCRb
PFGE
PCR
MKP and
22
1
3
–
26
BSK-II
22
1
3
–
26
MKP only
7
2
2
–
11
BSK-II only
10
1
–
–
11
Subtotal
61
5
8
0
Total
66
a
b
8
74
Identification of Borrelia species with pulsed-field gel electrophoresis.
Identification of Borrelia species with polymerase chain reaction.
From 48 skin-culture-positive patients with erythema migrans (Table 1), there were
26 patients with borreliae isolated in both media. Of these 26 strain pairs (52 strains),
24 strain pairs were suitable for further PFGE identification and were used for
analyzing and comparing PFGE types within the species as well as plasmid and
protein profiles. Each individual strain pair was congruent according to the species as
well as to the PFGE type. Regarding PFGE type, strain pairs consisted of either B.
afzelii Mla1 (21 pairs) or B. garinii Mlg2 (3 pairs).
Plasmid profile
Identical plasmid profiles were found in 17/21 B. afzelii strain pairs (81%) and in 1/3
B. garinii strain pairs, while in 6/24 patients, the two strains differed either in the
number of plasmids or their molecular mass. The plasmid profiles of some strain pairs
are shown in Fig. 1.
(50K)
Fig. 1. Plasmid profile of Borrelia strains (1 and 2) isolated in both modified Kelly–Pettenkofer (MKP)
and Barbour–Stoenner–Kelly II (BSK-II) medium. Strains were isolated from skin biopsies of patients
with erythema migrans (A–J). MW: molecular mass marker; B. afzelii strains: A–F and J; B. garinii
strains: G–I. Plasmid profile of strain pairs differs in patients A–D and G.
Protein profile
Protein profiles of strain pairs obtained from patients in whom borreliae were isolated
in MKP as well as in BSK-II medium differed in 7/24 cases (29%). All those strains
were identified as B. afzelii and showed identical distinction–one strain of each pair
expressed OspC, whereas the other did not. Protein profiles differed in six strain pairs
which were identical according to the species and the plasmid profile, and in one
strain pair both strains belonged to the same species but were distinct in their plasmid
profile (patient D from the Fig. 1).
Discussion
Although erythema migrans represents a pathognomonic clinical sign of Lyme
borreliosis, the isolation rate of Borrelia strains from the skin lesions was only 50%
(48/96 patients) in the present study, corroborating previous findings from Slovenia
(Strle et al., 1996; Jurca et al., 1998; Zore et al., 2002). The fastidious nature of the
organism and changes that Borrelia must undergo to adapt the transition from living
biological material to an artificial medium probably limit the isolation rate (Picken et
al., 1996; Norris et al., 1997). Additionally, ingenious characteristics of the individual
Borrelia species such as a tendency of better growth or overgrowth of certain Borrelia
species over the other(s) (Ružić-Sabljić and Strle, 2004) might influence borrelial
isolation rate. Several other factors, for example, the quantity of spirochetes in a given
sample, previous antibiotic treatment, local anesthesia at the site of biopsy, conditions
of sample transport to the laboratory, medium used for Borrelia cultivation, aseptic
environment of culture maintenance, etc. can also influence the isolation rate (Kollars
et al., 1997; Wormser et al., 2000). The relatively low isolation rate of Borrelia strains
in our patients with erythema migrans might have been caused by the rather small size
of skin biopsy specimens (e.g. 2×2×4 mm) that was additionally divided in two pieces.
Some previous studies suggested that borreliae are present in erythema migrans
lesions in only low concentration and are irregularly distributed (Pachner et al., 1993;
Picken et al., 1997; Zore et al., 2002). With larger samples, the isolation rate would
probably be higher (Wormser et al., 2000).
The main interest of the present study was to compare the isolation rate of B.
burgdorferi s.l. from erythema migrans skin samples in two commonly used media,
MKP and BSK-II. We had anticipated that our approach of taking one skin biopsy
from an individual patient, dissecting it in two pieces and inoculating each single
piece in a particular medium, would lead to identical (positive or negative) results in
the large majority of cases. The unexpected discrepancy may be explained by unequal
distribution of Borrelia strains within individual samples. Our findings and proposed
explanations are in accordance with the results of some previous studies which
suggested that borreliae are present in erythema migrans lesions in low concentration
and are irregularly distributed (Pachner et al., 1993; Picken et al., 1997; Zore et al.,
2002).
Sixty-six out of 74 isolates (89%) were typed as B. afzelii and 8 as B. garinii; no B.
burgdorferi s.s. strain was isolated (Table 2). These findings corroborate the results of
several European studies on the predominance of B. afzelii strains in skin
manifestations of Lyme borreliosis (Picken et al., 1996; Rijpkema et al., 1997;
Ružić-Sabljić et al., 2000; Ciceroni et al., 2001; Ornstein et al., 2001; Logar et al.,
2004).
Twenty-four strain pairs (out of 26 double isolates) grew well enough to allow RFLP
analysis (Table 2) and to carry out a comparison of the phenotypic and genotypic
characteristics of the isolates within the individual pairs (species identification,
plasmid and protein profiles). Either strain of each strain pair contained the same
Borrelia genospecies (21 pairs: B. afzelii; 3 pairs: B. garinii) and the same type (all B.
afzelii strains were determined as Mla1, and all B. garinii strains as Mlg2), whereas
some distinctions in plasmid and protein profiles were found.
A plasmid profile analysis revealed 6/24 strain pairs (25%) composed of strains with
distinct plasmid outlines. Some of these strains are shown in Fig. 1. The plasmid
profile is an excellent tool for strain discrimination particularly when comparing
strains within the same species. Many conditions can affect the borrelial plasmid
content including the possibility that plasmids can be lost upon cultivation (Xu and
Johnson, 1995; Busch et al., 1997; Ružić-Sabljić et al., 1999, Ružić-Sabljić et al.,
2000, Ružić-Sabljić et al., 2001a and Ružić-Sabljić et al., 2001b; Wang et al., 1999;
Iyer et al., 2003). We would like to stress that strains compared in our study were
subjected to quite identical circumstances. They were isolated, multiplied and
analyzed using analogous approaches and procedures but only differed in the culture
medium. However, the potential impact of a particular medium (MKP versus BSK-II)
on the plasmid content is not known. Differences in the plasmid content within
particular strain pairs have been described previously (Ružić-Sabljić et al., 2005). We
believe that the plasmid content of our strains most probably represents the natural
situation and that differing plasmid profiles of strains may be quite safely interpreted
as an infection with different clones of the same type of an identical Borrelia species.
Differences in the protein profile were found within 7/24 strain pairs (29%). All strain
pairs with dissimilar protein profiles belonged to B. afzelii. The distinctions were
uniform and limited to the expression of OspC. It is of interest that 6/7 strain pairs
with distinct protein profiles had congruent plasmid profiles. Besides the adaptive
mechanisms of the spirochetes that influence protein expression, each strain has its
own potential to express (or not to express) a particular protein. The latter statement is
supported by the finding that populations of B. afzelii and B. garinii generally differ in
their potential to express some important proteins such as OspB and OspC (Wilske et
al., 1988 and Wilske et al., 1996; Ružić-Sabljić et al., 2000, Ružić-Sabljić et al.,
2001a and Ružić-Sabljić et al., 2001b). Therefore, it is possible that proteins
expressed by the strains presented in the present study reflect their own genuine status.
In conclusion, our study showed comparable Borrelia isolation rates in MKP versus
BSK-II medium indicating their similar suitability for routine clinical work. The
results of the present study indicate that human patients with Lyme borreliosis may
simultaneously harbor heterogeneous B. burgdorferi s.l. strains.
References
Arnež et al., 2003 M. Arnež, D. Pleterski-Rigler, T. Lužnik-Bufon, E. Ružić-Sabljić
and F. Strle, Solitary and multiple erythema migrans in children: comparison of
demographic, clinical, and laboratory findings, Infection 31 (2003), pp. 404–409.
Abstract-MEDLINE | Order Document
Barbour, 1984 A.G. Barbour, Isolation and cultivation of Lyme disease spirochetes,
Yale J. Biol. Med. 57 (1984), pp. 521–525. Abstract-EMBASE | AbstractMEDLINE | Order Document
Belfaiza et al., 1993 J. Belfaiza, D. Postic, E. Bellenger, G. Baranton and I. Saint
Girons, Genomic fingerprinting of Borrelia burgdorferi sensu lato by pulsed-field gel
electrophoresis, J. Clin. Microbiol. 31 (1993), pp. 2873–2877. Abstract-MEDLINE |
Abstract-EMBASE | Order Document
Burgdorfer, 1995 W. Burgdorfer, Lyme disease (borreliosis): a global perspective,
Alpe Adria Microbiol. J. 3 (1995), pp. 227–233. Abstract-EMBASE | Order
Document
Busch and Nitschko, 1999 U. Busch and H. Nitschko, Methods for the differentiation
of microorganisms, J. Chromatogr. B 722 (1999), pp. 236–278.
Busch et al., 1995 U. Busch, C. Hizo-Teufel, R. Boehmer, B. Wilske and V. PreacMursic, Molecular characterization of Borrelia burgdorferi sensu lato strains by
pulsed-field electrophoresis, Electrophoresis 16 (1995), pp. 744–747. AbstractMEDLINE | Abstract-EMBASE | Order Document | Full Text via CrossRef
Busch et al., 1997 U. Busch, G. Will, C. Hizo-Teufel, B. Wilske and V. Preac-Mursic,
Long-term in vitro cultivation of Borrelia burgdorferi sensu lato strains: influence on
plasmid patterns, genome stability, and expression of proteins, Res. Microbiol. 148
(1997), pp. 109–111.
Ciceroni et al., 2001 L. Ciceroni, S. Ciarrochi, A. Ciervo, V. Mondarini, F. Guzzo, G.
Caruso, R. Murgia and M. Cinco, Isolation and characterization of Borrelia
burgdorferi sensu lato strains in an area of Italy where Lyme borreliosis is endemic,
J. Clin. Microbiol. 39 (2001), pp. 2254–2260. Abstract-Elsevier BIOBASE | AbstractEMBASE | Abstract-MEDLINE | Order Document | Full Text via CrossRef
Hubalek et al., 1998 Z. Hubalek, J. Halouzka and M. Heroldova, Growth temperature
ranges of Borrelia burgdorferi sensu lato strains, J. Med. Microbiol. 47 (1998), pp.
929–932. Abstract-MEDLINE | Abstract-EMBASE | Order Document
Iyer et al., 2003 R. Iyer, O. Kalu, J. Purser, S. Norris, B. Stevenson and I. Schwartz,
Linear and circular plasmid content in Borrelia burgdorferi clinical isolates, Infect.
Immun. 71 (2003), pp. 3699–3706. Abstract-Elsevier BIOBASE | Abstract-EMBASE
| Abstract-MEDLINE | Order Document | Full Text via CrossRef
Jobe et al., 1993 D.A. Jobe, S.M. Callister and R.F. Schell, Recovery of Borrelia
burgdorferi by filtration, J. Clin. Microbiol. 31 (1993), pp. 1896–1898. AbstractEMBASE | Abstract-MEDLINE | Order Document
Jurca et al., 1998 T. Jurca, E. Ružić-Sabljić, S. Lotrič-Furlan, V. Maraspin, J.
Cimperman, R.N. Picken and F. Strle, Comparison of peripheral and central biopsy
sites for the isolation of Borrelia burgdorferi sensu lato from erythema migrans
lesions, Clin. Infect. Dis. 27 (1998), pp. 636–638. Abstract-MEDLINE | AbstractEMBASE | Order Document
Kollars et al., 1997 T.M. Kollars, P.G. Kollars, J.H. Oliver, E.J. Masters and D. Miles,
Effects of two commonly used anesthetics on the in vitro growth of Borrelia
burgdorferi and B. garinii, J. Spirochet. Tick-borne Dis. 4 (1997), pp. 21–23.
Liveris et al., 1996 D. Liveris, G.P. Wormser, J. Nowakowski, R. Nadelman, S.
Bittker, D. Cooper, S. Varde, F.H. Moy, G. Forseter, C.S. Pavia and I. Schwartz,
Molecular typing of Borrelia burgdorferi from Lyme disease patients by PCRrestriction fragment length polymorphism analysis, J. Clin. Microbiol. 34 (1996), pp.
1306–1309. Abstract-MEDLINE | Abstract-EMBASE | Order Document
Logar et al., 2004 M. Logar, E. Ružić-Sabljić, S. Lotrič-Furlan, J. Cimperman, T.
Jurca and F. Strle, Comparison of erythema migrans caused by Borrelia afzelii and
Borrelia garinii, Infection 32 (2004), pp. 15–19. Abstract-MEDLINE | AbstractElsevier BIOBASE | Abstract-EMBASE | Order Document | Full Text via CrossRef
Lotrič-Furlan et al., 1999 S. Lotrič-Furlan, J. Cimperman, V. Maraspin, E. RužićSabljić, M. Logar, T. Jurca and F. Strle, Lyme borreliosis and peripheral facial
palsy, Wien. Klin. Wschr. 111 (1999), pp. 970–975. Abstract-MEDLINE | AbstractEMBASE | Order Document
Maraspin et al., 2001 V. Maraspin, E. Ružić-Sabljić, J. Cimperman, S. Lotrič-Furlan,
T. Jurca, R.N. Picken and F. Strle, Isolation of Borrelia burgdorferi sensu lato from
blood of patients with erythema migrans, Infection 29 (2001), pp. 65–70. AbstractEMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order Document |
Full Text via CrossRef
Maraspin et al., 2002 V. Maraspin, J. Cimperman, S. Lotrič-Furlan, E. Ružić-Sabljić,
T. Jurca and F. Strle, Cerebrospinal fluid findings in adult patients with multiple
erythema migrans, Wien. Klin. Wschr. 114 (2002), pp. 505–509. Abstract-MEDLINE
| Abstract-EMBASE | Order Document
Mathiesen et al., 1997 D.A. Mathiesen, J.H. Oliver, C.P. Kolbert, E.D. Tullson, B.J.B.
Johnson, G.L. Campbell, P.D. Mitchell, K.D. Reed, S.R. Telford III, J.F. Anderson,
R.S. Lane and D.H. Persing, Genetic heterogeneity of Borrelia burgdorferi in the
United States, J. Infect. Dis. 175 (1997), pp. 98–107. Abstract-MEDLINE | Order
Document
Nadelman and Wormser, 1998 R.B. Nadelman and G.P. Wormser, Lyme
borreliosis, Lancet 352 (1998), pp. 557–565. SummaryPlus | Full Text + Links | PDF
(362 K)
Nadelman et al., 1996 R.B. Nadelman, J. Nowakowski, G. Forseter, N.S. Goldberg, S.
Bittker, D. Cooper, M. Auguero-Rosenfeld and G. Wormser, The clinical spectrum of
early Lyme borreliosis in patients with culture confirmed erythema migrans, Am. J.
Med. 100 (1996), pp. 502–508. Abstract | PDF (738 K)
Norris et al., 1997 D.E. Norris, B.J.B. Johnson, J. Piesman, G.O. Maupin, J.L. Clark
and W.C. Black IV, Culturing select for specific genotypes of Borrelia burgdorferi in
the enzootic cycle in Colorado, J. Clin. Microbiol. 35 (1997), pp. 2359–2364.
Abstract-MEDLINE | Abstract-EMBASE | Order Document
Oksi et al., 2001 J. Oksi, H. Marttila, H. Soini, H. Aho, J. Uksila and M.K. Viljanen,
Early dissemination of Borrelia burgdorferi without generalized symptoms in patients
with erythema migrans, APMIS 109 (2001), pp. 581–588. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Olive and Bean, 1999 D.M. Olive and P. Bean, Principles and applications of methods
for DNA-based typing of microbial organism, J. Clin. Microbiol. 37 (1999), pp.
1661–1669. Abstract-Elsevier BIOBASE | Abstract-MEDLINE | AbstractEMBASE | Order Document
Ornstein et al., 2001 K. Ornstein, J. Berglund, I. Nilsson, R. Norrby and S. Bergström,
Characterization of Lyme borreliosis isolates from patients with erythema migrans
and neuroborreliosis in southern Sweden, J. Clin. Microbiol. 39 (2001), pp. 1294–
1298. Abstract-Elsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE |
Order Document | Full Text via CrossRef
Pachner et al., 1993 A.R. Pachner, N. Ricalton and E. Delanez, Comparison of
polymerase chain reaction with culture and serology for diagnosis of murine
experimental Lyme borreliosis, J. Clin. Microbiol. 31 (1993), pp. 208–214.
Abstract-MEDLINE | Abstract-EMBASE | Order Document
Pfister et al., 1984 H.W. Pfister, K. Einhäupl, V. Preac-Mursic, B. Wilske and G.
Schierz, The spirochetal etiology of lymphocytic meningoradiculitis of Bannwarth
(Bannwarth's syndrome), J. Neurol. 231 (1984), pp. 141–144. Abstract-MEDLINE |
Abstract-EMBASE | Order Document | Full Text via CrossRef
Picken et al., 1996 R.N. Picken, Y. Cheng, F. Strle, J. Cimperman, V. Maraspin, S.
Lotrič-Furlan, E. Ružić-Sabljić, D. Han, J.A. Nelson, M.M. Picken and G.M.
Trenholme, Molecular characterization of Borrelia burgdorferi sensu lato from
Slovenia revealing significant differences between tick and human isolates, Eur. J.
Clin. Microbiol. Infect. Dis. 15 (1996), pp. 313–323. Abstract-MEDLINE | AbstractEMBASE | Order Document | Full Text via CrossRef
Picken et al., 1997 M.M. Picken, R.N. Picken, D. Han, Y. Cheng, E. Ružić-Sabljić, J.
Cimperman, V. Maraspin, S. Lotrič-Furlan and F. Strle, A two year prospective study
to compare culture and polymerase chain reaction amplification for the detection and
diagnosis of Lyme borreliosis, J. Clin. Pathol.: Mol. Pathol. 50 (1997), pp. 186–
193. Abstract-EMBASE | Abstract-MEDLINE | Order Document
Pollack et al., 1993 R.J. Pollack, S.R. Telford III and A. Spielman, Standardization of
medium for culturing Lyme disease spirochetes, J. Clin. Microbiol. 31 (1993), pp.
1251–1255. Abstract-EMBASE | Order Document
Postic et al., 1994 D. Postic, M.V. Assous, P.A.D. Grimont and G. Baranton,
Diversity of Borrelia burgdorferi sensu lato evidenced by restriction fragment length
polymorphism of rrf (5S)–rrl (23S) intergenic spacer amplicons, Int. J. Syst. Bacteriol.
44 (1994), pp. 743–752. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document
Preac-Mursic et al., 1986 V. Preac-Mursic, B. Wilske and G. Schierz, European
Borrelia burgdorferi isolated from humans and ticks: culture conditions and antibiotic
susceptibility, Zbl. Bakt. Hyg. A 263 (1986), pp. 112–118. Abstract-EMBASE |
Abstract-MEDLINE | Order Document
Rijpkema et al., 1995 S.G.T. Rijpkema, M.J.C.H. Molkenboer, L.M. Schouls, F.
Jongejan and J.F.P. Schellekens, Simultaneous detection and genotyping of three
genomic groups of Borrelia burgdorferi sensu lato in Dutch Ixodes ricinus ticks by
characterization of the amplified intergenic spacer region between 5S and 23S rRNA
genes, J. Clin. Microbiol. 33 (1995), pp. 3091–3095. Abstract-MEDLINE | AbstractEMBASE | Order Document
Rijpkema et al., 1997 S.G.T. Rijpkema, D.J. Tazelaar, M.J.C.H. Molkenboer, G.T.
Noordhoek, G. Plantinga, L.M. Schouls and J.F.P. Schellekens, Detection of Borrelia
afzelii, Borrelia burgdorferi sensu stricto, Borrelia garinii and group VS116 by PCR
in skin biopsies of patients with erythema migrans and acrodermatitis chronica
atrophicans, Clin. Microbiol. Inf. 3 (1997), pp. 109–116. Abstract-EMBASE | Order
Document
Ružić-Sabljić and Strle, 2004 E. Ružić-Sabljić and F. Strle, Comparison of growth of
Borrelia afzelii, B. garinii, and B. burgdorferi sensu stricto in MKP and BSK-II
medium, Int. J. Med. Microbiol. 294 (2004), pp. 407–412. Full Text via CrossRef
Ružić-Sabljić et al., 1999 E. Ružić-Sabljić, F. Strle, S. Lotrič-Furlan, J. Cimperman
and V. Maraspin, Linear plasmid profile analysis of Borrelia burgdorferi sensu lato
strains, Zbl. Bakt. 289 (1999), pp. 740–741. Abstract-Elsevier BIOBASE | Order
Document
Ružić-Sabljić et al., 2000 E. Ružić-Sabljić, F. Strle, J. Cimperman, V. Maraspin, S.
Lotrič-Furlan and D. Pleterski-Rigler, Characterization of Borrelia burgdorferi sensu
lato strains isolated from patients with skin manifestations of Lyme borreliosis
residing in Slovenia, J. Med. Microbiol. 49 (2000), pp. 47–53. Abstract-EMBASE
|International Journal of Medical Microbiology Article in Press, Corrected
Proof
Carbohydrate utilization by the Lyme borreliosis
spirochete, Borrelia burgdorferi
Edited by M.Y. Galperin
Kate von Lackum and Brian Stevenson
,
Department of Microbiology, Immunology, and Molecular Genetics, College of
Medicine, University of Kentucky, Lexington, KY 40536-0298, USA
Received 10 September 2004; revised 26 October 2004; accepted 5 December
2004. Available online 14 December 2004.
Abstract
Growth kinetic analyses of Borrelia burgdorferi indicated that this bacterium can
utilize a limited number of carbon sources for energy: the monosaccharides glucose,
mannose, and N-acetylglucosamine, the disaccharides maltose and chitobiose, and
glycerol. All of these carbohydrates are likely to be available to B. burgdorferi during
infection of either vertebrate and arthropod hosts, enabling development of a model
describing energy sources potentially used by the Lyme borreliosis spirochete
during its natural infectious cycle.
Keywords: Borrelia burgdorferi; Lyme borreliosis; Lyme disease; Carbohydrate
utilization; Spirochete
Article Outline
1. Introduction
2. Materials and methods
2.1. Bacterial strains
2.2. Media preparation
2.3. Growth assays
2.4. Genomic analyses
3. Results
4. Discussion
Acknowledgements
References
1. Introduction
While Lyme borreliosis ( Lyme disease) is a significant threat to human health in
many parts of Europe, North America, and other parts of the globe, very few studies
have been conducted to elucidate the metabolic properties of the causative agent,
Borrelia burgdorferi. Such basic biological information may be useful in not only
increasing the understanding of B. burgdorferi pathogenesis, but also in design of
improved therapies for treatment of Lyme borreliosis.
B. burgdorferi is an obligate parasite, persisting in nature only by infecting vertebrates
and certain species of ticks. As is often observed in other parasitic organisms, the
genome of B. burgdorferi is rather small and is predicted to encode a limited number
of metabolic enzymes [1] and [2]. Cultivation in the laboratory is possible only with
complex media that include undefined components, such as yeast extract [3] and [4].
Elimination of any of those undefined constituents results in significant inhibition of
B. burgdorferi growth.
Previously-conducted metabolic studies of this bacterium concluded that it is an
auxotroph for adenine, spermidine and N-acetylglucosamine (GlcNAc), although the
disaccharide chitobiose may substitute for GlcNAc [4], [5] and [6]. Studies conducted
in the 1960s on the related bacterium B. recurrentis (formerly Spirochaeta
recurrentis) demonstrated the presence of enzymes for Embden-Meyerhof
fermentation of glucose to lactic acid [7], [8], [9] and [10]. Only one glycolytic
enzyme of B. burgdorferi, the pyrophosphate-dependent phosphofructokinase, has
been characterized in detail [11] and [12]. Radiolabeling studies with the related B.
hermsii using 14C-glucose found incorporation into the glycerol components of
phosphatidylcholine and other membrane constituents [13]. Consistent with those
biochemical characterizations, analysis of a B. burgdorferi genome sequence revealed
homologs of all glycolytic pathway enzymes, some components of the pentose
phosphate cycle, but none for oxidative phosphorylation or gluconeogenesis [1] and
[2]. Those genomic analyses also indicated numerous homologs of carbohydrate
transporters. Based upon similarities with characterized carbohydrate transporters of
other bacteria, it was predicted that B. burgdorferi can utilize a broad range of carbon
sources [1]. To better understand the metabolism of the Lyme borreliosis spirochete,
we assessed its ability to grow in media containing a variety of carbohydrates. Our
results demonstrated that there are actually very few carbohydrates capable of
supporting B. burgdorferi growth.
2. Materials and methods
2.1. Bacterial strains
The B. burgdorferi type strain B31 was originally cultured from an infected Ixodes
scapularis tick collected on Shelter Island, New York [14]. All experiments were
performed with a subculture of strain B31 that is infectious to both mammals and
ticks, and has a low in vitro passage history [15]. The genome of this subculture was
recently sequenced [1] and [2].
2.2. Media preparation
A modified version of a standard B. burgdorferi culture medium, Barbour–Stoener–
Kelly II (BSK-II) [4], was produced that lacked any specifically added carbohydrates.
This sugar-free medium, which we designated BSK-Lite, is identical to BSK-II
excepting the omission of free glucose and the use of glucose-free CMRL 1066
(product number C5900-02, United States Biologicals, Swampscott, MA).
Carbohydrate solutions were prepared at 20% (w/v) in distilled water, sterilized by
passage through a 0.2 μm filter, and individually added to BSK-Lite to final
concentrations of 0.4% (w/v, or v/v in the case of glycerol). This concentration was
used since it is the concentration of glucose specifically added to BSK-II [4], and is in
excess of carbohydrate concentrations likely to be encountered during mammalian
infection [16]. Each of the following carbohydrates were tested: the hexoses Dglucose, D-mannose, D-galactose, and D-fructose; the pentoses D-ribose, D-xylose,
L-arabinose, D-arabitol, and adonitol (ribitol); the disaccharides maltose and
melibiose; the methyl pentose L-fucose; the amino sugars D-glucosamine, GlcNAc,
and chitobiose; and glycerol (all obtained from Sigma, St. Louis, MO). Due to its
highly acidic nature, glucosamine was dissolved in 25 mM HEPES and the pH
adjusted to 7.6 prior to use. Examined carbohydrates include all those predicted to be
utilized by B. burgdorferi [1], plus several additional carbohydrates.
Although B. burgdorferi ORFs BBB04, BBB05 and BBB06 were originally annotated
as encoding a potential cellobiose transporter [1], it is highly unlikely that B.
burgdorferi, as an obligate parasite of vertebrates and ticks, would ever encounter that
cellulose derivative in nature. Research on those genes suggests they actually encode
a transporter for chitobiose, the disaccharide building block of arthropod chitin [5]
and [17]. For these reasons, we did not test the ability of cellobiose to support B.
burgdorferi growth.
2.3. Growth assays
B. burgdorferi was initially cultivated in complete BSK-II medium to midexponential phase (approximately 1 × 107 bacteria/ml). Aliquots were then diluted
1:100 into tubes of BSK-Lite plus each tested carbohydrate. As controls, bacteria
were also inoculated into BSK-Lite without any added carbohydrate, and into
complete BSK-II. Total numbers of intact bacteria in each culture were counted every
24 h using a Petroff–Hausser counting chamber and dark-field microscopy. Every
carbohydrate was independently analyzed two times. Those carbon sources that
supported growth during the initial two studies were further analyzed at least one
additional time.
2.4. Genomic analyses
Initial analysis of putative carbohydrate metabolism genes was based upon the
annotation provided for B. burgdorferi strain B31 by Fraser et al. [1] and the web site
http://www.tigr.org/tigr-scripts/CMR2/GenomePage3.spl?database=gbb. Identified
open reading frames (ORFs) were compared with genes of other organisms using
BLAST-P analysis of public databases through the web site
http://www.ncbi.nlm.nih.gov/blast/. Additionally, sequences of proteins with known
functions in other organisms were specifically compared with the B. burgdorferi B31
database through the web site http://tigrblast.tigr.org/cmr-blast/.
3. Results
A significant complication of performing growth kinetic assays of a fastidious
organism, such as B. burgdorferi is the necessary complexity of the culture medium.
While these bacteria require addition of GlcNAc for cell wall synthesis, that
compound can also serve as an energy source (see below). Other essential medium
components, such as yeast extract, neopeptone, and rabbit serum, contain
carbohydrates that may be utilized for energy production. Elimination of any of those
ingredients results in significant inhibition of bacterial growth [4], which could
possibly mask results of growth kinetic studies. For these reasons, BSK-Lite, a
modified medium that eliminated all specifically added carbohydrates, was utilized as
a base medium for the present studies. As described below, this medium was suitable
for discrimination of carbon sources capable of supporting B. burgdorferi growth.
Presumably because of the unavoidable carbohydrates, B. burgdorferi was capable of
growth in BSK-Lite without additional carbohydrate (Fig. 1). Bacteria grew for
approximately three days before culture densities abruptly stabilized, apparently due
to depletion of energy sources. However, inclusion of any of several carbohydrates
resulted in bacterial culture densities that significantly superceded those observed
when using plain BSK-Lite (Fig. 1). In contrast, many other carbohydrates did not
support bacterial growth any better than did unsupplemented BSK-Lite. We therefore
defined a carbohydrate as being utilized for growth by B. burgdorferi if it supported
culture densities greater than twofold higher than did BSK-Lite without added
carbohydrate (Table 1).
(33K)
Fig. 1. Growth kinetics of B. burgdorferi in BSK-Lite medium supplemented with each of various
carbohydrates. Data shown are representative of experiments performed at least three separate times
per carbohydrate. Results for those carbohydrates that supported growth at levels greater than twofold
higher than unsupplemented BSK-Lite are illustrated. Addition of all other tested carbohydrates to
BSK-Lite yielded growth rates and maximal densities indistinguishable from those obtained using
unsupplemented BSK-Lite, and are not illustrated.
Table 1.
Tested carbohydrates and their abilities to support growth of B. burgdorferi
Carbohydrate
Growtha
Glucose
+
Maltose
+
Mannose
+
GlcNAc
+
Chitobiose
+
Glycerol
+
Galactose
−
Fructose
−
Melibiose
−
Ribose
−
Xylose
−
Arabinose
−
Arabitol
−
Adonitol
−
Fucose
−
Glucosamine
−
a
Defined as greater than twofold higher final culture density relative to unsupplemented BSK-Lite (+),
or culture density levels equal to those achieved in unsupplemented BSK-Lite (−).
The standard culture medium used for growth of B. burgdorferi, BSK-II, contains
glucose as the added carbon source [3] and [4]. As expected, addition of glucose to
BSK-Lite yielded culture densities comparable to those obtained when using standard
BSK-II (Fig. 1). Maltose, a disaccharide of glucose, also supported B. burgdorferi
growth, indicating that this bacterium produces an α-glucosidase.
Supplementation with mannose, glycerol, GlcNAc and the GlcNAc disaccharide
chitobiose consistently resulted in final culture densities comparable to those obtained
in either BSK-Lite plus glucose or in standard BSK-II. It is therefore concluded that B.
burgdorferi expresses transporters and enzymes for utilization of these alternative
energy sources.
Although analysis of the B. burgdorferi genome suggested that it encodes homologs
of galactose, fructose, and ribose transporters [1], none of those sugars supported
bacterial growth. None of the other tested carbohydrates enabled growth at levels
exceeding those obtained from unsupplemented BSK-Lite.
4. Discussion
The Lyme borreliosis spirochete has long been known as a fastidious organism,
with cultivation possible only in complex media. The reason for this became obvious
upon sequence analysis of a B. burgdorferi genome, which revealed homologs of very
few metabolic enzymes [1]. It appears that this bacterium is unable to synthesize
amino acids, nucleotides, fatty acids, or most other cellular building blocks. Previous
biochemical studies were supported by genomic data suggesting fermentation of
sugars to lactate, and the absence of both a citric acid cycle and oxidative
phosphorylation. The present metabolic studies determined that B. burgdorferi is
capable of utilizing only a small number of different carbohydrates as energy sources,
consistent with the general paucity of enzymes encoded by the spirochete. Fig. 2
indicates the probable metabolic pathways by which these carbohydrates are utilized
for energy and for synthesis of cellular components.
(98K)
Fig. 2. Diagram of predicted carbohydrate transporters and enzymes of B. burgdorferi, based on results
of these and other functional studies and genome sequence analyses [1], [5], [7], [8], [9], [10], [11],
[12], [13] and [17]. Predicted proteins are noted by their conventional bacterial nomenclature, with
encoding open reading frames designated by the ORF number assigned to the B. burgdorferi strain B31
genome [1] and [2]. Please see text for details.
The B. burgdorferi genome sequence indicates three probable phosphotransferase
system (PTS) glucose transporters (Fig. 2). This apparent redundancy suggests that
glucose is a major energy source for B. burgdorferi, not altogether surprising
considering the parasitic nature of this organism. A recent study demonstrated that
deletion of one of the putative glucose transporters, malX2, resulted in a slight
inhibition of growth in culture [18], consistent with the predicted overlap in
transporter function.
B. burgdorferi appears to also contain a fourth, non-PTS glucose transporter,
homologous to the Mgl transporter of Escherichia coli (Fig. 2). The E. coli Mgl
system is a high-affinity glucose transporter that can also transport methylgalactose
and other sugars [19]. It was this latter characteristic of the E. coli Mgl system that led
to annotation of the B. burgdorferi system as a potential galactose transporter [1]. The
present studies suggest that the previous annotation is incorrect, as we were unable to
find evidence that B. burgdorferi can utilize galactose for energy. The existence of a
non-PTS glucose transporter in B. burgdorferi is supported by the earlier biochemical
characterization of glucokinase activity in the related spirochete B. recurrentis [8] and
[10]. Blast-P analyses of the B. burgdorferi genome sequence indicated strong
similarities between ORF BB831 and the proven glucokinase enzymes of
Streptomyces coelicolor (P = 7.5 × 10−16) [20] and Thermotoga maritima
(P = 9.5 × 10−12) [21]. ORF BB693 exhibits slightly lower degrees of similarity with
those glucokinases. While both ORFs were originally annotated as encoding putative
xylose operon regulatory proteins [1], sugar kinases and transcriptional repressors
often share significant homology [22]. The inability of B. burgdorferi to grow in
xylose-containing media also supports the notion that both BB831 and BB693 were
initially annotated incorrectly.
B. burgdorferi grew quite well on medium containing maltose, confirming that this
bacterium encodes an enzyme for breakdown of glucose polysaccharides. ORF
BB166 encodes a protein with significant similarity to such enzymes (Fig. 2).
Probable natural sources of α-glucosides are glycogen obtained from tissues within
vertebrates hosts and from ingested blood within the tick vector.
The only other hexose found to support B. burgdorferi growth was mannose, with
mannose-modified host proteins as likely natural sources of this sugar. Many
characterized bacteria import mannose through a PTS transporter, and we note that B.
burgdorferi encodes two separate, single-subunit PTS sugar transporters encoded by
ORFs BB408 and BB629 (Fig. 2). One or both of these transporters may function to
bring mannose into the cell. Additionally, several characterized E. coli sugar
transporters exhibit loose specificity in the carbohydrates they are able to import [23],
raising the possibilities that these B. burgdorferi transporters may import more than
just one type of sugar, and that other transporters may also import mannose. Genetic
analyses, involving deletion and complementation of the six predicted B. burgdorferi
PTS transporters, will be required to confirm each system’s substrate specificity.
GlcNAc is an essential component of artificial media for cultivation of B. burgdorferi
[3] and [4]. Genomic analysis suggests this is due to inability of the organism to
synthesize GlcNAc de novo (Fig. 2). While this molecule is a building block of cell
wall peptidoglycan, the present studies demonstrated that GlcNAc can also serve as
an energy source, presumably following the catabolic pathway delineated in Fig. 2.
Many other bacteria import GlcNAc into the cell through glucose PTS transporters
[23], as may also be the case with B. burgdorferi.
The finding that chitobiose, a disaccharide of GlcNAc, can likewise substitute for
glucose to support growth of B. burgdorferi supported and extended upon earlier
studies. It was previously demonstrated that chitobiose can substitute for GlcNAc in
BSK-II medium [5], indicating that the spirochete can effectively transport chitobiose
and cleave it into monosaccharides for use in cell wall biosynthesis. Tick cuticle is
comprised of chitin, polymers of GlcNAc/chitobiose, leading to a hypothesis that
chitobiose transport and catabolism play roles during tick infection [5]. Previous
characterization of ORFs BBB04, BBB05, and BBB06 strongly suggested that these
genes encode the chitobiose PTS transporter ChbCAB (Fig. 2) [5] and [17].
Disruption of this probable transporter did not disrupt ability of B. burgdorferi to
infect ticks and mammals [17], suggesting that this source of energy is redundant to
other catabolites. It is possible, however, that energy provided by chitobiose enhances
survival of the bacteria during tick-associated stages.
Glycerol can also serve as an energy source for B. burgdorferi, presumably being
acquired from host blood. However, glycerol catabolism yields only one ATP per
molecule, as opposed to two ATPs per hexose. This suggests that glycerol is more
likely to be used for phospholipid and lipoprotein synthesis than as an energy source
in nature.
No other tested carbohydrate was capable of supporting B. burgdorferi growth.
Although annotation of the B. burgdorferi genome suggested the presence of
transporters for both galactose and fructose [1], the present studies strongly suggest
that those annotations are incorrect. It should be remembered that original annotation
of the B. burgdorferi genome was performed by in silico comparisons between its
ORF sequences and those of proteins with known or postulated functions from other
organisms [1]. Biological analyses of those predicted functions needs to be performed
before one can conclusively attribute function to any ORF product. For example, B.
burgdorferi ORFs BBB04, BBB05 and BBB06 were initially annotated as encoding a
cellobiose transporter, based on their similarity with such transporters [1], while
subsequent laboratory studies suggest that those ORFs actually encode a chitobiose
transporter. As B. burgdorferi and well-characterized bacteria, such as E. coli are
separated by untold millions of years of evolution, divergences in protein specificity
or domain linkage are bound to have occurred. Thus, while the possibility remains
that B. burgdorferi may utilize sugars, such as galactose or fructose under certain
conditions in nature, it is important to note that there are no metabolic or biochemical
data to support such hypotheses.
Earlier genomic analysis also suggested that ORFs BB677, BB678 and BB679 may
constitute a ribose transporter, based on similarities with both the E. coli Rbs and Mgl
transporters [1]. Although our analyses indicated that B. burgdorferi cannot utilize
ribose as a sole carbon source, it remains possible that the B. burgdorferi system may
transport ribose for other uses. Examination of the B. burgdorferi genome sequence
revealed that the spirochete encodes homologs of only part of the pentose-phosphate
pathway, wherein glucose can be used to produce ribose, but ribose cannot be
metabolized to form glucose or any other energy-producing molecule (Fig. 2). Thus,
any ribose transported into the bacterial cell could be utilized only for nucleic acid
synthesis and not for energy production.
Our study represents the first analysis of carbohydrate utilization by B. burgdorferi,
enabling construction of a model describing possible sources of energy throughout the
bacterial infectious cycle. In nature, the Lyme borreliosis spirochete undergoes a
period of rapid growth during transmission from a feeding tick to a vertebrate host
[24], [25] and [26]. At that time, serum glucose and glycerol, along with mannose,
GlcNAc and glucose polysaccharides associated with ingested host blood cells,
provide energy to the growing bacteria. Chitobiose from the tick cuticle may provide
additional energy and/or GlcNAc. Within the infected vertebrate, glucose, glycerol,
mannose, GlcNAc, and glucose polymers continue to serve as energy sources for
bacterial maintenance, as well as providing building blocks for peptidoglycan,
phospholipids, lipoproteins, and nucleic acids. Those same carbohydrates fuel the
bacteria during transmission from host to naïve, feeding ticks, with ingested blood
providing nutrients during tick colonization. Mutagenesis of genes encoding specific
transporters and catabolic enzymes will test this model and enable determination of
the relative importance of each carbohydrate in the B. burgdorferi pathogenic cycle.
Acknowledgements
These studies were supported by US Public Health Service Grants R01-AI53101 and
5T32-AI49795. We thank Jennifer Miller for advice on growth curve assays; Frank
Gherardini, Kit Tilly, Rebecca Byram and Patricia Rosa for constructive discussions
of biochemical pathways and B. burgdorferi biology; and Kelly Babb and Sara Bair
for technical assistance.
References
[1] C.M. Fraser et al., Genomic sequence of a Lyme disease spirochaete, Borrelia
burgdorferi, Nature 390 (1997), pp. 580–586. Abstract-EMBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
[2] S. Casjens et al., A bacterial genome in flux: the twelve linear and nine circular
extrachromosomal DNAs of an infectious isolate of the Lyme disease spirochete
Borrelia burgdorferi, Mol. Microbiol. 35 (2000), pp. 490–516. Abstract-EMBASE |
Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
[3] R. Kelly, Cultivation of Borrelia hermsi, Science 173 (1971), pp. 443–444.
Abstract-MEDLINE | Order Document
[4] A.G. Barbour, Isolation and cultivation of Lyme disease spirochetes, Yale J.
Biol. Med. 57 (1984), pp. 521–525. Abstract-EMBASE | Abstract-MEDLINE | Order
Document
[5] K. Tilly, A.F. Elias, J. Errett, E. Fischer, R. Iyer, I. Schwartz, J.L. Bono and P.
Rosa, Genetics and regulation of chitobiose utilization in Borrelia burgdorferi, J.
Bacteriol. 183 (2001), pp. 5544–5553. Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Abstract-EMBASE | Order Document | Full Text via CrossRef
[6] C. Wyss and P. Ermert, Borrelia burgdorferi is an adenine and spermidine
auxotroph, Microbial Ecol. Health Dis. 9 (1996), pp. 181–185. Abstract-Elsevier
BIOBASE | Order Document
[7] J.D. Fulton and P.J.C. Smith, Carbohydrate metabolism in Spirochaeta
recurrentis: 1. The metabolism of spirochaetes in vivo and in vitro, Biochem. J. 76
(1960), pp. 491–499. Abstract-MEDLINE | Order Document
[8] P.J.C. Smith, Carbohydrate metabolism in Spirochaeta recurrentis: 2. Enzymes
associated with disintegrated cells and extracts of spirochaetes, Biochem. J. 76 (1960),
pp. 500–508.
[9] P.J.C. Smith, Carbohydrate metabolism in Spirochaeta recurrentis: 3. Properties
of aldolase in spirochaetes, Biochem. J. 76 (1960), pp. 508–514.
[10] P.J.C. Smith, Carbohydrate metabolism in Spirochaeta recurrentis: 4. Some
properties of hexokinase and lactic dehydrogenase in spirochaetes, Biochem. J. 76
(1960), pp. 514–520.
[11] Z. Deng, D. Roberts, X. Wang and R.G. Kemp, Expression, characterization, and
crystallization of the pyrophosphate-dependent phosphofructo-1-kinase of Borrelia
burgdorferi, Arch. Biochem. Biophys. 371 (1999), pp. 326–331. Abstract | Abstract +
References | PDF (113 K)
[12] S.A. Moore, R.S. Ronimus, R.S. Roberson and H.W. Morgan, The structure of a
pyrophosphate-dependent phosphofructokinase from the Lyme disease spirochete
Borrelia burgdorferi, Structure 10 (2002), pp. 659–671. SummaryPlus | Full Text +
Links | PDF (1150 K)
[13] B.P. Livermore, R.F. Bey and R.C. Johnson, Lipid metabolism of Borrelia
hermsi, Infect. Immun. 20 (1978), pp. 215–220. Abstract-MEDLINE | AbstractEMBASE | Order Document
[14] W. Burgdorfer, A.G. Barbour, S.F. Hayes, J.L. Benach, E. Grunwaldt and J.P.
Davis, Lyme disease – a tick-borne spirochetosis?, Science 216 (1982), pp. 1317–
1319. Abstract-MEDLINE | Abstract-EMBASE | Order Document
[15] J.C. Miller, K. von Lackum, K. Babb, J.D. McAlister and B. Stevenson,
Temporal analysis of Borrelia burgdorferi Erp protein expression throughout the
mammal-tick infectious cycle, Infect. Immun. 71 (2003), pp. 6943–6952. Abstract-
MEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
[16] P.L. Altman, Blood and other body fluids In: D.S. Dittmer, Editors, Biological
Handbooks, Federation of American Societies for Experimental Biology, Washington,
DC (1971).
[17] K. Tilly, D. Grimm, D.M. Bueschel, J.G. Krum and P. Rosa, Infectious cycle
analysis of a Borrelia burgdorferi mutant defective in transport of chitobiose, a tick
cuticle component, Vector-borne Zoonotic Dis. 4 (2004), pp. 159–168. AbstractElsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | Order Document
[18] R. Byram, P.E. Stewart and P. Rosa, The essential nature of the ubiquitous 26kilobase circular replicon of Borrelia burgdorferi, J. Bacteriol. 186 (2004), pp. 3561–
3569. Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Abstract-EMBASE |
Order Document | Full Text via CrossRef
[19] A. Death and T. Ferenci, The importance of the binding-protein-dependent Mgl
system to the transport of glucose in Escherichia coli growing on low sugar
concentrations, Res. Microbiol. 144 (1993), pp. 529–537. Abstract | Abstract +
References | PDF (560 K)
[20] K. Mahr, G.P. van Wezel, C. Svensson, U. Krengel, M.J. Bibb and F. Titgemeyer,
Glucose kinase of Streptomyces coelicolor A3(2): large-scale purification and
biochemical analysis, Antonie van Leeuwenhoek 78 (2000), pp. 253–261. AbstractMEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document |
Full Text via CrossRef
[21] T. Hansen and P. Schönheit, ATP-dependent glucokinase from the
hyperthermophilic bacterium Thermotoga maritima represents an extremely
thermophilic ROK glucokinase with high substrate specificity, FEMS Microbiol. Lett.
226 (2003), pp. 405–411. SummaryPlus | Full Text + Links | PDF (208 K)
[22] F. Titgemeyer, J. Reizer, A. Reizer and M.H. Saier, Evolutionary relationships
between sugar kinases and transcriptional repressors in bacteria, Microbiology 140
(1994), pp. 2349–2354. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document
[23] P.W. Postma, J.W. Lengeler and G.R. Jacobson,
Phosphoenolpyruvate:carbohydrate phosphotransferase systems In: F.C. Neidhart,
Editors, Escherichia coli and Salmonella, ASM Press, Washington, DC (1996), pp.
1149–1174.
[24] J.L. Benach, J.L. Coleman, R.A. Skinner and E.M. Bosler, Adult Ixodes
damminion rabbits: a hypothesis for the development and transmission of Borrelia
burgdorferi, J. Infect. Dis. 155 (1987), pp. 1300–1306. Abstract-EMBASE | AbstractMEDLINE | Order Document
[25] A.M. Silva and E. Fikrig, de Growth and migration of Borrelia burgdorferi in
Ixodes ticks during blood feeding, Am. J. Trop. Med. Hyg. 53 (1995), pp. 397–404.
[26] J. Piesman, B.S. Schneider and N.S. Zeidner, Use of quantitative PCR to measure
density of Borrelia burgdorferi in the midgut and salivary glands of feeding tick
vectors, J. Clin. Microbiol. 39 (2001), pp. 4145–4148. Abstract-Elsevier BIOBASE |
Abstract-EMBASE | Abstract-MEDLINE | Order Document | Full Text via
CrossRef
FEMS Microbiology Letters
Volume 243, Issue 1 , 1 February 2005, Pages 173-179
Corresponding author. Tel.: +1 859 257 9358; fax: +1 859 257 8994
Evaluation of Venezuelan Equine Encephalitis (VEE)
replicon-based Outer surface protein A (OspA)
vaccines in a tick challenge mouse model of Lyme
disease
Clay L. Gipson, Nancy L. Davis, Robert E. Johnston and Aravinda M. de Silva
Department of Microbiology and Immunology, University of North Carolina, CB#
7290, Chapel Hill, NC 27599, USA
Received 13 January 2003; revised 2 April 2003; accepted 9 April 2003. ; Available
online 14 May 2003.
Abstract
Venezuelan Equine Encephalitis (VEE) virus replicon particles (VRPs) encoding
Borrelia burgdorferi Outer surface protein A (OspA) were evaluated for their ability
to induce an immune response and provide protection from tick-borne spirochetes.
VRPs expressing ospA that accumulated intracellularly (VRP OspA) or that was
secreted from host cells (VRP tPA-OspA) were tested. Both VRP OspA and VRP
tPA-OspA expressed ospA in immunized mice. Mice vaccinated with VRPs
expressing secreted OspA produced significant amounts of anti-OspA antibodies,
whereas VRPs expressing intracellular OspA were less immunogenic. The VRP
method of delivery induced a Th1 type immune response unlike the recombinant
OspA protein in Freund’s adjuvant, which induced a mixed (Th1 and Th2) immune
response. The VRP tPA-OspA construct induced an immune response that reduced
the bacterial load in feeding Ixodes scapularis and blocked transmission to the host.
These results indicate that VRPs are capable of providing protection against tickborne B. burgdorferi, and potentially can be used for developing improved vaccines
against Lyme disease.
,
Author Keywords: Venezuelan Equine Encephalitis; Virus replicon particles; Outer
surface protein A; Vaccine
Article Outline
1. Introduction
2. Materials and methods
2.1. Mice and ticks
2.2. Cells and plasmids
2.3. Production of VEE replicon particles (VRPs) containing ospA and tpA-ospA
2.4. Expression assays
2.5. Immunization
2.6. ELISA assays for determining total specific IgG and IgG isotype
2.7. Immunohistochemistry
2.8. Bacterial load in ticks
2.9. Evaluation of mice for B. burgdorferi infections
3. Results
3.1. OspA protein production by VEE mRNA and replicons
3.2. Vaccination of mice with VRP OspA and VRP tPA-OspA
3.3. Characterization of immune responses elicited by the different OspA-based
vaccines
3.4. Challenge of immunized mice with B. burgdorferi infected ticks
3.5. Assessment of bacterial load within infected ticks
4. Discussion
Acknowledgements
References
1. Introduction
Lyme disease is an emerging, infectious disease caused by the tick-borne spirochete,
Borrelia burgdorferi [1]. The disease is now recognized as the most prevalent vectorborne illness in the United States and Europe. In 1999, a Lyme disease vaccine was
approved for human use in the US [2]. This vaccine is based on recombinant,
lipidated B. burgdorferi Outer surface protein A (OspA). The vaccine has been
withdrawn from the market, with the manufacturer citing poor sales.
Spirochetes within ticks produce OspA in abundance, whereas it is not a major
antigen during early stages of host infection. In an unfed infected nymphal tick, the
burden of spirochetes within the tick is low with the majority expressing OspA. As
the nymphal tick engorges, the population of the spirochetes expands rapidly, and the
phenotype of the population in the gut lumen shifts towards a more heterogeneous
population of bacteria with many expressing OspA and Outer surface protein C
(OspC) [3]. This vaccine confers protective immunity because OspA antibodies enter
the gut of feeding ticks and bind to spirochetes, blocking transmission from the vector
to the host [4]. Animals can be protected up to 24 h after infected tick attachment by
passively receiving OspA antibodies [5]. Thus, the OspA vaccine is an arthropod
specific transmission blocking vaccine.
Because the OspA protein is mainly produced within the tick, immune cells of the
vaccinated host do not encounter this antigen during challenge and the memory
response of the host is not stimulated. In the absence of a memory response, the host
has to maintain high circulating antibody levels for protection. With the current
vaccine this can only be achieved through an initial vaccination, followed by two
successive boosters over 6 months. In the OspA vaccine trials to date, the individuals
who were not protected by vaccination had, on average, lower antibody titers, which
further supports the notion that antibody titer is critical for protection [6]. Vaccination
strategies that require fewer immunizations and lead to long lasting protective
immunity are needed and will likely to lead to greater acceptance of the vaccine
among high risk populations.
Multiple vaccination strategies have been employed to elicit protective immunity
using OspA in laboratory animals. The lipidated rOspA vaccine that was approved is
produced in E. coli and the purified protein is used with an Alum adjuvant to produce
an immune response [7 and 8]. Langermann et al. were able to show protection in
mice immunized with recombinant BCG (bacillus Calmette-Guerin) mycobacteria
expressing OspA [9]. DNA plasmid vaccines expressing OspA and/or OspC have
been shown to induce protective antibodies in mice as well [10, 11 and 12].
Recently, different alphaviruses, including attenuated strains of Venezuelan Equine
Encephalitis (VEE) virus, have been engineered as vaccine vectors [13, 14 and 15].
Vectors derived from VEE present many advantages to vaccine development. The
replicons efficiently target lymphoid tissues, and direct expression of the heterologous
protein in antigen presenting cells [16]. The heterologous protein is also placed
downstream of the viral 26S promoter, which results in independent, high level
production of the heterologous protein [17]. During production of the replicon
particles, the structural genes are provided in trans, leading to a viral particle that
contains only the nonstructural VEE-based genes and the vaccine gene of interest [13].
This results in a safe VEE vaccine, which does not lead to the production of new virus
particles in the host. The VEE replicons are only capable of a single round of
infection and the antigen of interest is only produced within host cells initially
infected by the replicon particles. The vectors are also RNA based, which reduces the
likelihood of integration into the host chromosome. The majority of the human
population has not been exposed to VEE, reducing the chance of pre-existing
immunity to the vector, which might compromise the efficacy of the vaccine [18, 19
and 20]. VEE replicon particles (VRPs) have provided protection against influenza in
mice, Marburg virus in primates and Ebola virus in rodent models [13, 21 and 22].
Given the promising results with VEE replicons and the need for high circulating
levels of OspA antibodies for preventing infections with B. burgdorferi, we decided to
explore VEE replicons for delivering an OspA-based Lyme disease vaccine.
Many Lyme vaccine models are based on syringe inoculation of cultured bacteria
into animals. Syringe challenge is not a suitable surrogate for tick challenge because
spirochetes delivered by ticks produce different antigens than those cultured in vitro.
B. burgdorferi Decorin binding protein A (DbpA) was effective as a vaccine against
cultured organisms but not against the same strain of spirochetes delivered by tick bite
[23 and 24], emphasizing the importance of using tick challenge in Lyme vaccine
investigations. Here we present the results of vaccine studies that were performed to
test VEE replicons coding for intracellular or secreted forms of OspA in a tick
challenge mouse model of Lyme disease.
2. Materials and methods
2.1. Mice and ticks
Female C3H HenJ mice, 4–6 weeks of age, were obtained from the National Institutes
of Health (Bethesda, MD). The ticks used in this study were raised by placing larval
Ixodes scapularis on mice infected with B. burgdorferi strain B31 (from Shelter
Island, NY). The ticks were kept in a humid chamber at 21 °C and allowed to molt.
After the molt the nymphs were assessed for infection prevalence. Individual nymphs
were homogenized in PBS, and spotted onto slides. The homogenates were acetone
fixed, and blocked in 5% FBS/PBS at RT for 1 h. Twenty-five microliters of goat α-B.
burgdorferi-FITC (1:200) was applied to each spot, and incubated at RT for 1.5 h.
Slides were washed, and Anti-Fade (Molecular Probes, Eugene, OR) mounting media
was applied. Eighteen of 20 nymphs assessed were positive for B. burgdorferi which
results in an infection prevalence of 90%.
2.2. Cells and plasmids
BHK cells obtained from the American Type Culture Collection in passage 53 were
used between passages 54 and 64. Cells were maintained in alpha minimal essential
media containing 10% fetal calf serum, 10% tryptose phosphate broth, and 0.29 mg of
-glutamine per milliliter. For electroporation, cells were cultured overnight,
harvested when subconfluent, and prepared for electroporation as previously
described [15].
OspA was cloned from B. burgdorferi strain N40 using ospA forward primer (5′AGTCTAGTCCGCCAAGATGAAGCAAATGTTAGCAGCCTTGAACGAG-3′)
and reverse primer (3′GTCATAATCGATTATCATTTTAAAGCGTTTTTAATTTCATC-5′) creating a
850 bp fragment that was cloned into a TOPO TA cloning vector as specified by the
manufacturer (Invitrogen; Carlsbad, CA). To create the tpA-ospA construct, the tpA
signal sequence was produced from pJW4304 (gift from James Arthos, NIH) using
tpA forward primer (5′AGCCGAACTCTAGTCCGCCAAGATGAGCTTGCAATCA-3′) and reverse primer
(3′-CGACGATCGATAGCTTGCAATCATGGATGCAATG-5′). The tpA and ospA
PCR products were subjected to overlapping PCR, creating the tpA-ospA construct
that was subsequently cloned into a TOPO TA vector. The sequences of both ospA
and ospA-tpA constructs were confirmed by DNA sequencing.
2.3. Production of VEE replicon particles (VRPs) containing ospA and
tpA-ospA
OspA and tpA-ospA gene products were inserted into pVR21, the VEE replicon
expression vector downstream of the 26S promoter by overlapping extension PCR
[25]. Transcripts of pVR21-ospA and PVR21-tpA-ospA were generated in vitro using
a mMessage mMachine T7 transcription kit (Ambion; Austin, TX). Transcripts were
electroporated into 800 μl BHK cell suspensions at a concentration of 107 cells/ml in
PBS using three electrical pulses of 0.85 kV at 25 μF with a Bio-Rad Gene Pulser II
electroporator (Bio-Rad; Hercules, CA). VRPs were generated by co-electroporating
the transcript containing ospA or tpA-ospA with two helper mRNA’s encoding the
VEE capsid and attenuated glycoproteins [13]. The electroporated BHK cells were
seeded into 75 cm2 flasks and incubated at 37 °C for 24 h. VRPs were harvested by
clarifying the electroporated BHK supernatant by centrifugation at 10,000 rpm for
30 min, and then pelting the VRPs at 24,000 rpm for 3 h through a 20% sucrose
cushion. VRPs were assayed by indirect immunofluorescence (IFA) of VRP-infected
BHK cell monolayers and the titers of the resulting VRPs were 8.7×107 i.u./ml
(infectious units/ml) (VRP OspA) and 3.1×108 i.u./ml (VRP tPA-OspA).
2.4. Expression assays
BHK cells electroporated with RNA transcribed from pVR21-ospA and PVR21-tpAospA were incubated for 30 h at 37 °C. The culture media was separated from the
cells and clarified by centrifuging at 2000×g for 10 min. The BHK cells were
harvested with a cell scraper and resuspended in PBS. Cells were lysed in a 0.2% NP40/TAE buffer. For Western blot analysis, polypeptides from the cell supernatants and
cell lysates were separated by 12% SDS-PAGE and transferred to nitrocellulose at
400 mA for 75 min. The membranes were probed with polyclonal mouse α-OspA sera
at 1:400. The membranes were then incubated with goat α-mouse-alkaline
phosphatase (1:1000) (KPL, Gaithersburg, MD) and developed with BCIP/NBT (KPL,
Gaithersburg, MD). Treatment with PNGase (NEB, Beverly, MA) before PAGE was
used to determine presence of N-linked glycosylation.
2.5. Immunization
Mice were immunized subcutaneously (s.c.) via footpad inoculation with 1×106 i.u. of
VRPs in 10 μl at days 0 and 21. Control mice were immunized s.c. (above the
shoulder) with 100 μl containing 20 μg of purified recombinant protein in Freund’s
complete adjuvant or Alum (Alumax, Pierce, IL) on day 0, and boosted with 20 μg
protein in Freund’s incomplete adjuvant or Alum on day 21.
2.6. ELISA assays for determining total specific IgG and IgG isotype
Sera from vaccinated mice at days 0, 14 and 35 were tested for α-OspA antibodies on
96 well ELISA plates (Griener, Lake Murray, FL). Each well on the plate was treated
with 10 μg of OspA-glutathione-S-transferase fusion protein (OspA-GST) in 100 μl of
carbonate binding buffer (pH 9.2) overnight at 4 °C to coat the well with OspA. Plates
were washed with TBST (Tris buffer saline–0.2% Tween-20), and blocked with
0.25% BSA in TBS (Tris buffer saline) for 30 min at 37 °C. Sera from immunized
mice were applied to ELISA plates in multiple dilutions in blocking buffer, and
incubated at 37 °C for 90 min. The plates were washed three times in TBST, and
incubated with goat α-mouse-alkaline phosphatase (1:1000) for 60 min at 37 °C. The
plates were washed three times in TBST, developed with pNPP (Sigma, St. Louis,
MO) before measuring absorbance at 405 nm.
The isotyping ELISAs were similar to the total IgG ELISAs, except that the
secondary antibodies were alkaline-phosphatase conjugated isotype specific
antibodies (Bethyl Laboratories, Montgomery, TX) were used at dilutions of 1:1000
(IgG1), 1:800 (IgG2a, IgG2b) and 1:400 (IgG3).
2.7. Immunohistochemistry
At 18 h after innoculation with VRPs mice were sacrificed via cervical dislocation,
and draining popliteal lymph nodes were removed. The unfixed tissues were fresh
frozen in a supercooled N-methylbutanol bath, cryosectioned, and fixed with 4%
paraformaldehyde in PBS. Sections were blocked in 10% normal goat serum/PBS for
1 h, washed with PBS, and incubated with rabbit α-OspA Ab at 1:200 overnight at
4 °C. The sections were thoroughly washed, and incubated with goat α-rabbit-FITC at
1:500 for 1 h at room temperature (RT).
2.8. Bacterial load in ticks
Ticks that had fed for 60 h were homogenized, spotted onto silylated slides and
acetone fixed, and blocked in 5% FBS/PBS at RT for 1 h. 25 μl of goat-α-B.
burgdorferi-FITC (1:200) was applied to each spot, and incubated at RT for 1.5 h.
Slides were washed, and Anti-Fade (Molecular Probes, Eugene, OR) mounting media
was applied. The spirochetes in each sample were counted by IFA as previously
described [5].
2.9. Evaluation of mice for B. burgdorferi infections
Three weeks after tick detachment mice were sacrificed and serum, spleen and
bladder samples were obtained. Samples were placed in BSK-II media, incubated at
34 °C, and checked weekly for evidence of spirochetes by dark field microscopy.
The serum was probed for production of α-B. burgdorferi antibodies by Western blot
as previously done [7].
3. Results
3.1. OspA protein production by VEE mRNA and replicons
The full length OspA protein when produced in B. burgdorferi is a 273 AA protein,
with a 16 AA signal sequence and a lipidation sequence at the N-terminus. The 16 AA
signal sequence is cleaved and the protein is attached to the outer membrane by a lipid
anchor attached to a cysteine residue at position 17. For the current study, two
different VEE replicons expressing ospA were produced. We used B. burgdorferi N40
ospA as template but used B31 infected ticks to challenge immunized mice. They are
99% similar, and cross-protection between the two stains has been shown previously
[26 and 27]. The first replicon was designed to produce the region of ospA encoding
the mature protein (A.A. 18-273) only (Fig. 1). We expected ospA expressed from this
replicon to accumulate in the cytoplasm of cells because it did not contain a signal
sequence for secretion. The second replicon expressing ospA was designed to target
the protein to the secretion pathway of eukaryotic cells by fusing a tissue plasminogen
activator (tPA) signal sequence to the N-terminus of the ospA gene (Fig. 1). Each
ospA gene was inserted into the plasmid pVR 21, which contains all the VEE
nonstructural genes along with a strong promoter for expressing the foreign gene of
interest [25]. When replicon RNAs transcribed in vitro from these plasmids (pVR 21OspA and pVR 21-tPA-OspA) were electroporated into cultured cells, both resulted in
the synthesis of OspA ( Fig. 2A). As expected, the OspA expressed without the signal
sequence was mainly present in the cell pellet whereas the OspA expressed with the
tPA signal sequence was mainly secreted into the media (Fig. 2A).
(19K)
Fig. 1. Forms of OspA used in this study. Native full length OspA shown in relation to the three VRP
expressed genes (OspA, tPA-OspA, and HA) along with purified recombinant proteins, OspA-GST and
GST.
(7K)
Fig. 2. Production of OspA from RNA transcripts of pVR21-OspA and pVR21-tPA-OspA. (A) OspA
produced by pVR21-OspA transfected BHK cell lysate (2) and supernatant (1). pVR21-tPA-OspA
transfected BHK cell supernatant (3) and cell lysate (4). (B) OspA produced by pVR21-tPA-OspA
displayed the ladder pattern consistent with N-linked glycosylation. Cell supernatants were incubated
either without (1) or with (2) PNGase overnight at 37 °C prior to being resolved.
The protein produced by the tPA-OspA replicon RNA was distributed among multiple
bands indicating possible glycosylation during secretion. The ospA sequence has five
potential N-linked glycosylation sites. When the protein produced by tPA-OspA was
treated with N-glycosidase, the multiple bands disappeared leaving a single, faster
migrating band corresponding to the size of the band produced by the replicon RNA
lacking the signal sequence (Fig. 2B) confirming that the OspA expressed with the
tPA signal sequence was, indeed, glycosylated in mammalian cells.
Once we determined that each VEE-ospA replicon expressed OspA in BHK cells,
VEE replicon particles were produced. The VRPs were capable of infecting BHK
cells and driving the expression of ospA as determined by immunofluorescence using
anti-OspA antibodies (data not shown). BHK cells were also used to titer each
replicon. The VRPs expressing ospA alone had a titer of 8.7×107 i.u./ml whereas the
replicons coding for tPA-ospA had a titer of 3.1×108 i.u./ml.
3.2. Vaccination of mice with VRP OspA and VRP tPA-OspA
In order to assess the immunogenicity of the two OspA-expressing VRPs, vaccine
trials were carried out as outlined in Fig. 3. In the first trial groups of four mice were
immunized with VRP particles (1×106 i.u.) expressing ospA or tPA-ospA by footpad
injection as previously described [28]. A control for the replicon system was included
by inoculating a group with 1×106 i.u. of influenza hemaglutinin (HA) encoding
replicons. The other groups consisted of mice inoculated subcutaneously with the
recombinant OspA-GST fusion protein or GST alone in the presence of Freund’s
adjuvant. In the second trial eight mice were immunized with the tPA-OspA VRPs
and four mice each were immunized with recombinant OspA-GST or GST alone
resuspended in Alum as an adjuvant. Sera were collected on days 0, 14 and 35 in
order to determine serum antibody levels against OspA.
(9K)
Fig. 3. Schematic of immunization schedule. Groups of mice were immunized initially on day 0, and
boosted on day 21. Sera were collected from the mice prior to initial vaccination on days 0, 14 and 35.
After the initial vaccination, antibody responses were detected in the mice immunized
with OspA-GST protein as well as with tPA-OspA VRPs (Fig. 4). After boosting,
significantly (Student’s t-test, P<0.01) increased responses were detected in the mice
immunized with OspA-GST and VRP tPA-OspA (Fig. 4). These results indicate that
VRPs expressing tPA-OspA were capable of stimulating an antibody response, unlike
the VRPs expressing OspA alone without a secretion signal sequence. Furthermore,
the VRP tPA-OspA generated significantly (Student’s t-test, P<0.01) greater antibody
levels than the OspA-GST recombinant protein in Alum adjuvant.
(13K)
Fig. 4. Induction of α-OspA IgG antibodies by different immunogens. Serum was collected at days 0
(not shown), 14 and 35 to determine amount of serum IgG against OspA. Each group is an average of
four mice, except for VRP tPA-OspA which is an average of 12 mice. Standard deviation is indicated
by error bars. (*) Indicates group significantly different from GST control at same time point (P<0.01).
(**) Indicates significantly different from both GST and Alum OspA-GST at same time point (P<0.01).
The different immune responses against VRP OspA and VRP tPA-OspA may be due
to the intracellular and extracellular location of the OspA. Alternatively, only the VRP
tPA-OspA may be expressed in vivo following footpad inoculation. VRP’s have
previously been shown to infect and express foreign antigen in the popliteal lymph
nodes of immunized mice [16]. To distinguish between these possibilities, mice were
immunized with VRPs encoding ospA and tPA-OspA. The popliteal lymph nodes
were removed 18 h post-footpad immunization, cryosectioned, and probed by IFA for
cells expressing OspA. It was determined that both VRPs were capable of infecting
and producing OspA in lymph node cells (Fig. 5). The lack of an antibody response to
VRP OspA replicons was not due to the lack of in vivo expression of OspA, but more
likely due to the cellular localization of the protein that it produced.
(42K)
Fig. 5. Detection of OspA in mouse popliteal lymph nodes. Individual mice were immunized with
5×105 i.u. of VRP OspA (1), VRP tPA-OspA (2), or PBS alone (3) in each hind footpad. Eighteen
hours post-immunization, mice were euthanised, and popliteal lymph nodes were removed, snap frozen,
and cryosectioned. The sections were probed with rabbit α-OspA polyclonal sera, and a goat-α-rabbitFITC 2° antibody.
3.3. Characterization of immune responses elicited by the different
OspA-based vaccines
The method of vaccine delivery can alter the host immune response against the
vaccine antigen. Studies were done to characterize T helper cell subsets activated
following immunization with VRPs or protein antigens. VRP tPA-OspA and OspAGST produced significant levels of serum antibodies, which allowed us to isotype the
antibody profiles of these two immunogens. OspA-GST in Freund’s produced
significant (Student’s t-test, P<0.01) levels of IgG1, IgG2a and IgG2b (Fig. 6B),
indicating a mixed Th-1 and Th-2 response. The mice immunized with VRP tPAOspA and the OspA-GST protein in Alum produced significant (Student’s t-test,
P<0.01) levels of IgG2a, with lesser levels of IgG2b indicating a mainly TH1 type
response (Fig. 6). We confirmed that mice immunized with VRP constructs generated
a TH1 type response by measuring cytokines secreted by spleenocytes harvested from
immunized mice 21 days after their final boost. Cells from mice immunized with
OspA and tPA-OspA VRPs produced higher levels of INF-γ than cells from control
VRP HA animals (data not shown). Both the antibody isotype and cytokine data
confirmed that mice immunized with VRPs developed a TH1 type response against
OspA.
(30K)
Fig. 6. Serum IgG isotype profile of mice immunized with VRP tPA-OspA or OspA-GST in Alum or
Freund’s adjuvant. Sera collected at day 35 were used in the OspA ELISA with isotype specific 2°
antibodies. VRP tPA-OspA resulted in the productions of mainly IgG2a, with some IgG2b (A). OspAGST in Freund’s produced significant amounts of all IgG isotypes other than IgG3 (B). When Alum
was used as the adjuvant, OspA-GST produced predominantly IgG2a (C). IgG3 was tested but not
detected in any samples. (*) Indicates group level significantly different that GST control (P<0.01).
3.4. Challenge of immunized mice with B. burgdorferi infected ticks
Protection of animals receiving OspA vaccines is mainly dependent on circulating
levels of antibody because transmission is blocked within the tick gut where host
cellular immunity is unlikely to be functional. Mice immunized with the different
OspA vaccines were challenged with five to eight infected I. scapularis nymphs.
Three weeks after tick challenge, the mice were tested for Borrelia infection by
serology and by organ culture. When mouse sera were tested by Western blot, it was
evident that the majority of mice immunized with OspA-GST/Freund’s (4/4), OspAGST/Alum (3/4), and VRP tPA-OspA (10/12) were protected from infection (Table 1).
The serology results were confirmed by culture of Borrelia from mouse organs (Table
1).
Table 1. Prevention of infection with tick-borne B. burgdorferi
Three weeks post-tick detachment, serum was collected from each mouse to determine production of αB. burgdorferi antibodies other than OspA. Mice were then euthanised, and spleen and bladder were
cultured in BSK-II media. Cultures were examined weekly for 4 weeks and scored for either positive or
negative growth of the spirochetes. (One set of organ cultures from the VRP OspA and VRP HA were
contaminated.)
3.5. Assessment of bacterial load within infected ticks
Anti-OspA antibodies block transmission by binding to spirochetes within the tick gut.
Infected ticks removed at 60 h from vaccinated animals were tested for Borrelia
infection to determine if VRPs stimulated an antibody response that reduces the
number of spirochetes within the tick gut. Spirochete numbers were significantly
reduced (Student’s t-test, P<0.01) within ticks that fed on mice immunized with tPAOspA VRPs and OspA-GST fusion proteins in comparison to ticks that fed on a
control mouse (Fig. 7). The highest level of killing was seen in ticks that fed on a
mouse immunized with OspA-GST in Freund’s adjuvant, which is consistent with
these mice having higher antibody levels. Mice immunized with VRP OspA and VRP
HA showed no reduction in the number of B. burgdorferi within the ticks when
compared with the negative controls (data not shown), which is consistent with the
lack of protection observed among mice in these groups.
(7K)
Fig. 7. Percent survival of B. burgdorferi in partially engorged I. scapularis nymphs. Two to four ticks
were removed from each mouse 60 h into the bloodmeal. Pairs were homogenized in 50 μl of PBS, and
spotted onto silylated slides, and stained with α-B. burgdorferi-FITC antibodies to detect number of
spirochetes. Five fields were counted in four spots at 400× for each sample. Numbers are expressed at
percent of spirochetes in each sample with the number in the GST negative control set at 100. (*)
Indicates group level significantly different that GST control (P<0.01).
4. Discussion
Venezuelan Equine Encephalitis virus replicon particles are effective vaccine vectors
for protecting against a number of viral pathogens. We have evaluated VEE replicon
particles as a delivery system for the OspA vaccine against the extracellular bacterium,
B. burgdorferi. During the life cycle of the Lyme disease spirochete, OspA is
mainly produced by bacteria within the tick gut. The OspA vaccine confers protective
immunity by targeting the bacteria in the tick gut and preventing transmission to the
host. Robust antibody responses are vital to conferring protection in OspA-based
vaccines. We were especially interested in the ability of VEE replicons to stimulate
the production of antibodies because they are the effector molecules in the bloodmeal
that block transmission.
We evaluated VEE replicons with (VRP tPA-OspA) or without (VRP OspA) a
eukaryotic secretion signal. OspA expressed without a signal sequence accumulated
in the cytoplasm of VRP infected cells. OspA with a signal sequence was targeted to
the secretion pathway as evidenced by the presence of N-linked sugars on the protein
as well as its accumulation outside cells. When mice were immunized with the VRPs,
both constructs infected lymph node cells and induced a specific cytokine (IFN-γ)
response. However, only the tPA-OspA VRP induced an antibody response. Others
have also observed that antigens that accumulate inside cells are prone to inducing a
cellular immune response with little or no antibody production unlike secreted
antigens that stimulate both humoral and cellular immunity [25]. Given the primary, if
not exclusive, role of antibody in OspA mediated protection, we expected only the
secreted construct to be effective. In fact, when VRP vaccinated animals were
challenged, only the tPA-OspA VRP vaccinated animals were protected and none of
the animals receiving the OspA VRPs were protected.
The tPA-OspA produced within mammalian cells was different from the native
Borrelia protein because tPA-OspA was glycosylated. The N-linked sugars might
alter the epitopes on the protein compared to the native bacterial protein. Additionally,
it has been shown that glycosylation can affect how a peptide is presented to the
immune system. Manoury et al. showed that N-glycosylation of an antigen could
block presentation by MHC II molecules [29]. Similarly, tPA-OspA may have also
stimulated a TH1 type response because glycosylation blocked MHC class II
presentation.
Recently, an epitope of OspA has been found to have homology with human
leukocyte function-associated antigen-1 (hLFA-1) [30]. Patients that have been
diagnosed with treatment-resistant Lyme arthritis were found to generate a response
to OspA when compared to other groups of chronic arthritis patients [30]. This raises
concerns over vaccinating people with OspA, especially in individuals who carry the
HLA-DRB1*0401 allele. However, both pre- and post-clinical evaluations show no
signs that vaccinating with OspA induces this type of auto-immune response [31]. We
have produced constructs with amino acid changes in the region of OspA suspected to
mimic hLFA-1. In future studies we plan to assess how changes in this region affect
immunogenicity and vaccine efficacy.
In summary, we have used a tick challenge mouse model to demonstrate that VEE
replicons can be used to deliver an OspA vaccine that is similar in efficacy to a
recombinant OspA protein vaccine. In human challenge studies with the recombinant
protein antigen in Alum, vaccine efficacy was 80% in people receiving three doses of
the vaccine (0, 1 and 12 months). The vaccine failures were associated with lower
antibody titers and it is likely that people would have to be boosted with the
recombinant protein at regular intervals to maintain protective antibody levels. We are
currently testing if the VEE replicon particle delivery method could be used to
develop an OspA vaccine that generates longer lasting antibody levels and would
require fewer boosts than the recombinant protein vaccine.
Acknowledgements
We thank Kevin Brown, Martha Collier and Gene MacDonald for advice and
technical assistance. We also thank members of the de Silva Laboratory for their help.
Clay Gipson was supported by NIH training grant T32 AR074416-22. These studies
were also supported by grants from the NIH (K01 AR02061-06 and R01 AR4794801) and an Academic Research Initiation Grant from the North Carolina
Biotechnology Center.
References
1. A.C. Steere, Lyme disease. N. Engl. J. Med. 321 9 (1989), pp. 586–596.
Abstract-EMBASE | Abstract-MEDLINE | Order Document
2. Recommendations for the use of Lyme disease vaccine. Recommendations of the
Advisory Committee on Immunization Practices (ACIP). MMWR Morb Mortal Wkly
Rep 1999;48(RR-7):1–17, 21–15.
3. J. Ohnishi, J. Piesman and A.M. de Silva, Antigenic and genetic heterogeneity of
Borrelia burgdorferi populations transmitted by ticks. Proc. Natl. Acad. Sci. U.S.A.
98 2 (2001), pp. 670–675. Abstract-MEDLINE | Abstract-Elsevier BIOBASE |
Abstract-EMBASE | Order Document | Full Text via CrossRef
4. A.M. de Silva, N.S. Zeidner, Y. Zhang, M.C. Dolan, J. Piesman and E. Fikrig,
Influence of outer surface protein A antibody on Borrelia burgdorferi within feeding
ticks.Infect Immun. 67 1 (1999), pp. 30–35. Abstract-EMBASE | AbstractMEDLINE | Order Document
5. A.M. de Silva, S.R. Telford, III, L.R. Brunet, S.W. Barthold and E. Fikrig, Borrelia
burgdorferi OspA is an arthropod-specific transmission-blocking Lyme disease
vaccine. J. Exp. Med. 183 1 (1996), pp. 271–275. Abstract-MEDLINE | AbstractElsevier BIOBASE | Order Document | Full Text via CrossRef
6. A.C. Steere, V.K. Sikand, F. Meurice et al., Vaccination against Lyme disease
with recombinant Borrelia burgdorferi outer-surface lipoprotein A with adjuvant.
Lyme Disease Vaccine Study Group. N. Engl. J. Med. 339 4 (1998), pp. 209–215.
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
7. E. Fikrig, S.W. Barthold, F.S. Kantor and R.A. Flavell, Protection of mice against
the Lyme disease agent by immunizing with recombinant OspA. Science 250 4980
(1990), pp. 553–556. Abstract-EMBASE | Abstract-MEDLINE | Order Document
8. O. Mendoza-Vega, E. Keppi, B. Bouchon, M. Nguyen and T. Achstetter,
Recombinant outer-surface protein A (des-Cys1-OspA) from the Lyme disease
spirochete Borrelia burgdorferi: high production levels in Saccharomyces cerevisiae
yeast cultures. Appl. Microbiol. Biotechnol. 44 5 (1996), pp. 624–628. AbstractEMBASE | Abstract-MEDLINE | Order Document | Full Text via CrossRef
9. S. Langermann, S. Palaszynski, A. Sadziene, C.K. Stover and S. Koenig, Systemic
and mucosal immunity induced by BCG vector expressing outer-surface protein A of
Borrelia burgdorferi. Nature 372 6506 (1994), pp. 552–555. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
10. C.J. Luke, K. Carner, X. Liang and A.G. Barbour, An OspA-based DNA vaccine
protects mice against infection with Borrelia burgdorferi. J. Infect Dis. 175 1 (1997),
pp. 91–97. Abstract-MEDLINE | Order Document
11. W. Zhong, K.H. Wiesmuller, M.D. Kramer, R. Wallich and M.M. Simon, Plasmid
DNA and protein vaccination of mice to the outer surface protein A of Borrelia
burgdorferi leads to induction of T helper cells with specificity for a major epitope
and augmentation of protective IgG antibodies in vivo. Eur. J. Immunol. 26 11 (1996),
pp. 2749–2757. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document
12. R. Wallich, A. Siebers, O. Jahraus, C. Brenner, T. Stehle and M.M. Simon, DNA
vaccines expressing a fusion product of outer surface proteins A and C from Borrelia
burgdorferi induce protective antibodies suitable for prophylaxis but not for
resolution of Lyme disease. Infect Immun. 69 4 (2001), pp. 2130–2136. AbstractEMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order Document |
Full Text via CrossRef
13. P. Pushko, M. Parker, G.V. Ludwig, N.L. Davis, R.E. Johnston and J.F. Smith,
Replicon–helper systems from attenuated Venezuelan equine encephalitis virus:
expression of heterologous genes in vitro and immunization against heterologous
pathogens in vivo. Virology 239 2 (1997), pp. 389–401. Abstract | Abstract +
References | PDF (252 K)
14. C. Xiong, R. Levis, P. Shen, S. Schlesinger, C.M. Rice and H.V. Huang, Sindbis
virus: an efficient, broad host range vector for gene expression in animal cells.
Science 243 4895 (1989), pp. 1188–1191. Abstract-MEDLINE | Order Document
15. P. Liljestrom and H. Garoff, A new generation of animal cell expression vectors
based on the Semliki Forest virus replicon. Biotechnology (NY) 9 12 (1991), pp.
1356–1361. Abstract-MEDLINE | Abstract-EMBASE | Order Document | Full Text
via CrossRef
16. G.H. MacDonald and R.E. Johnston, Role of dendritic cell targeting in
Venezuelan equine encephalitis virus pathogenesis. J. Virol. 74 2 (2000), pp. 914–922.
Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
17. N.L. Davis, K.W. Brown and R.E. Johnston, A viral vaccine vector that expresses
foreign genes in lymph nodes and protects against mucosal challenge. J. Virol. 70 6
(1996), pp. 3781–3787. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | AbstractEMBASE | Order Document
18. Walton TE, Grayson MA. Venezuelan equine encephalomyelitis. In: TP, M (Ed.),
The arboviruses: epidemiology and ecology. Boca Raton (FL): CRC Press; 1989. p.
203–32.
19. Venezuelan equine encephalitis—Colombia, 1995. MMWR Morb Mortal Wkly
Rep 1995;44(39):721–4.
20. Update: Venezuelan equine encephalitis—Colombia, 1995. MMWR Morb Mortal
Wkly Rep 1995;44(41):775–7.
21. M. Hevey, D. Negley, P. Pushko, J. Smith and A. Schmaljohn, Marburg virus
vaccines based upon alphavirus replicons protect guinea pigs and nonhuman primates.
Virology 251 1 (1998), pp. 28–37. Abstract | Abstract + References | PDF (1438 K)
22. P. Pushko, J. Geisbert, M. Parker, P. Jahrling and J. Smith, Individual and bivalent
vaccines based on alphavirus replicons protect guinea pigs against infection with
Lassa and Ebola viruses. J. Virol. 75 23 (2001), pp. 11677–11685. AbstractMEDLINE | Abstract-EMBASE | Order Document | Full Text via CrossRef
23. M.S. Hanson, D.R. Cassatt, B.P. Guo et al., Active and passive immunity against
Borrelia burgdorferi decorin binding protein A (DbpA) protects against infection.
Infect Immun. 66 5 (1998), pp. 2143–2153. Abstract-EMBASE | AbstractMEDLINE | Order Document
24. K.E. Hagman, X. Yang, S.K. Wikel et al., Decorin-binding protein A (DbpA) of
Borrelia burgdorferi is not protective when immunized mice are challenged via tick
infestation and correlates with the lack of DbpA expression by B. burgdorferi in ticks.
Infect Immun. 68 8 (2000), pp. 4759–4764. Abstract-Elsevier BIOBASE | AbstractEMBASE | Abstract-MEDLINE | Order Document | Full Text via CrossRef
25. U.B. Balasuriya, H.W. Heidner, J.F. Hedges et al., Expression of the two major
envelope proteins of equine arteritis virus as a heterodimer is necessary for induction
of neutralizing antibodies in mice immunized with recombinant Venezuelan equine
encephalitis virus replicon particles. J. Virol. 74 22 (2000), pp. 10623–10630.
Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
26. S.R. Telford, .III, E. Fikrig, S.W. Barthold, L.R. Brunet, A. Spielman and R.A.
Flavell, Protection against antigenically variable Borrelia burgdorferi conferred by
recombinant vaccines. J. Exp. Med. 178 2 (1993), pp. 755–758. AbstractMEDLINE | Order Document | Full Text via CrossRef
27. W.S. Probert, M. Crawford, R.B. Cadiz and R.B. LeFebvre, Immunization with
outer surface protein (Osp) A, but not OspC, provides cross-protection of mice
challenged with North American isolates of Borrelia burgdorferi. J. Infect Dis. 175 2
(1997), pp. 400–405. Abstract-MEDLINE | Abstract-EMBASE | Order Document
28. I.J. Caley, M.R. Betts, D.M. Irlbeck et al., Humoral, mucosal, and cellular
immunity in response to a human immunodeficiency virus type 1 immunogen
expressed by a Venezuelan equine encephalitis virus vaccine vector. J. Virol. 71 4
(1997), pp. 3031–3038. Abstract-MEDLINE | Abstract-EMBASE | Order Document
29. B. Manoury, E.W. Hewitt, N. Morrice, P.M. Dando, A.J. Barrett and C. Watts, An
asparaginyl endopeptidase processes a microbial antigen for class II MHC
presentation. Nature 396 6712 (1998), pp. 695–699. Abstract-EMBASE | AbstractMEDLINE | Order Document
30. D.M. Gross, T. Forsthuber, M. Tary-Lehmann et al., Identification of LFA-1 as a
candidate autoantigen in treatment-resistant Lyme arthritis. Science 281 5377
(1998), pp. 703–706. Abstract-EMBASE | Abstract-MEDLINE | Order Document |
Full Text via CrossRef
31. Jain VK. Recombinant OspA vaccine: assessment four years after FDA approval.
In: Proceedings of the IX International Conference on Lyme Borreliosis and Other
Tick-Borne Diseases, New York; 2002.
Vaccine
Volume 21, Issues 25-26 , 8 September 2003, Pages 3875-3884
Corresponding author. Tel.: +1-919-843-9964; fax: +1-919-962-8103.
Experimental infection of laboratory mice and
rabbits with several isolates of Borrelia burgdorferi
sensu lato; comparison of antigens from different
genospecies in serological measurement of immune
responses
J. Tuomi, L. K. Rantamäki and R. Tanskanen
,
Faculty of Veterinary Medicine, Department of Basic Veterinary Sciences, University
of Helsinki, PO Box 57, 00014 Helsinki, Finland
Accepted 10 September 2001 Available online 14 December 2001.
Abstract
Infectivity of and immune responses to 28 Finnish Borrelia burgdorferi sensu lato
isolates was studied in 3–4-week-old outbred NMRI and inbred BALB/c/Hy
laboratory mice; rabbits were also inoculated. Twenty-one isolates were found to
detectably infect mice. A variation among isolates in degree of infectivity was
observed. Higher infection rate and higher average ELISA readings were recorded for
intradermal than intraperitoneal inoculations. The results suggest differences between
Borrelia genospecies in organotropism. The ear was frequently infected by
representatives of all genospecies; among high infectivity experiments, this rate was
highest, 100%, in infections by Borrelia afzelii. Further differences between
genospecies specific organ distributions: B. burgdorferi sensu stricto and Borrelia
garinii isolates seemed to infect the bladder relatively more frequently than B. afzelii
did; B. afzelii isolates infected heart relatively more frequently than others did.
Genospecies specific differences were demonstrated between antigens in reactivity,
i.e. in their ‘sensitivity’ as reagents of ELISA and IFA methods to measure isolate
specific immune responses. Antigens from two B. afzelii isolates differed clearly in
sensitivity.
Résumé
Les réponses infectieuses et immunes des souris NMRI et BALB/c/Hy à 28 souches
de Borrelia burgdorferi isolées en Finlande ont été étudiées. Des lapins ont également
été inoculés. 21 souches ont pu infecter la souris. Une variation dans le degré
d'infection a été observée. Un taux d'infection plus élevé et un taux d'anticorps plus
élevé à l'ELISA ont été trouvés pour les inoculations intradermiques, que pour les
inoculations intraperitonéales. Les résultats suggèrent des différences dans
l'organotropisme des Borrelia. L'oreille était fréquemment infectée par les
représentants de toutes les espèces types. Un taux de 100% d'infection a été décelé
pour Borrelia afzelii. Des différences ont été notées dans la distribution des organes
infectés: Borrelia burgdorferi et Borrelia garinii semblent infecter plus souvent la
vessie que Borrelia afzelii; Borrelia afzelii a été isolée plus fréquemment dans le
coeur que les autres espèces. Les différences entre espèces ont été observées en ce qui
concerne la réactivité des antigènes c'est à dire leur "sensibilité" à l'ELISA et
l'immunofluorescence.
Author Keywords: Borrelia burgdorferi; Genospecies; Infectivity; Mice; ELISA;
Antigen sensitivityAuthor Keywords: Borrelia burgdorferi; Les espèces types;
Infectivité; Souris; ELISA; La réactivité des antigènes
Article Outline
1. Introduction
2. Materials and methods
2.1. Experimental animals
2.2. Isolates of B. burgdorferi sensu lato used in the inoculations
2.3. Inoculation of animals and collection of blood samples
2.4. Isolation of Borreliae
2.5. ELISA
2.6. IFA
2.7. Sensitivity
3. Results
4. Discussion
Acknowledgements
References
1. Introduction
In Europe, the three genospecies of Borrelia burgdorferi sensu lato known to be
pathogenic for humans are B. burgdorferi sensu stricto (s.s.), Borrelia garinii, and
Borrelia afzelii. Isolates representative of all three genospecies have been isolated
from Ixodes ricinus ticks in Finland [1 and 2]. Part of the isolates have been subjected
to some basic characterizations, especially immunological [2]. In addition, some
isolates have been studied for their infectivity for cattle [3].
The present experiments were designed to study infectivity of various B. burgdorferi
sensu lato isolates and to characterize infections and responses to infections caused by
them, mainly in laboratory mice but also in rabbits. Responses in these laboratory
animals were monitored by the isolation method and serologically by both ELISA and
IFA techniques. Genospecies specific distribution of borreliae in infected mice was of
major interest. As antigens in serology, isolates from all three genospecies were
comparatively studied.
2. Materials and methods
2.1. Experimental animals
The infection experiments were performed in the Unit for Studies of Infectious
Diseases in Large Animals at the former Veterinary College. Mice were either
outbred NMRI or inbred BALB/c/Hy mice from the Laboratory Animal Center of
Helsinki University. The ages of mice at inoculation were 3–6-weeks. New Zealand
White rabbits, 4–6-months of age, were purchased from a local commercial colony
providing rabbits for experimental purposes.
2.2. Isolates of B. burgdorferi sensu lato used in the inoculations
All 28 isolates used in the infection studies had been isolated from Ixodes ricinus ticks
collected during the summer of 1992 in Finland [1]. Their genospecies identities were
determined and are given with documentations in another study [2]. Of the isolates,
Y8, Y19, Y26 and Ri5 represent genospecies B. burgdorferi s.s., M2, K3, H1, K5, Ri1,
Ri3, Ri4, Ri8, P1, U2, U4, Y13, Y16, Y17, and Y29 are B. garinii isolates and K1,
K4, H2, H7, Po1, Y12 are B. afzelii isolates. Isolates M1 and U1 are atypical B. afzelii
strains and Y18 could not be classified.
BSKII medium was used for culturing the isolates. Some isolates were passaged in
mice before their use in the present experiments (see Table 1 and Table 2).
Table 1. In comparative "large experiments"a, two groups of six laboratory mice, each divided in threemice subgroups, were inoculated, one intradermally, the other intraperitoneally, with one of Finnish
isolates of Borrelia burgdorferi sensu lato. Two other types of experiments with inoculum size other
than in large experiments were made each in one six-mice group only. The two subgroups within each
six-mice group were sacrificed separately, at different times postinoculation. Experiments found
positive by ELISA and/or IFA and/or isolation method are included in this Table. (Note. The 14
negative large experiments were inoculations with isolates (x refers to number of experiments;
P=passages in culture; M=passages in culture after mouse passage): M2x2, p7 in both; Y13, p3; P1, p4;
H7, p3; H1, p2; K1, p1; Po1, p14; Ri5x2, p5, p12; M1x2, p3, p6; U1, p6; Y19, m1.)
Table 2. Organ specific infection rates in BALB/c and NMRI mice inoculated with various Borrelia
burgdorferi sensu lato isolates. Included are experimentsa in which overall infection rate of mice was
50% or higher. All these experiments were also positive by ELISA
2.3. Inoculation of animals and collection of blood samples
Inocula were prepared as described earlier [3]. In brief, borreliae were counted using
the method of Stoenner [4] from undiluted or 1:10 diluted cultures. Isolates in their
late exponential-early stationary phase—some primary cultures in late stationary
phase—were removed from BSKII medium by centrifugation (9000×g for 30 min)
and suspended in phosphate buffered saline, pH 7.4 (PBS). Borreliae to be inoculated
were not washed, as in preliminary trials washing seemed to affect adversely borreliae.
For the majority, 32 in all, of the mouse inoculations, called large experiments, a
dilution containing 104 borreliae/0.3 ml was prepared, allowing a programme in
which six mice each received 104 borreliae intraperitoneally (i.p.), and another six
(rarely nine) received 3.3×103 borreliae intradermally (i.d.) (positive experiments are
displayed in Table 1). This dilution was also used to perform a confirming viable
count by growth titration with a dilution series in BSKII medium. In the four-mouse
experiments of the second category, 3×105 to 5×105 borreliae were administered i.d.
only (Table 1). The third category mouse experiments, in which the size of inoculum
was unknown, were made (a) to study infectivity of several random isolates at various
phases of their passage history, or, and especially, of some primary cultures kept first
about 2 months at 34°C and then further stored for 2–5 months at 4°C, and (b) for the
purpose of purifying contaminated cultures (third category positive experiments are
displayed in Table 1 and Table 2). Rabbits were inoculated in pairs. The sizes of the
inocula injected subcutaneously (sc) or intravenously (iv) varied from 5×102 to 108.
Rabbit inoculations, and IFA results, positive or negative, of the studies of their
immune responses, have been described previously only in a preliminary, limited way
[3]. In [3] of that article, the isolates inoculated and sizes of inocula for the 20 rabbits
included in the studies are given. In addition to all the rabbit inoculations, some of the
present mouse inoculations were likewise partially designed to offer infectivity
controls to cattle inoculations and have only to that effect, isolation + or −, been
reported earlier [3].
For antibody studies, a combined serum from each three-mice group killed
simultaneously was obtained. Blood was also collected from rabbits for both borrelia
isolation attempts and for separation of serum. For Borrelia culturing attempts, the
scheme of whole blood sampling was: twice weekly for 3 weeks and thereafter once
weekly for 3 additional weeks. Blood for serum was collected once weekly
throughout the experiments.
2.4. Isolation of Borreliae
In the majority of experiments, half of each six-mice group, constituting the threemice ‘unit experiment’, were killed 3–4 weeks (occasionally 2 or 6 weeks, see Table
1) postinoculation, and the other half one week later (rarely 2 weeks, once 4 weeks
later, Table 1). In the third category experiments, three to six mice were inoculated
and then killed after 2–5 weeks, all at the same time or in two groups as in other
experiments ( Table 1 and Table 2). Isolation was attempted from blood, heart,
bladder and spleen according to Schwan et al. [5], with some modifications. For
trituration of tissues in 1 ml of BSKII medium, mortar and pestle was used. Three
portions of approximately 0.3 ml of each suspension were inoculated into three tubes
containing 6 ml of BSKII medium, two of the tubes containing phophomycin
(100 μg/ml) and rifampin (50 μg/ml) and the third being without antibiotics. Only two
tubes, one with and the other without antibiotics, were inoculated with blood,
0.1 ml/tube. For many of the three-mice groups isolation was also attempted from a
piece of the ear [6]. As with blood, only two tubes were inoculated. From rabbits,
whole blood samples obtained according to the scheme described above were cultured
as blood from mice. The culture tubes were incubated at 34°C and, for most of the
experiments, examined by dark-field microscopy at least twice after about 1 and 2
months of culturing; some cultures were also studied in an earlier phase. For a few
experiments, the first examination could be delayed with a few weeks and
confirmative examinations could be made as late as 6 months after inoculation of
tubes.
2.5. ELISA
The antigens and ELISA plates were prepared as described earlier [3]. The mouse and
rabbit sera were diluted 1:500, and 100 μl was applied per well and incubated for 2 h
at 37°C. After washing the plates, the conjugate MIG5-POD [7 and 8], an IgGbinding region from Protein MIG fused to MAL and conjugated with horseradish
peroxidase according to Wilson and Nakane [9], was used for the mouse sera. The
conjugate was a kind gift from Dr Peter Mueller, Department of Microbiology,
University of Agricultural Sciences, Uppsala, Sweden. For rabbit sera, the conjugate
Protein G-POD was applied as described earlier [3], as were also the following steps.
Each serum was tested as duplicate, and on each plate a negative serum and a twofold serially diluted positive serum (dilutions from 1:500 to 1:64,000) from the
respective species were applied. The mean OD values of the duplicate measurements
are given in the results. OD values >0.20 were considered as signs of immune
responses to B. burgdorferi isolates. OD values in a group of negative control mice
remained for all antigens used ≤0.10.
2.6. IFA
The majority of mouse sera were first examined with B31 antigen. Later, selected sera
were also tested with one or more of the antigens prepared from Finnish Borrelia
isolates Y8, P1, M2, K3, K4, and H7. The antigen slides (Multitest Slides, Flow, Inc
Biomedicals) were prepared and the test mainly performed as described earlier [2].
The fluorescein isothiocyanate conjugate was rabbit anti-mouse IgG,A,M (Serotec,
Oxford, UK), which was used at a 1:40 dilution. The sera were diluted in two-fold
steps and first screened in dilutions 1:2, 1:8, and 1:32. For sera of interest, further
dilutions were examined against selected antigens to determine the titre. The large
number of three-mice group sera from experiments negative both by ELISA and
isolation and several sera from uninoculated mice had all been clearly negative by
IFA at dilution 1:2. Consequently, that dilution was selected as the level at which to
decide between positivity and negativity in the present studies. A positive reaction
was recorded if >50% of the spirochetes were fluorescent with an intesity of ≥3 out of
a possible score of 6 (very bright). When comparative measurements with three to
four different antigens were made, the tests were run simultaneously.
2.7. Sensitivity
With antigen sensitivity, as used here, is meant the relative ability of antigens, in
comparison with others, to react with anti-borrelia antibodies of a serum tested. In
ELISA testing of this study, the measure of sensitivity is the relative magnitude of the
OD value.
3. Results
In all, 28 Finnish isolates were subjected to experiments. Twenty-one of them were
found to infect mice, infectivity of one (Ri5) was regarded as doubtful, and six
isolates (M1, H1, U1, U4, K5 and Y17) were formally recorded as negative but
remained, most of them, insufficiently studied. No reisolation was made from seven
experiments with isolate Ri5; increased ELISA OD values were recorded in two
experiments (Table 1). Genuine noninfectivity was suggested for the atypical B.
afzelii isolate M1 [2] by four experiments of various categories. Of the five other
‘negative’ isolates, tested each only once, three (U4, K5 and Y17) were contaminated
primary cultures preserved long at 4°C. Among the 21 isolates found infective,
differences in infectivity were observed (see Table 1 and Table 2).
Table 1 is a master table giving subgroup-specifically the results for positive large and
second category experiments, and also for part of third category experiments. In the
following text, these results are analysed and/or commented on selectively only. The
18 positive large experiments were inoculations with 10 different isolates.
Demonstrating the infectivity variation of some isolates in the course of the studies,
eight of the 14 negative large experiments (see footnote in Table 1) were inoculations
with isolates found positive either in some other large experiments or in third category
experiments. The experiments of the second category described in Table 1 were made
with relatively highly passaged organisms. The responses are considered to have been
induced with noninfectious organisms in large enough numbers.
The titration results of inocula for positive and most of the negative large experiments
were either 10−3 or 10−4, with even 10−5 recorded in four cases. In three negative large
experiments (K1,p1; M1,p6; Po1,p14) the titre was, however, only 10−1. The latter
finding very likely explains the negativity of the respective three infection trials.
Experiments of the third category were 28, representing 17 different isolates, of which
14 experiments made with 11 different isolates were positive by isolation of borreliae
(11 of the 14 positive experiments are shown in Table 1 and Table 2; of the rest, one
was made with isolate Y18, 2 with Po1). The four original cultures, which infected
mice ( Table 2), were all heavily contaminated with bacteria or with fungi and had
been stored consecutively at 34 and 4°C for 4–7 months.
The growth of the isolates in culture was in majority of cases relatively slow, and
consequently the present culture times between passages were rather long, on the
average more than one month. In these conditions, definite infectivity was not
recorded for inoculations at higher than five passages. As an example of recorded
pace of in vitro losses of infectivity, the case of M2 inoculations is referred to. The
negative double experiment with this isolate (note, Table 1) was made with a higher
passaged (p7) culture than the 3 positive experiments ( Table 1).
As seen from Table 1, more mice were found infected among i.d. than i.p. inoculated
ones. In comparisons concerning the 30 positive i.d.–i.p. pairs of three-mice groups
(either one or both groups of the pair positive serologically and/or by isolation), and
regarding individual mice and positivity by isolation, the chi-square test for paired
samples gives between i.d. and i.p. inoculations a statistically significant difference,
P<0.05. Comparison by ELISA results of i.d. and i.p. inoculations (included are data
from 24 i.d.–i.p. pairs of three-mice units) gave mean OD values 1.22 and 0.86,
respectively; the difference in Wilcoxon signed rank test was: P<0.02. In comparison
between first and second sacrifice groups, without differentiation by inoculation mode,
the ELISA OD values were in average clearly higher among the second groups.
As shown in Table 2, the ear was the most frequent source of borreliae in experiments
both with B. afzelii and B. garinii isolates (ear as the source for B. burgdorferi s.s.
was only tested in one large experiment). Relatively, the isolation rate from the ear, in
comparison with rates for other organs, was higher among B. afzelii than B. garinii
infections presented in Table 2. The result that B. afzelii regularly, in all mice of the
included experiments, caused detectable ear infection is conspicuous. Isolation rate
for the urinary bladder, relative to rates for other organs, was very high for B.
burgdorferi s.s. experiments, high for B. garinii and very low for B. afzelii
experiments. Rate for isolation from heart was proportionally lowest in B. garinii
experiments.
Even in experiments in which all three mice, and one or more organs of each mouse,
proved positive by isolation, all three culture tubes from the positive organ (either
heart, bladder or spleen) being positive was more exceptional. Such cases were
recorded especially for experiments with M2, K3 and K4 (Table 2; detailed data not
given). No clear difference between tubes with or without antibiotics were observed.
In successful isolations from ear, both two tubes being positive—a result most
frequently recorded for B. afzelii infections—was relatively more frequent than
positivity of two to three tubes in successful isolation attempts from heart, bladder or
spleen.
As seen in Table 3 and Fig. 1, in studies with ELISA of the mouse immune responses,
the highest OD values were as a rule recorded when the antigen from the homologous
genospecies was used. Within genospecies, the immune responses to different isolates
or isolate groups could, however, differ as to the sensitivity spectrum of the
measuring antigens. Among responses to B. garinii strains, the response to the isolate
K3 clearly deviated from those to other isolates. Differences among B. afzelii
responses are conspicuous in regard to the measuring sensitivity of the two B. afzelii
antigens, H7 and K4. The Y12 immune response observed is quite atypical in its
virtual nonreactivity with the K4 antigen—and with B. garinii and B. burgdorferi s.s.
antigens. Responses to H7 are recorded (Table 3) to show, on average, as high OD
values both by H7 and K4 antigens. The average result is, however, decisively
influenced by the fact that in two clearly strongest H7 responses recorded in mice,
higher OD values were, paradoxically, measured with antigen K4 than with the
homologous H7 ( Table 1 and Fig. 1). Reactivity of H7 antibodies is atypical only in
mice inoculated with passage 7;6(m1) inoculum ( Table 1), and among them only in
NMRI, not in BALB/c mice.
Table 3. Summary data of OD measurements with ELISA of mouse immunresponses to various
Borrelia burgdorferi sensu lato isolates, by different isolates as antigens
(13K)
Fig. 1. Antibody responses in mice measured with ELISA using antigens of three genospecies, B.
burgdorferi sensu stricto (B31 and Y8), B. garinii (P1 and M2) and B. afzelii (H7 and K4). Responses
in 6 mice each inoculated with different B. garinii isolates (A), six mice inoculated with B. afzelii
isolates (B), and three mice inoculated with B.burgdorferi s.s. isolates (C) are presented. Symbols for
identities of the infecting isolates: A: P1 (○), M2 (•), U2 ( ), Ri1 (▪), Ri3 ( ), K3 (♦), Ri8 ( ), Ri4
( ), Y16 ( ), Y29 ( ); B: K4 (○), H7 (•), Y12 ( ), Po1 (▪), K1 ( ), and H2 ( ); C: Y8 (○), Y19 (•),
and Ri5 ( ).
No borreliae were isolated from blood samples of rabbits. Fig. 2 shows ELISA results
of immune responses of four rabbits as measured with four different antigens. For the
response to the isolate Y8, the most sensitive antigen was B31, a representative of the
same genospecies as Y8 (in a parallel ELISA test with both B. burgdorferi s.s.
antigens, B31 and Y8, included—data not shown—their sensitivities were equal); for
H7 response, the homologous antigen was slightly more sensitive than antigens from
two other genospecies, whereas antigen K4, also a B. afzelii strain antigen, was the
least sensitive; for M2 response the homologous antigen was clearly the most
sensitive; and for K3 response, all the four antigens showed roughly similar
sensitivities. The pairs to the rabbits depicted in Fig. 2 showed (data not given) similar
patterns of antigen sensitivity in measurement of their immune responses (also the
other M2 rabbit, which had earlier [3] been found IFA negative by B31 antigen),
except for the other one of the rabbits inoculated with isolate H7, the response of
which was measured with equal sensitivity with both antigen H7 and M2. The
responses in rabbits (data not given) inoculated with B. garinii isolate U2 resembled
quite closely those to M2, whereas responses to isolates P1 and Ri3 (for the latter,
only one of the two rabbits had responded) represented in their antigen sensitivities
types in the middle between those to M2 and K3.
(12K)
Fig. 2. Antibody responses in four rabbits inoculated once or twice (arrows) with borrelia isolates: A
with B. burgdorferi sensu stricto isolate Y8; B with B. afzelii isolate H7; C and D with B. garinii
isolates M2 and K3, respectively. Symbols for antigens used: B31 (•), M2 (▪), H7 (♦), and K4 ( ).
4. Discussion
Among the isolates tested, a variation in mouse infectivity was observed. Part of the
variation seemed original, based on differences of freshly isolated borreliae and not
resulting from changes during the growth in the artificial medium. Some isolates were
of relatively high others of lower infectivity, whereas at the other end of the scale the
isolates Ri5 and M1, subjected to repeated experiments, could not in the conditions of
the present studies on any occasion be reisolated from the mice inoculated. Both Ri5
and M1 had earlier been found, within their respective genospecies, atypical in their
protein and antigen structure [2]. In regard to present occurrence of noninfective or
low infectivity isolates, it may be relevant that all the investigated strains were
originally isolated from ticks. In literature, isolates noninfective to laboratory mice
[10, 11 and 12] and rats [13] have been described, as are those of weak infectivity [14
and 15].
Decrease and subsequent loss of infectivity of B. burgdorferi isolates by the
increasing length of in vitro culture has been well documented [16, 17, 18 and 19]. In
the cited studies, the passage level at which infectivity was lost varied widely. A
relatively late loss was that between passages 17 and 21, with a stay of more than 4
months in in vitro conditions, reported by Moody et al. [18]. Even preservation of
infectivity up to the passage level 75 has, however, been reported [19]. In the
conditions of the present studies, decrease of infectivity seemed to start earlier than
usual: infectivity was demonstrated only for isolates at ≤5 passages (a very low grade
infection was serologically suggested to have been caused by Y12 at the passage 7),
high infectivity only at passages ≤4. As stated in the results, the passaging of the
isolates was on the average slow in our studies. The total times in culture became long
if compared with those reported in the literature. This probably is the major factor to
explain the observed loss of infectivity at a relatively low passage level. Another
aspect of the subject of phenotypic and genotypic changes in culture is effect of
storage at 4°C. A rather unexpected result was that a months-long storage of some
isolates at 4°C in heavily contaminated primary cultures did not seem to have affected
notably the infectivity. Thus, any regular and decisive selection for noninfectivity in
the population preserved relatively long in stationary phase at 4°C is not indicated by
these data. There are few reports on the rapidity of loss of infectivity in comparable
conditions. Norton Hughes et al. [20] describe one well documented case of the loss
after 6 months storage of the isolate at 5°C.
Differences have been demonstrated between the three pathogenic Borrelia
genospecies in the organotropism in human infections and diseases caused by them,
e.g. Refs. [21 and 22]. Affection of skin is typical of B. afzelii. In the mouse model,
organotropism of infection has more thoroughly been investigated only for the B.
burgdorferi s.s. genospecies. As organs of predilection for that infection, the urinary
bladder and the heart have been identified [5 and 23]; also the rodent ear has been
found frequently infected [6 and 24]. In our studies, B. afzelii and B. garinii isolates
were subjected to comparative investigations by the isolation method of distribution
of observable infection among selected organs in laboratory mice. Although the
material of mouse infections was not large enough to allow more definitive statistical
conclusions, the results, nevertheless, clearly suggest—as a hypothesis to be further
studied—that for B. afzelii mouse ear (i.e. skin), in comparison with other organs, is a
distinct predilection site. It is further suggested by culture tube and individual mouse
specific rates that B. afzelii infects the ear of the mice with greater relative intensity
than the other two species. Other hypotheses raised by the results include: a low
infection rate of the urinary bladder by B. afzelii and relatively low rate for heart by B.
garinii are features suggestively typical of the mouse infections by the respective
species. A strong tropism by B. afzelii to the skin of rodents, its natural hosts, may
also be suggestively inferred from the results of some other studies [25].
One of the goals of these studies was to compare i.d. and i.p. inoculations in low
doses, to do it in larger scale and with several isolates, also of different genospecies.
As shown by the titration results, sizes of inocula by viable count could vary to certain
extent between experiments, but the relative sizes within each comparative
experiment remained fixed. As expected from the results of the basic works by others
using B. burgdorferi s.s. strain [26 and 27], both infection rate and mean ELISA titers
at defined intervals postinoculation were, at doses used in these experiments,
significantly higher among i.d. than i.p. inoculated mice and mouse groups,
respectively. It appears that in critical cases of lower infectivity the infectious dose
level remained more often unreached by the i.p. inocula of 104 borreliae than the i.d.
inocula of 3.3×103; the observed lower level of ELISA antibodies in i.p. inoculated
mice is thought to be associated with a delayed development due to smaller number of
route specific infectious doses injected.
Immune responses were recorded in mice inoculated with higher doses (≥3×105, with
the titration results ≥106) of higher passaged (≥9 passages) isolates. Borreliae were,
however, not reisolated from the mice. In these cases, responses are regarded to have
been induced by nonmultiplicating, noninfectious borreliae. In literature, the inoculum
size needed to cause detectable immune response in mice by noninfective borreliae
has been estimated to be in the range of 106 to 107 [28 and 27].
In an earlier study with ELISA of experimental immune responses in cattle, we
showed differences in reactivity of the antigens both by genospecies and, sometimes
also, by isolate within a genospecies [3]; we speak in this connection of antigen
sensitivity. As a rule, the homologous antigen was the most sensitive one in those
ELISA measurements. A wide variation in sensitivity of antigens was recorded by the
isolate identity of the immune response investigated. Within B. afzelii, two isolates
K4 and H7 clearly differed from each other as antigens. A discussion of literature on
antigen heterogeneity in ELISA studies is found in the above referred article. The
results of the present studies in mice and rabbits confirm in general our earlier
findings on antigen differences, i.e. ELISA serologic differences when the extent of
cross-reacting between genospecies is investigated. Minor differences apparently
caused by the host factor are recorded, among them those between members of each
pair of rabbits—cf earlier findings on pairs of cattle—but the general pattern of
antigen sensitivity relationships remains the same for isolate specific immune
responses. A special emphasis is laid on how in mouse serum ELISA studies the
antigen from the homologous genospecies was regularly the most sensitive one, and
how, with the one exception of the responses to B. garinii strain K3, the sensitivity
difference with antigens from other genospecies was very clear indeed. Responses to
B. afzelii isolates were divided into two groups, each more reactive with one of the
two B. afzelii type antigens used. Explanation to the two mouse responses to H7
inoculations which were paradoxically measured to higher ELISA titers with K4
antigen than H7 antigen remains in these studies a matter of speculation only. The
mechanism of change involved has to fit the observed fact that immune responses of
both typical and atypical reactivity occurred within one single experiment, but were
separated to subexperiments of different duration.
Acknowledgements
We thank Anja Osola, Sinikka Ahonen and Ulla Viitanen for technical assistance.
References
1. J. Junttila, R. Tanskanen and J. Tuomi, Prevalence of Borrelia burgdorferi in
selected tick populations in Finland. Scand J Infect Dis 26 (1994), pp. 349–355.
Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order
Document
2. J. Tuomi, L.K. Rantamäki, R. Tanskanen and J. Junttila, Characterization of
Finnish Borrelia burgdorferi sensu lato isolates by sodium dodecyl sulfatepolyacrylamide gel electrophoresis and with monoclonal antibodies. J Clin Microbiol
33 (1995), pp. 1989–1996. Abstract-MEDLINE | Abstract-Elsevier BIOBASE |
Abstract-EMBASE | Order Document
3. J. Tuomi, L.K. Rantamäki and R. Tanskanen, Experimental infection of cattle with
several Borrelia burgdorferi sensu lato strains; immunological heterogeneity of
strains as revealed in serological tests. Vet Microbiol 60 (1998), pp. 27–43.
SummaryPlus | Full Text + Links | PDF (223 K)
4. H.G. Stoenner, Biology of Borrelia hermsii in Kelly medium. Appl Microbiol 28
(1974), pp. 540–543. Abstract-EMBASE | Abstract-MEDLINE | Order Document
5. T.G. Schwan, W. Burgdorfer, M.E. Schrumpf and R.H. Karstens, The urinary
bladder, a consistent source of Borrelia burgdorferi in experimentally infected whitefooted mice (Peromyscus leucopus). J Clin Microbiol 26 (1988), pp. 893–895.
Abstract-EMBASE | Abstract-MEDLINE | Order Document
6. R.J. Sinsky and J. Piesman, Ear punch biopsy method for detection and isolation of
Borrelia burgdorferi from rodents. J Clin Microbiol 27 (1989), pp. 1723–1727.
Abstract-MEDLINE | Abstract-EMBASE | Order Document
7. H. Jonsson and P.H. Mueller, The type-III Fc receptor from Streptococcus
dysgalactiae is also an α2-macroglobulin receptor. Eur J Biochem 220 (1994), pp.
821–826.
8. J. Vasi, J. Svensson, I.M. Frick and H.P. Mueller, Five homologous repeats of the
protein G-related protein MIG cooperate in binding to goat immunoglobulin G. Infect
Immun 67 (1999), pp. 413–416. Abstract-MEDLINE | Abstract-EMBASE | Order
Document
9. M.B. Wilson and P.K. Nakane, Recent developments in periodate method of
conjugating horseradish peroxidase (HPRO) to antibodies. In: W. Knpp, K. Holubar
and G. Wick, Editors, Immunofluorescence and related staining techniques, Elsevier,
Amsterdam (1978), pp. 215–224.
10. T.G. Schwan, M.E. Schrumpf, R.H. Karstens, J.R. Clover, J. Wong, M. Daugherty,
M. Struthers and P.A. Rosa, Distribution and molecular analysis of Lyme disease
spirochetes, Borrelia burgdorferi, isolated from ticks throughout California. J Clin
Microbiol 31 (1993), pp. 3096–3108. Abstract-MEDLINE | Abstract-EMBASE |
Abstract-Elsevier BIOBASE | Order Document
11. J.F. Anderson, R.A. Flavell, L.A. Magnarelli, S.W. Barthold, F.S. Kantor, R.
Wallich, D.H. Persing, D. Mathiesen and E. Fikrig, Novel Borrelia burgdorferi
isolates from Ixodes scapularis and Ixodes dentatus ticks feeding on humans. J Clin
Microbiol 34 (1996), pp. 524–529. Abstract-MEDLINE | Abstract-EMBASE |
Abstract-Elsevier BIOBASE | Order Document
12. J. Piesman and C.M. Happ, Ability of the Lyme disease spirochete Borrelia
burgdorferi to infect rodents and three species of human-biting ticks (blacklegged tick,
American dog tick, lone star tick) (Acari: Ixodidae). J Med Entomol 34 (1997), pp.
451–456. Abstract-MEDLINE | Order Document
13. S.W. Barthold, K.D. Moody and D.S. Beck, Susceptibility of laboratory rats to
isolates of Borrelia burgdorferi from different geographic areas. Am J Trop Med Hyg
42 (1990), pp. 596–600. Abstract-EMBASE | Order Document
14. T. Masuzawa, T. Kurita, H. Kawabata, K. Muramatsu, K. Uchikawa and Y.
Yanagihara, Infectivity and early antibody response to Borrelia burgdorferi sensu lato
isolated in Japan in outbred mice. Microbiol Immunol 38 (1994), pp. 621–627.
Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order
Document
15. C.A. Peavey and R.S. Lane, Comparison of infectivities of six tick-derived
isolates of Borrelia burgdorferi for rodents and ticks. J Clin Microbiol 34 (1996), pp.
71–75. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE |
Order Document
16. R.C. Johnson, N. Marek and C. Kodner, Infection of Syrian hamsters with
Lyme disease spirochetes. J Clin Microbiol 20 (1984), pp. 1099–1101. AbstractEMBASE | Abstract-MEDLINE | Order Document
17. T.G. Schwan, W. Burgdorfer and C.F. Garon, Changes in infectivity and plasmid
profile of the Lyme disease spirochete, Borrelia burgdorferi, as a result of in vitro
cultivation. Infect Immun 56 (1988), pp. 1831–1836. Abstract-MEDLINE | AbstractEMBASE | Order Document
18. K.D. Moody, S.W. Barthold and G.A. Terwilliger, Lyme borreliosis in
laboratory animals: effect of host species and in vitro passage of Borrelia burgdorferi.
Am J Trop Med Hyg 43 (1990), pp. 87–92. Abstract-EMBASE | Order Document
19. J. Anguita, S. Samanta, B. Revilla, K. Suk, S. Das, S.W. Barthold and E. Fikrig,
Borrelia burgdorferi gene expression in vivo and spirochete pathogenicity. Infect
Immun 68 (2000), pp. 1222–1230. Abstract-EMBASE | Abstract-Elsevier BIOBASE |
Abstract-MEDLINE | Order Document | Full Text via CrossRef
20. C.A. Norton Hughes, S.M. Engstrom, L.A. Coleman, C.B. Kodner and R.C.
Johnson, Protective immunity is induced by a Borrelia burgdorferi mutant that lacks
OspA and OspB. Infect Immun 61 (1993), pp. 5115–5122.
21. A.P. Van Dam, H. Kuiper, K. Vos, A. Widjojokusumo, B.M. de Jongh, L.
Spanjaard, A.C.P. Ramselaar, M.D. Kramer and J. Dankert, Different genospecies of
Borrelia burgdorferi are associated with distinct clinical manifestations of Lyme
borreliosis. Clin Infect Dis 17 (1993), pp. 708–717. Abstract-MEDLINE | Order
Document
22. J. Saint Girons, L. Gern, J.S. Gray, E.C. Guy, E. Korenberg, P.A. Nuttall, S.G.
Rijpkema, A. Schonberg, G. Stanek and D. Postic, Identification of Borrelia
burgdorferi sensu lato species in Europe. Zentralbl Bacteriol 287 (1998), pp. 190–195.
23. T. Masuzawa, Y. Beppu, H. Kawabata, Y. Yanagihara, Y. Iwamoto, T. Shimizu
and R.C. Johnson, Experimental Borrelia burgdorferi infection of outbred mice. J
Clin Microbiol 30 (1992), pp. 3016–3018. Abstract-EMBASE | AbstractMEDLINE | Order Document
24. S.W. Barthold, D.H. Persing, A.L. Armstrong and R.A. Peeples, Kinetics of
Borrelia burgdorferi dissemination and evolution of disease after intradermal
inoculation of mice. Am J Pathol 139 (1991), pp. 263–273. Abstract-MEDLINE |
Abstract-EMBASE | Order Document
25. P.F. Humair, O. Peter, R. Wallich and L. Gern, Strain variation of Lyme disease
spirochetes isolated from Ixodes ricinus ticks and rodents collected in two endemic
areas in Switzerland. J Med Entomol 32 (1995), pp. 433–438. Abstract-MEDLINE |
Order Document
26. S.W. Barthold, Infectivity of Borrelia burgdorferi relative to route of inoculation
and genotype in laboratory mice. J Infect Dis 163 (1991), pp. 419–420. AbstractMEDLINE | Abstract-EMBASE | Order Document
27. S.W. Barthold, E. Fikrig, L.K. Bockenstedt and D.H. Persing, Circumvention of
outer surface protein A immunity by host-adapted Borrelia burgdorferi. Infect Immun
63 (1995), pp. 2255–2261. Abstract-MEDLINE | Abstract-EMBASE | AbstractElsevier BIOBASE | Order Document
28. W.T. Golde, K.J. Kappel, G. Dequesne, C. Feron, D. Plainchamp, C. Capiau and
Y. Lobet, Tick transmission of Borrelia burgdorferi to inbred strains of mice induces
an antibody response to P39 but not to outer surface protein A. Infect Immun 62
(1994), pp. 2625–2627. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Order Document
Comparative Immunology, Microbiology and Infectious Diseases
Volume 25, Issue 2 , March 2002, Pages 109-
Corresponding author. Tel.: +358-9-239-2951; fax: +358-9-191-49799; email:
raili.tanskanen@helsinki.fi
Functionality of Borrelia burgdorferi LuxS: The Lyme
disease spirochete produces and responds to the
pheromone autoinducer-2 and lacks a complete
activated-methyl cycle
Kate von Lackuma, 1, Kelly Babba, 1, Sean P. Rileya, 1, Rachel L. Wattiera, b, 2,
Tomasz Bykowskia and Brian Stevensona, ,
a
Department of Microbiology, Immunology, and Molecular Genetics, College of
Medicine, University of Kentucky, MS 415 Chandler Medical Center, Lexington,
Kentucky 40536-0298, USA
b
Agricultural Biotechnology Program, College of Agriculture, University of Kentucky,
Lexington, Kentucky, USA
Available online 10 March 2006.
Abstract
Borrelia burgdorferi produces Pfs and LuxS enzymes for breakdown of the toxic
byproducts of methylation reactions, producing 4,5-dihydroxy-2,3-pentanedione
(DPD), adenine, and homocysteine. DPD and its spontaneously rearranged derivatives
constitute a class of bacterial pheromones named autoinducer-2 (AI-2). We describe
that B. burgdorferi produces DPD during laboratory cultivation. Furthermore,
addition of in vitro synthesized DPD to cultured B. burgdorferi resulted in altered
expression levels of a specific set of bacterial proteins, among which is the outer
surface lipoprotein VlsE. While a large number of bacteria utilize homocysteine, the
other LuxS product, for synthesis of methionine as part of the activated-methyl cycle,
B. burgdorferi was found to lack that ability. We propose that the main function of B.
burgdorferi LuxS is to synthesize DPD and that the Lyme disease spirochete utilizes a
form of DPD as a pheromone to control gene expression.
Keywords: Borrelia burgdorferi; Quorum sensing; Pheromone; Bacterial gene
regulation; Homocysteine; Methionine
Article Outline
Introduction
Materials and methods
Bacteria and growth conditions
In vitro synthesis of DPD
Vibrio harveyi bioassay of AI-2
Genomic analyses
Borrelia burgdorferi genomic libraries construction and analyses
Methionine synthase assay
Results
Borrelia burgdorferi synthesizes AI-2 during laboratory cultivation
Borrelia burgdorferi modulates protein expression in response to DPD
Borrelia burgdorferi lacks a complete activated-methyl cycle
Many other pathogenic spirochete species lack activated-methyl cycles
Discussion
Acknowledgements
References
Introduction
As do most other organisms, the Lyme disease spirochete Borrelia burgdorferi lives
in a series of dynamic environments. This bacterium persists in nature through cycles
requiring infection of both vertebrates and ticks. During these infectious cycles, the
spirochete must not only adapt to life in two extremely different types of host, but
must also manage efficient transmission between the two. These constraints require
that for B. burgdorferi to survive, it must precisely control gene expression so that
only appropriate proteins are expressed during each stage of infection (Schwan, 1996;
Indest et al., 2001b; Seshu and Skare, 2001; Anguita et al., 2003). Since disruption of
regulatory networks that control expression of infection-associated proteins is a key
goal for development of novel therapies to prevent and treat Lyme disease,
characterization of those control mechanisms will be of great value.
A growing number of bacteria are known to utilize derivatives of 4,5-dihydroxy-2,3pentanedione (DPD) as a pheromone to control gene expression (Xavier and Bassler,
2003). DPD can spontaneously cyclize and/or interact with borate to form at least two
different, interconvertible molecules collectively described as autoinducer-2 (AI-2,
Fig. 1) (Chen et al., 2002; Miller et al., 2004). Although AI-2 was originally described
as a quorum sensing molecule for measuring bacterial density (Surette et al., 1999), it
appears that many bacteria instead use AI-2 as a pheromone during the exponential
growth phase to signal metabolic status and fitness (Xavier and Bassler, 2003). In a
previous study, our laboratory demonstrated that B. burgdorferi encodes a functional
copy of LuxS, the enzyme that synthesizes DPD (Stevenson and Babb, 2002; Babb et
al., 2005).
(6K)
Fig. 1. Composite diagram of metabolic pathways that constitute activated-methyl cycles.
Abbreviations: SAM, S-adenosylmethionine; SAH, S-adenosylhomocysteine; SRH, Sribosylhomocysteine; DPD, 4,5-dihydroxy-2,3-pentanedione; Me-THF, 5-methyltetrahydrofolate; THF,
tetrahydrofolate. DPD can spontaneously cyclize and/or combine with borate to produce at least two
different, interconvertible forms of AI-2 (Schauder et al., 2001; Chen et al., 2002; Miller et al., 2004).
Most organisms contain either the SAH hydrolase pathway or the Pfs/LuxS pathway for homocysteine
synthesis, although some organisms contain both (Sun et al., 2004). Figure adapted from Babb et al.
(2005).
Many bacteria utilize LuxS as part of the activated-methyl cycle (Fig. 1). This series
of reactions generates a methyl donor molecule, S-adenosylmethionine (SAM) for use
in a wide variety of methylation reactions, then detoxifies byproducts and regenerates
SAM. The second product of LuxS is homocysteine, which many organisms
metabolize to produce methionine. For bacteria with a complete activated-methyl
cycle such as illustrated in Fig. 1, LuxS plays an important role in maintaining a pool
of free methionine in the cell. For example, mutants of Escherichia coli defective in
methionine synthase are unable to grow in minimal media that lack added methionine
(Urbanowski et al., 1987; Matthews, 1996). This function of LuxS has led to
suggestions that the primary role of that enzyme in bacteria is to synthesize
homocysteine for recycling, rather than for synthesis of DPD, and that effects of luxS
mutations on bacterial pathogenicity are due to methionine starvation (Winzer et al.,
2002a, Winzer et al., 2002b and Winzer et al., 2003; Blevins et al., 2004). For this
reason, we examined B. burgdorferi in detail to determine whether that bacterium can
also regenerate methionine from homocysteine, and found that it lacks such an ability,
indicating that the Lyme disease spirochete produces LuxS for a purpose other than
homocysteine synthesis.
Materials and methods
Bacteria and growth conditions
B. burgdorferi were cultured in Barbour–Stoenner–Kelly II broth (Barbour, 1984). B.
burgdorferi strain 297 is an infectious, wild-type bacterium and was originally
isolated from human cerebrospinal fluid in New York, USA (Steere et al., 1983).
Strain AH309 is a luxS-deficient mutant of strain 297 (Hübner et al., 2003) and was
obtained from Michael Norgard (University of Texas Southwestern, Dallas, USA).
For analyses of AI-2 production by B. burgdorferi, cultures of strains 297 and AH309
were grown at 34 °C to densities of approximately 107 bacteria per ml. Those cultures
were then placed at 23 °C, which greatly retards bacterial growth (Stevenson et al.,
1995). Aliquots of each initial culture were diluted 1:1000 into fresh medium on 6
subsequent days, with each secondary culture incubated at 34 °C to allow optimal
growth. On day 7, supernatant was removed from each secondary culture and assayed
for AI-2 content. Through this technique, cultures with essentially the same starting
densities could be grown under the same conditions for 1–7 days and then assayed
simultaneously. Bacterial density of each culture was also determined at that time,
using a Petroff–Hauser counting chamber and dark-field microscopy.
E. coli strain GS162 is wild type for both methionine synthase genes, while GS472 is
defective in both metH and metE. Both were obtained from George Stauffer
(University of Iowa, USA) (Urbanowski et al., 1987). For attempted complementation
of E. coli metE and metH, transformed GS472 was plated on M9 minimal salts agar
supplemented with 1 μg/ml thiamin, with this same medium plus 100 μg/ml
methionine serving as a positive control for growth (Urbanowski et al., 1987;
Sambrook et al., 1989; Zeh et al., 2002). For use as a positive control for methionine
synthase analyses, GS162 was cultured in M9 supplemented with 3.4 μg/ml
hydroxocobalamin, 1 μg/ml thiamin and 100 μg/ml phenylalanine (Urbanowski et al.,
1987; Jarrett et al., 1997).
Vibrio harveyi strain BB170 (Bassler et al., 1997) was obtained from Bonnie Bassler
(Princeton University, USA). V. harveyi were cultivated in modified autoinducer
bioassay medium (Greenberg et al., 1979) containing 40 μM sodium borate (pH=6.8).
Leptospira interrogans serovar pomona type kennewicki strain JEN4 (Nally et al.,
2001) was cultured at 30 °C in Bovuminar PLM-5 medium (Intergen, Purchase, NY).
In vitro synthesis of DPD
DPD was synthesized from S-adenosylhomocysteine nucleosidase (SAH) (Sigma, St.
Louis, MO, USA), using equimolar concentrations of recombinant B. burgdorferi
LuxS and Pfs proteins. Reaction products were quantified using Ellman's reaction, as
previously described (Schauder et al., 2001; Babb et al., 2005).
Vibrio harveyi bioassay of AI-2
V. harveyi strain BB170 autofluoresces in the presence of AI-2 in a dose-dependent
manner, enabling its use in a bioassay specific for AI-2 (Bassler et al., 1997; Taga,
2005). Bioassays were performed as previously described (Surette and Bassler, 1998;
Stevenson and Babb, 2002). AI-2 activities are reported as average luminescence
values of each strain 297 assay minus the average luminescence of equivalent cultures
of strain AH309. Studies were repeated at least three times using independent cultures.
Genomic analyses
Genome databases of B. burgdorferi and three other spirochetal species were queried
for presence of specific gene homologs. Complete genome sequences of B.
burgdorferi strain B31 (Fraser et al., 1997; Casjens et al., 2000), Treponema pallidum
Nichols strain (Fraser et al., 1998), T. denticola ATCC 35405 (Seshadri et al., 2004),
L. interrogans serovar Lai strain 56601 (Ren et al., 2003), and L. interrogans serovar
Copenhageni strain Fiocruz L1-130 (Nascimento et al., 2004a) were accessed through
the Institute for Genomic Research microbial database at http://www.tigr.org. To
search for homologs of enzymes involved in SAH metabolism, each genome was
queried using BLAST-P with the amino acid sequences of the biochemically
characterized V. harveyi and B. burgdorferi LuxS, E. coli Pfs, and Rhodobacter
capsulatus SAH hydrolase proteins, and the hypothetical SAH hydrolase of L.
interrogans (GenBank accession numbers AF120098, AAC66762, U24438, M80630,
and AAN51667, respectively). To search for homologs of methionine synthase
enzymes, the genomes were queried with protein sequences of the MetE homologs of
E. coli, Mycobacterium tuberculosis, the archaeon Methanobacterium
thermoautotrophicum, and the plant Solanum tuberosum; the MetH homologs of E.
coli, L. interrogans, and Synechococcus sp. WH8102; the methylmethioninedependent YagD enzyme of the E. coli CP4-6 prophage; and the human betainedependent methionine synthase (GenBank accession numbers M87625, AAK45422,
X92082, AF082893, P13009, AAN51667, CAE07753, AAC73364, and U50929,
respectively). Each identified spirochetal gene was used to re-query all of the
spirochete genomes, along with the complete GenBank database at
http://www.ncbi.nlm.nih.gov/blast/.
Borrelia burgdorferi genomic libraries construction and analyses
Total genomic DNA of infectious, wild-type B. burgdorferi strain B31 was digested
using either EcoRI or PstI, then ligated with appropriately digested pUC118 (Vieira
and Messing, 1987). Each ligation mixture was used to transform E. coli strain GS472
and bacteria plated on solid M9 medium lacking methionine.
Methionine synthase assay
5-methyltetrahydrofolate-homocysteine S-methyltransferase activity was determined
as described by Jarrett et al. (1997). Produced 14C-labeled methionine was separated
from the reactants by passage through AG 1-X8 columns (Bio-Rad), then measured
using a scintillation counter. Both E. coli strains GS162 and GS472 were analyzed as
controls, and all experiments included a negative control that lacked any bacterial
lysate. Number of decays per minute in the column flow-through of the negative
control reaction was then subtracted from each experimental value.
Results
Borrelia burgdorferi synthesizes AI-2 during laboratory cultivation
Cultured B. burgdorferi appear to utilize SAM in a variety of methylation reactions
(Hughes and Johnson, 1990; Fraser et al., 1997; Charon and Goldstein, 2002). Both
immunoblot analysis and RT-PCR demonstrated that cultured B. burgdorferi also
produce both Pfs and LuxS enzymes (Hübner et al., 2003; Babb et al., 2005).
Although earlier assays failed to detect production of DPD by cultivated B.
burgdorferi (Stevenson and Babb, 2002; Hübner et al., 2003), we have since refined
analysis techniques and found that the spirochete does indeed synthesize DPD, as
described below.
The most sensitive assay available for detection of DPD uses the marine bacterium V.
harveyi as a biosensor (Taga, 2005). V. harveyi recognizes a cyclic, borate derivative
of DPD and responds by autofluorescing at levels proportional to the amount of added
DPD. Generally, unused growth medium of the tested microorganism is utilized as a
negative control, and values obtained for the control then subtracted from
experimental results. However, B. burgdorferi is cultured in a very rich, complex
medium. We observed that addition of unused B. burgdorferi culture medium to V.
harveyi caused the reporter bacteria to grow far more rapidly than did addition of B.
burgdorferi culture supernatant, yielding the artifactual result of greater
bioluminescence levels being attained from unused medium than from spent medium
(Babb et al., 2005). To avoid this artifact, we instead compared bioassay results of
wild-type strain 297 and an isogenic luxS mutant, AH309, using results from the
mutant as background. Equivalent cultures of each strain were simultaneously
examined during early through late exponential phases of growth, as well as after
reaching stationary phase (Fig. 2). Significant levels of DPD were found in the
supernatants of cultured B. burgdorferi 297, reaching a maximum during the midexponential phase and then decreasing as cultures entered stationary phase. The
reduced levels of DPD in stationary phase cultures suggest that B. burgdorferi
actively removes the molecule from the medium, as do several other studied bacteria
(Surette and Bassler, 1999; Taga et al., 2001 and Taga et al., 2003; Hardie et al.,
2003; Xavier and Bassler, 2003).
(20K)
Fig. 2. Production of AI-2 by Borrelia burgdorferi. Strains 297 (wild-type) and AH309 (luxS) were
diluted into fresh medium and grown for 1–7 days at 34 °C. Culture densities are illustrated as a growth
curve (left Y-axis). Vibrio harveyi bioassays were performed for each culture, with luminescence values
obtained for the negative control AH309 being subtracted from corresponding values obtained for
strain 297. Statistically significant (>90% confidence interval by independent sample t-test) mean
luminescence values are illustrated as rectangles (right Y-axis). Error bars represent standard deviations
of 2–5 separate experiments.
Since culture pH may affect bioassay results (DeKeersmaecker and Vanderleyden,
2003), the pH of the B. burgdorferi culture medium was examined at all time points
and found to have dropped only slightly during the studies, from an initial 7.5 to a
final pH of 6.8 after 3 days at stationary phase, so it is unlikely that the pH of the
tested B. burgdorferi culture media influenced these results. However, V. harveyi also
controls bioluminescence in response to cellular levels of cAMP, repressing light
generation in the presence of PTS sugars such as glucose (Chatterjee et al., 2002;
DeKeersmaecker and Vanderleyden, 2003). Unfortunately, all culture media capable
of supporting B. burgdorferi growth include glucose as a primary carbon source, as
well as other, essential PTS carbohydrates such as N-acetylglucosamine (Barbour,
1984; von Lackum and Stevenson, 2005). Furthermore, B. burgdorferi is capable of
high growth rates for 3–4 days in media lacking glucose, due to energy provided by
other medium components (von Lackum and Stevenson, 2005). Media capable of
supporting growth of these fastidious spirochetes but lack trace carbohydrates do not
exist. The unavoidable effects of catabolite repression on V. harveyi reporter strain
bioluminescence lead us to suspect that the DPD synthesis results reported for B.
burgdorferi may be artificially low (Babb et al., 2005).
Borrelia burgdorferi modulates protein expression in response to DPD
Results of the above-described studies indicated that B. burgdorferi can and does
synthesize DPD. Two additional studies indicated that B. burgdorferi utilizes DPD (or
a derivative of that molecule) as an AI-2 pheromone to control protein expression.
First, a luxS-deficient mutant of E. coli was complemented with the B. burgdorferi
luxS gene, and demonstrated to synthesize DPD (Stevenson and Babb, 2002).
Addition of sterile culture supernatant from those complemented bacteria to B.
burgdorferi influenced expression levels of more than 50 B. burgdorferi proteins,
including the factor H-binding Erp outer surface proteins (Stevenson and Babb, 2002).
Culture supernatants from the uncomplemented E. coli luxS mutant had no detectable
effects.
Second, DPD was synthesized in vitro and B. burgdorferi cultures examined for
effects of the added compound (Babb et al., 2005). Again, expression levels of a
specific subset of B. burgdorferi proteins were measurably affected by addition of
reaction products to cultures (Babb et al., 2005). Furthermore, the effect of DPD
addition was dose dependent, as would be expected for a pheromone. Control assays
in which only homocysteine or SAH were added did not yield detectable changes to
expression levels of any B. burgdorferi protein. The effects of adenine, the third
product of the Pfs and LuxS reactions were not examined, since B. burgdorferi is an
auxotroph for that molecule (Wyss and Ermert, 1996) and culture medium contains a
substantial concentration of adenine (Barbour, 1984). These control experiments
demonstrated that the effects of adding reaction products to culture medium were due
to DPD alone. Parallel studies of wild-type strain 297 and its isogenic luxS mutant
AH309 revealed that some proteins were detectable in lysates of uninduced strain 297,
but were not visible in lysates of AH309, suggesting that the amounts of DPD
produced by wild-type B. burgdorferi during laboratory cultivation cause significant
effects on protein levels. Additionally, AH309 responded to addition of DPD in
manners similar to the wild-type strain, indicating that responses to that molecule can
occur independently of LuxS (Babb et al., 2005).
Both proteomic and microarray analyses were utilized to identify B. burgdorferi
proteins and genes that are controlled through DPD (Babb et al., 2005). Most of the
tentatively identified proteins have yet to be characterized. We are in the process of
developing reagents to confirm those preliminary data and further characterize DPDregulated genes and proteins.
Previously characterized proteins whose expression levels have been demonstrated to
be influenced by DPD include the Erp protein family (Stevenson and Babb, 2002).
These outer membrane lipoproteins are expressed during transmission between ticks
and mammals and during persistent mammalian infection, but not during tick
infection (Lam et al., 1994; Akins et al., 1995; Stevenson et al., 1995 and Stevenson
et al., 1998; Suk et al., 1995; Wallich et al., 1995; Das et al., 1997; El-Hage et al.,
2001; Gilmore et al., 2001; Hefty et al., 2001 and Hefty et al., 2002; McDowell et al.,
2001; Miller et al., 2003 and Miller et al., 2005; Miller and Stevenson, 2004). Many
members of the Erp protein family have been demonstrated to bind the host
complement regulator molecule factor H, suggestive of roles in establishment and
maintenance of mammalian infection (Hellwage et al., 2001; Kraiczy et al., 2001a,
Kraiczy et al., 2001b, Kraiczy et al., 2003 and Kraiczy et al., 2004; Alitalo et al.,
2002; Stevenson et al., 2002; McDowell et al., 2003; Metts et al., 2003). Along with
the effects of DPD, erp genes are also controlled by environmental temperature and
uncharacterized chemical signals (Stevenson et al., 1995; Akins et al., 1998; Babb et
al., 2001 and Babb et al., 2004; Hefty et al., 2001; El-Hage and Stevenson, 2002). In
other studies, we identified DNA sequences involved in control of erp gene
transcription (Babb et al., 2004) and are continuing to explore the mechanism by
which DPD affects Erp expression.
We also identified that B. burgdorferi increases expression of the polymorphic surface
protein VlsE in directly proportional response to DPD concentration (Babb et al.,
2005). VlsE is expressed during mammalian infection, where it protects the bacterium
from host antibodies through an antigenic variation mechanism (Zhang et al., 1997;
Zhang and Norris, 1998a and Zhang and Norris, 1998b; Liang et al., 1999).
Regulatory mechanisms controlling vlsE expression are also quite complex, and
include environmental signals such as temperature and pH and interactions with
mammalian cell membranes (Hudson et al., 2001; Indest et al., 2001a; Ohnishi et al.,
2003; K. von Lackum, K. Babb, S.P. Riley, R.L. Wattier, T. Bykowski, B. Stevenson,
unpublished results). As with the erp loci, the vlsE promoter/operator region
specifically binds multiple B. burgdorferi cytoplasmic proteins (T. Bykowski, K.
Babb, and B. Stevenson, unpublished results), one or more of which may be
responsible for the effects of DPD on gene expression.
Borrelia burgdorferi lacks a complete activated-methyl cycle
As noted above, evidence indicates that B. burgdorferi utilizes SAM as a methyl
donor for many cellular reactions. We have demonstrated that the Lyme disease
spirochete expresses functional Pfs and LuxS enzymes, and can therefore detoxify
SAH to yield DPD, adenine, and homocysteine (Babb et al., 2005). Additional studies
demonstrated that B. burgdorferi also encodes a functional MetK for synthesis of
SAM from methionine (S.P. Riley and B. Stevenson, unpublished results). Almost all
examined organisms, from bacteria to plants to animals, possess complete activatedmethyl cycles and regenerate methionine from homocysteine (Fig. 1) (Sun et al.,
2004). For this reason, it has been suggested that the major, and possibly the only,
reason bacteria possess LuxS is to produce homocysteine for re-synthesis of
methionine (Winzer et al., 2002a, Winzer et al., 2002b and Winzer et al., 2003;
Blevins et al., 2004). However, the following studies indicated that B. burgdorferi
lacks the ability to synthesize methionine.
The genome sequence of B. burgdorferi strain B31 was examined for an open reading
frame (ORF) homologous to a previously characterized methionine synthase. The two
major classes of this enzyme use 5-methyltetrahydrofolate or its derivatives as the
methyl donor. The best characterized methionine synthases are the MetH and MetE
proteins of E. coli. Proteins homologous to one or both these enzymes have been
found in nearly every examined prokaryote and eukaryote (Sun et al., 2004). MetH
and MetE enzymes are commonly referred to as cobalamin-dependent and cobalaminindependent methionine synthases, respectively (González et al., 1992). Two other
identified types of methionine synthase use either betaine or methylmethionine as the
methyl donor (Garrow, 1996; Neuhierl et al., 1999; Thanbichler et al., 1999). Both
those enzymes share very similar amino acid sequences with cobalamin-dependent
methionine synthases (Garrow, 1996; Thanbichler et al., 1999). BLAST-P queries
against the predicted proteins of B. burgdorferi indicated that this bacterium lacks a
protein with recognizable homology to any known methionine synthase.
To examine the possibility that B. burgdorferi may encode a completely novel
methionine synthase, we used plasmid libraries of B. burgdorferi DNA in attempts to
complement an E. coli metE metH mutant. While this technique had previously been
used to clone methionine synthase genes from organisms as evolutionarily distant
from E. coli as the potato (Zeh et al., 2002), all attempts have failed to identify such a
gene in B. burgdorferi.
Finally, we biochemically analyzed cellular extracts of B. burgdorferi for methionine
synthase activity. Consistent with data from our genomic and cloning analyses, no
enzymatic activity could be detected in cell-free extracts of this spirochete (data not
shown). Control studies with wild-type E. coli detected enzyme activity, as expected.
Many other pathogenic spirochete species lack activated-methyl cycles
Results of our studies on B. burgdorferi prompted us to examine other species of
spirochetes for possible methionine synthases. Examination of the unpublished
genome sequences of the relapsing fever spirochetes B. hermsii and B. turicatae
indicates that both possess luxS homologs, yet lack homologs of any known
methionine synthase (Tom Schwan, pers. comm.). The causative agent of syphilis, T.
pallidum, contains a homolog of pfs, ORF TP0170. However, T. pallidum lacks genes
for either LuxS or methionine synthase, and so probably does not encode a complete
activated-methyl cycle (Fig. 3). The periodontal disease-associated spirochete T.
denticola likewise contains a pfs homolog (ORF TDE0105) and lacks both luxS and a
methionine synthase gene. Hence, none of these Treponema species is predicted to
synthesize DPD. Related to the lack of methionine synthase genes in these spirochetes,
neither B. burgdorferi nor T. pallidum encode homologs of any cobalamin-dependent
enzyme or any proteins involved in either cobalamin synthesis or transport (Rodionov
et al., 2003). These data indicate that an activated-methyl cycle is completely
unnecessary for any of these pathogenic spirochetes to survive in nature.
(5K)
Fig. 3. Experimentally determined metabolic pathways found in Borrelia burgdorferi. The Lyme
disease spirochete utilizes methionine to produce SAM and detoxifies SAH to DPD, adenine, and
homocysteine via Pfs and LuxS. This bacterium is unable to regenerate methionine from homocysteine.
Among the six spirochete species for which genome sequence data are available, only
L. interrogans encodes a potential homocysteine salvage enzyme, an ortholog of
MetH (Fig. 4). Consistent with that observation, analysis of L. interrogans lysates
detected levels of methionine synthase activity that were comparable to wild-type E.
coli controls (data not shown). L. interrogans contains a gene homologous to SAH
hydrolases (ORF LB106), but lacks homologs of either pfs or luxS. Infectious
leptospires also encode homologs of many other biosynthetic enzymes, as well as
proteins involved with cobalamin metabolism (Picardeau et al., 2003; Ren et al.,
2003; Rodionov et al., 2003; Nascimento et al., 2004a and Nascimento et al., 2004b;
Sekowska et al., 2004). We conclude that L. interrogans, alone among the examined
spirochete species, encodes a complete activated-methyl cycle, and can regenerate
methionine from homocysteine (Fig. 5). It is also apparent that the leptospirosis
spirochete cannot synthesize DPD.
(4K)
Fig. 4. Metabolic pathways of the syphilis spirochete Treponema pallidum and the peridontitisassociated spirochete T. denticola, as determined by genomic analyses. These spirochetes produce
SAM from methionine for methylation reactions, then detoxify SAH to SRH and adenine via Pfs.
Neither bacterium is predicted to regenerate methionine or to produce DPD.
(6K)
Fig. 5. Metabolic pathways of the leptospirosis agent, Leptospira interrogans, as determined by
genomic analyses. This spirochete species is predicted to encode a complete activated-methyl cycle,
with a single-step detoxification of SAH to homocysteine and adenosine. L. interrogans lacks a
homolog of LuxS and is not predicted to synthesize DPD.
Discussion
Our studies demonstrated that B. burgdorferi detoxifies SAH by converting that
molecule into DPD, adenine, and homocysteine. The Pfs- and LuxS-catalyzed
reactions occur during laboratory cultivation, with DPD accumulating during the
exponential phase of growth. However, biochemical and genomic analyses indicated
that B. burgdorferi lacks a complete activated-methyl cycle, and is unable to
regenerate methionine from homocysteine. These data lead us to conclude that the
Lyme disease spirochete synthesizes LuxS for a purpose other than production of
homocysteine for regeneration of methionine.
We propose that B. burgdorferi produces a LuxS enzyme for the express purpose of
synthesizing DPD. Several species of bacteria utilize DPD or a derivative as an AI-2
pheromone to control gene expression, and our studies indicate that B. burgdorferi is
to be included among that list. The finding that relapsing fever Borrelia species also
contain luxS raises the possibility that those infectious spirochetes may likewise use
DPD as a signal. The mechanism by which B. burgdorferi senses DPD as a signal
molecule is not yet known, as the sequenced genome does not encode recognizable
homologs of proteins known to function in DPD sensing by other bacteria (Stevenson
et al., 2003). However, we note that the two Gram-negative bacterial species for
which the AI-2 sensors have been defined use extremely different mechanisms, so it is
quite possible that the distantly related spirochetes use a completely novel
sensor/regulatory mechanism (Bassler et al., 1994; Taga et al., 2001; Stevenson et al.,
2003). We are continuing studies to characterize the mechanisms by which AI-2dependent regulation occurs in B. burgdorferi, as well as examining other spirochetes
for use of this pheromone.
Two recent publications reported that a luxS mutant of B. burgdorferi was capable of
infecting both mice and ticks, leading those authors to suggest that neither LuxS nor
AI-2 are necessary for infection processes (Hübner et al., 2003; Blevins et al., 2004).
However, there are significant questions about how to interpret results of those
experiments due to the process by which the mutant bacteria were derived: Bacteria
were transformed by electroporation, briefly cultured in liquid medium with a
selective antibiotic, placed in a dialysis bag that was then implanted in the peritoneum
of a rat for 15 days, then removed from the dialysis bag, injected into a mouse, and,
after 2 weeks of infection, a skin biopsy was cultured in liquid medium and, finally,
plated in solid medium (Hübner et al., 2003). Bacteria from two resulting colonies
were then tested for ability to infect mice. Since this complicated selection scheme
mandated that bacteria maintain infectivity, it is impossible to know whether bacteria
that survived the process contain only the introduced luxS lesion or if spontaneous
mutations arose at additional loci to compensate for the loss of luxS. Moreover, none
of those earlier studies compared relative levels of infectivity of mutant and wild-type
bacteria. For these reasons, it is not yet known how critical AI-2-mediated genetic
regulation is for B. burgdorferi pathogenesis.
That B. burgdorferi does not regenerate methionine from homocysteine is consistent
with other indications that it is an auxotroph for all amino acids. Culture media
capable of supporting B. burgdorferi growth must contain all amino acids and many
other nutrients (Barbour, 1984; Pollack et al., 1993). Growth of relapsing fever
borreliae and oral treponemes also requires very complex culture media (Kelly, 1971;
Wyss, 1992). The genome sequences of borreliae and treponemes indicate homologs
of proteases and transporters of polypeptides and amino acids, but few or no
biosynthetic enzymes (Fraser et al., 1997 and Fraser et al., 1998; Seshadri et al., 2004).
This probably explains why all identified species of Borrelia or Treponema are found
only in close association with host animals. In contrast, the sole spirochete known to
possess a complete activated-methyl cycle, L. interrogans, is a water-borne pathogen
capable of survival outside animal hosts. Additionally, L. interrogans encodes a great
many amino acid biosynthetic enzymes (Picardeau et al., 2003; Ren et al., 2003;
Nascimento et al., 2004a and Nascimento et al., 2004b). These observations indicate
that while the free-living leptospires probably require a complete activated-methyl
cycle in order to survive in methionine-deficient environments, the obligatory
parasitic borreliae and treponemes do not need that pathway since they can scavenge
sufficient quantities of methionine from their hosts for all metabolic processes.
B. burgdorferi produces maximum levels of DPD during the exponential phase of
growth, as is also found with many other bacteria (Xavier and Bassler, 2003). DPD
synthesis increases during rapid bacterial growth, presumably due to increased
number of methylation reactions, and is thereby thought to serve as a signal of
bacterial fitness (Xavier and Bassler, 2003). DPD/AI-2 may thus function to
coordinate growth-related processes throughout a population or serve as a form of
positive feedback to the cell that produced it, or a combination of those two
possibilities. Since DPD synthesis is often unrelated to culture density, it is probably
more accurate to think of AI-2 as a pheromone than as a ‘quorum sensing’ molecule.
In conclusion, B. burgdorferi can and does synthesize DPD. Furthermore, B.
burgdorferi uses either DPD or a derivative thereof as an AI-2 pheromone to control
expression levels of a specific subset of bacterial proteins. Those observations, along
with the lack of a complete activated-methyl cycle, lead us to hypothesize that the
Lyme disease spirochete produces LuxS for the express purpose of synthesizing DPD
pheromone. Since maximal synthesis of DPD during cultivation was observed during
the exponential phase of growth, it is likely that the pheromone also functions during
periods of rapid growth in the natural infectious cycle. B. burgdorferi within the
midguts of infected, feeding ticks experience dramatic increases in growth rate
(Benach et al., 1987; de Silva and Fikrig, 1995; Piesman et al., 2001 and Piesman et
al., 2003). Bacteria within feeding ticks also increase synthesis of LuxS (Narasimhan
et al., 2002), consistent with our hypothesis and suggesting a role for AI-2 in
coordinating bacterial gene expression during transmission (Stevenson and Babb,
2002; Miller et al., 2003; Stevenson et al., 2003; Miller and Stevenson, 2004). It is
possible that B. burgdorferi may also use DPD/AI-2 to regulate gene expression
during other stages of its infectious cycle, perhaps through self-induction (Redfield,
2002; Koerber et al., 2004).
Acknowledgements
This work was supported by National Institutes of Health Grants R01-AI53101 and
5T32-AI49795. We thank Bonnie Bassler, Michael Norgard, George Stauffer, and
Xiaofeng Yang for providing bacterial strains; Tom Schwan for sharing unpublished
results; Bonnie Bassler, Kenneth Cornell, Klaus Winzer, and Wolfram Zückert for
helpful discussions; Sarah Wackerbarth for statistical analyses; and Sara Bair, Sarah
Kearns, Natalie Mickelsen, Jennifer Miller, Ashutosh Verma, and Michael Woodman
for assistance in this research.
References
Akins et al., 1995 D.R. Akins, S.F. Porcella, T.G. Popova, D. Shevchenko, S.I. Baker,
M. Li, M.V. Norgard and J.D. Radolf, Evidence for in vivo but not in vitro expression
of a Borrelia burgdorferi outer surface protein F (OspF) homologue, Mol. Microbiol.
18 (1995), pp. 507–520. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Order Document
Akins et al., 1998 D.R. Akins, K.W. Bourell, M.J. Caimano, M.V. Norgard and J.D.
Radolf, A new animal model for studying Lyme disease spirochetes in a mammalian
host-adapted state, J. Clin. Invest. 101 (1998), pp. 2240–2250. Abstract-EMBASE |
Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order Document
Alitalo et al., 2002 A. Alitalo, T. Meri, H. Lankinen, I. Seppälä, P. Lahdenne, P.S.
Hefty, D. Akins and S. Meri, Complement inhibitor factor H binding to Lyme disease
spirochetes is mediated by inducible expression of multiple plasmid-encoded outer
surface protein E paralogs, J. Immunol. 169 (2002), pp. 3847–3853. Abstract-Elsevier
BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | Order Document
Anguita et al., 2003 J. Anguita, M.N. Hedrick and E. Fikrig, Adaptation of Borrelia
burgdorferi in the tick and the mammalian host, FEMS Microbiol. Rev. 27 (2003), pp.
493–504. Abstract | Order Document
Babb et al., 2001 K. Babb, N. El-Hage, J.C. Miller, J.A. Carroll and B. Stevenson,
Distinct regulatory pathways control the synthesis of Borrelia burgdorferi infectionassociated OspC and Erp surface proteins, Infect. Immun. 69 (2001), pp. 4146–4153.
Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
Babb et al., 2004 K. Babb, J.D. McAlister, J.C. Miller and B. Stevenson, Molecular
characterization of Borrelia burgdorferi erp promoter/operator elements, J. Bacteriol.
186 (2004), pp. 2745–2756. Abstract-MEDLINE | Abstract-Elsevier BIOBASE |
Abstract-EMBASE | Order Document | Full Text via CrossRef
Babb et al., 2005 K. Babb, K. von Lackum, R.L. Wattier, S.P. Riley and B. Stevenson,
Synthesis of autoinducer-2 by the Lyme disease spirochete, Borrelia burgdorferi, J.
Bacteriol. 187 (2005), pp. 3079–3087. Abstract-Elsevier BIOBASE | AbstractEMBASE | Abstract-MEDLINE | Order Document | Full Text via CrossRef
Barbour, 1984 A.G. Barbour, Isolation and cultivation of Lyme disease spirochetes,
Yale J. Biol. Med. 57 (1984), pp. 521–525. Abstract-EMBASE | AbstractMEDLINE | Order Document
Bassler et al., 1994 B.L. Bassler, M. Wright and M.R. Silverman, Multiple signalling
systems controlling expression of luminescence in Vibrio harveyi: sequence and
function of genes encoding a second sensory pathway, Mol. Microbiol. 13 (1994), pp.
273–286. Abstract-EMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE |
Order Document
Bassler et al., 1997 B.L. Bassler, E.P. Greenberg and A.M. Stevens, Cross-species
induction of luminescence in the quorum-sensing bacterium Vibrio harveyi, J.
Bacteriol. 179 (1997), pp. 4043–4045. Abstract-MEDLINE | Abstract-EMBASE |
Order Document
Benach et al., 1987 J.L. Benach, J.L. Coleman, R.A. Skinner and E.M. Bosler, Adult
Ixodes dammini on rabbits: a hypothesis for the development and transmission of
Borrelia burgdorferi, J. Infect. Dis. 155 (1987), pp. 1300–1306. Abstract-EMBASE |
Abstract-MEDLINE | Order Document
Blevins et al., 2004 J.S. Blevins, A.T. Revel, M.J. Caimano, X.F. Yang, J.A.
Richardson, K.E. Hagman and M.V. Norgard, The luxS gene is not required for
Borrelia burgdorferi tick colonization, transmission to a mammalian host, or
induction of disease, Infect. Immun. 72 (2004), pp. 4862–4867.
Casjens et al., 2000 S. Casjens, N. Palmer, R. van Vugt, W.M. Huang, B. Stevenson,
P. Rosa, R. Lathigra, G. Sutton, J. Peterson, R.J. Dodson, D. Haft, E. Hickey, M.
Gwinn, O. White and C. Fraser, A bacterial genome in flux: the twelve linear and nine
circular extrachromosomal DNAs of an infectious isolate of the Lyme disease
spirochete Borrelia burgdorferi, Mol. Microbiol. 35 (2000), pp. 490–516. AbstractEMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document |
Full Text via CrossRef
Charon and Goldstein, 2002 N.W. Charon and S.F. Goldstein, Genetics of motility
and chemotaxis of a fascinating group of bacteria: the spirochetes, Annu. Rev. Genet.
36 (2002), pp. 47–73. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Order Document | Full Text via CrossRef
Chatterjee et al., 2002 J. Chatterjee, C.M. Miyamoto, A. Zouzoulas, B.F. Lang, N.
Skouris and E.A. Meighan, MetR and CRP bind to the Vibrio harveyi lux promoters
and regulate luminescence, Mol. Microbiol. 46 (2002), pp. 101–111. AbstractEMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document |
Full Text via CrossRef
Chen et al., 2002 X. Chen, S. Schauder, N. Potier, A. Van Dorsselaer, I. Pelczer, B.L.
Bassler and F.M. Hughson, Structural identification of a bacterial quorum-sensing
signal containing boron, Nature 415 (2002), pp. 545–549. Abstract-GEOBASE |
Abstract-Elsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | AbstractCompendex | Abstract-INSPEC | Order Document | Full Text via CrossRef
Das et al., 1997 S. Das, S.W. Barthold, S. Stocker Giles, R.R. Montgomery, S.R.
Telford and E. Fikrig, Temporal pattern of Borrelia burgdorferi p21 expression in
ticks and the mammalian host, J. Clin. Invest. 99 (1997), pp. 987–995. AbstractMEDLINE | Abstract-EMBASE | Order Document
DeKeersmaecker and Vanderleyden, 2003 S.C.J. DeKeersmaecker and J.
Vanderleyden, Constraints on detection of autoinducer-2 (AI-2) signalling molecules
using Vibrio harveyi as a reporter, Microbiology 149 (2003), pp. 1953–1956.
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
de Silva and Fikrig, 1995 A.M. de Silva and E. Fikrig, Growth and migration of
Borrelia burgdorferi in Ixodes ticks during blood feeding, Am. J. Trop. Med. Hyg. 53
(1995), pp. 397–404. Abstract-MEDLINE | Order Document
El-Hage and Stevenson, 2002 N. El-Hage and B. Stevenson, Simultaneous
coexpression of Borrelia burgdorferi Erp proteins occurs through a specific, erp
locus-directed regulatory mechanism, J. Bacteriol. 184 (2002), pp. 4536–4543.
Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
El-Hage et al., 2001 N. El-Hage, K. Babb, J.A. Carroll, N. Lindstrom, E.R. Fischer,
J.C. Miller, R.D. Gilmore Jr., M.L. Mbow and B. Stevenson, Surface exposure and
protease insensitivity of Borrelia burgdorferi Erp (OspEF-related) lipoproteins,
Microbiology 147 (2001), pp. 821–830. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document
Fraser et al., 1997 C.M. Fraser, S. Casjens, W.M. Huang, G.G. Sutton, R. Clayton, R.
Lathigra, O. White, K.A. Ketchum, R. Dodson, E.K. Hickey, M. Gwinn, B.
Dougherty, J.-F. Tomb, R.D. Fleischmann, D. Richardson, J. Peterson, A.R.
Kerlavage, J. Quackenbush, S. Salzberg, M. Hanson, R. van Vugt, N. Palmer, M.D.
Adams, J. Gocayne, J. Weidmann, T. Utterback, L. Watthey, L. McDonald, P. Artiach,
C. Bowman, S. Garland, C. Fujii, M.D. Cotton, K. Horst, K. Roberts, B. Hatch, H.O.
Smith and J.C. Venter, Genomic sequence of a Lyme disease spirochaete, Borrelia
burgdorferi, Nature 390 (1997), pp. 580–586. Abstract-EMBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Fraser et al., 1998 C.M. Fraser, S.J. Norris, G.M. Weinstock, O. White, G.G. Sutton,
R. Dodson, M. Gwinn, E.K. Hickey, R. Clayton, K.A. Ketchum, E. Sodergren, J.M.
Hardham, M.P. McLeod, S. Salzberg, J. Peterson, H. Khalak, D. Richardson, J.K.
Howell, M. Chidambaram, T. Utterback, L. McDonald, P. Artiach, C. Bowman, M.D.
Cotton, C. Fujii, S. Garland, B. Hatch, K. Horst, K. Roberts, L. Watthey, J. Weidman,
H.O. Smith and J.C. Venter, Complete genome sequence of Treponema pallidum, the
syphilis spirochete, Science 281 (1998), pp. 375–388. Abstract-Elsevier BIOBASE |
Abstract-MEDLINE | Abstract-EMBASE | Order Document | Full Text via
CrossRef
Garrow, 1996 T.A. Garrow, Purification, kinetic properties, and cDNA cloning of
mammalian betaine-homocysteine methyltransferase, J. Biol. Chem. 271 (1996), pp.
22831–22838. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document
Gilmore et al., 2001 R.D. Gilmore Jr., M.L. Mbow and B. Stevenson, Analysis of
Borrelia burgdorferi gene expression during life cycle phases of the tick vector Ixodes
scapularis, Microbes Infect. 3 (2001), pp. 799–808. Abstract-MEDLINE | AbstractEMBASE | Abstract-Elsevier BIOBASE | Order Document
González et al., 1992 J.C. González, R.V. Banerjee, S. Huang, J.S. Sumner and R.G.
Matthews, Comparison of cobalamin-independent and cobalamin-dependent
methionine synthases from Escherichia coli: two solutions to the same chemical
problem, Biochemistry 31 (1992), pp. 6045–6056. Abstract-MEDLINE | AbstractEMBASE | Order Document | Full Text via CrossRef
Greenberg et al., 1979 E.P. Greenberg, J.W. Hastings and S. Ulitzur, Induction of
luciferase synthesis in Beneckea harveyi by other marine bacteria, Arch. Microbiol.
120 (1979), pp. 87–91. Abstract-EMBASE | Order Document | Full Text via
CrossRef
Hardie et al., 2003 K.R. Hardie, C. Cooksley, A.D. Green and K. Winzer,
Autoinducer 2 activity in Escherichia coli culture supernatants can be actively
reduced despite maintenance of an active synthase, LuxS, Microbiology 149 (2003),
pp. 715–728. Abstract-EMBASE | Abstract-Elsevier BIOBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Hefty et al., 2001 P.S. Hefty, S.E. Jolliff, M.J. Caimano, S.K. Wikel, J.D. Radolf and
D.R. Akins, Regulation of OspE-related, OspF-related, and Elp lipoproteins of
Borrelia burgdorferi strain 297 by mammalian host-specific signals, Infect. Immun.
69 (2001), pp. 3618–3627. Abstract-MEDLINE | Abstract-EMBASE | AbstractElsevier BIOBASE | Order Document | Full Text via CrossRef
Hefty et al., 2002 P.S. Hefty, C.S. Brooks, A.M. Jett, G.L. White, S.K. Wikel, R.C.
Kennedy and D.R. Akins, OspE-related, OspF-related, and Elp lipoproteins are
immunogenic in baboons experimentally infected with Borrelia burgdorferi and in
human Lyme disease patients, J. Clin. Microbiol. 40 (2002), pp. 4256–4265. AbstractElsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | Order Document |
Full Text via CrossRef
Hellwage et al., 2001 J. Hellwage, T. Meri, T. Heikkilä, A. Alitalo, J. Panelius, P.
Lahdenne, I.J.T. Seppälä and S. Meri, The complement regulatory factor H binds to
the surface protein OspE of Borrelia burgdorferi, J. Biol. Chem. 276 (2001), pp.
8427–8435. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | AbstractCompendex | Order Document | Full Text via CrossRef
Hübner et al., 2003 A. Hübner, A.T. Revel, D.M. Nolen, K.E. Hagman and M.V.
Norgard, Expression of a luxS gene is not required for Borrelia burgdorferi infection
of mice via needle inoculation, Infect. Immun. 71 (2003), pp. 2892–2896. AbstractMEDLINE | Order Document | Full Text via CrossRef
Hudson et al., 2001 C.R. Hudson, J.G. Frye, F.D. Quinn and F.C. Gherardini,
Increased expression of Borrelia burgdorferi vlsE in response to human endothelial
cell membranes, Mol. Microbiol. 41 (2001), pp. 229–239. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Hughes and Johnson, 1990 C.A.N. Hughes and R.C. Johnson, Methylated DNA in
Borrelia species, J. Bacteriol. 172 (1990), pp. 6602–6604. Abstract-MEDLINE |
Order Document
Indest et al., 2001a K.J. Indest, J.K. Howell, M.B. Jacobs, D. Scholl-Meeker, S.J.
Norris and M.T. Philipp, Analysis of Borrelia burgdorferi vlsE gene expression and
recombination in the tick vector, Infect. Immun. 69 (2001), pp. 7083–7090. AbstractElsevier BIOBASE | Abstract-MEDLINE | Abstract-EMBASE | Order Document |
Full Text via CrossRef
Indest et al., 2001b K.J. Indest, R. Ramamoorthy and M.T. Philipp, Transcriptional
regulation in spirochetes of medical importance. In: M.H. Saier and J. García-Lara,
Editors, The Spirochetes: Molecular and Cellular Biology, Horizon Press, Oxford,
UK (2001), pp. 159–170.
Jarrett et al., 1997 J.T. Jarrett, C.W. Goulding, K. Fluhr, S. Huang and R.G. Matthews,
Purification and assay of cobalamin-dependent methionine synthase from Escherichia
coli, Methods Enzymol. 281 (1997), pp. 196–213. Abstract-EMBASE | AbstractMEDLINE | Order Document
Kelly, 1971 R. Kelly, Cultivation of Borrelia hermsi, Science 173 (1971), pp. 443–
444. Abstract-MEDLINE | Order Document
Koerber et al., 2004 A.J. Koerber, J.R. King and P. Williams, Deterministic and
stochastic modelling of endosome escape by Staphylococcus aureus: “quorum”
sensing by a single bacterium, J. Math. Biol. 50 (2004), pp. 440–488.
Kraiczy et al., 2001a P. Kraiczy, C. Skerka, V. Brade and P.F. Zipfel, Further
characterization of complement regulator-acquiring surface proteins of Borrelia
burgdorferi, Infect. Immun. 69 (2001), pp. 7800–7809. Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Abstract-EMBASE | Order Document | Full Text via
CrossRef
Kraiczy et al., 2001b P. Kraiczy, C. Skerka, M. Kirschfink, V. Brade and P.F. Zipfel,
Immune evasion of Borrelia burgdorferi by acquisition of human complement
regulators FHL-1/reconectin and factor H, Eur. J. Immunol. 31 (2001), pp. 1674–1684.
Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
Kraiczy et al., 2003 P. Kraiczy, J. Hellwage, C. Skerka, M. Kirschfink, V. Brade, P.F.
Zipfel and R. Wallich, Immune evasion of Borrelia burgdorferi: mapping of a
complement inhibitor factor H-binding site of BbCRASP-3, a novel member of the
Erp protein family, Eur. J. Immunol. 33 (2003), pp. 697–707. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Kraiczy et al., 2004 P. Kraiczy, K. Hartmann, J. Hellwage, C. Skerka, V. Brade, P.F.
Zipfel, R. Wallich and B. Stevenson, Immunological characterization of the
complement regulator factor H-binding CRASP and Erp proteins of Borrelia
burgdorferi, Int. J. Med. Microbiol. 293 (2004) (Suppl. 37), pp. 152–157. Abstract |
PDF (802 K)
Lam et al., 1994 T.T. Lam, T.-P.K. Nguyen, R.R. Montgomery, F.S. Kantor, E. Fikrig
and R.A. Flavell, Outer surface proteins E and F of Borrelia burgdorferi, the agent of
Lyme disease, Infect. Immun. 62 (1994), pp. 290–298. Abstract-EMBASE | AbstractMEDLINE | Abstract-Elsevier BIOBASE | Order Document
Liang et al., 1999 F.T. Liang, A.L. Alvarez, Y. Gu, J.M. Nowling, R. Ramamoorthy
and M.T. Philipp, An immunodominant conserved region within the variable domain
of VlsE, the variable surface antigen of Borrelia burgdorferi, J. Immunol. 163 (1999),
pp. 5566–5573. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document
Matthews, 1996 R.G. Matthews, One-carbon metabolism. In: F.C. Neidhart, Editor,
Escherichia coli and Salmonella, ASM Press, Washington, DC, USA (1996), pp.
600–611.
McDowell et al., 2001 J.V. McDowell, S.Y. Sung, G. Price and R.T. Marconi,
Demonstration of the genetic stability and temporal expression of select members of
the Lyme disease spirochete OspF protein family during infection in mice, Infect.
Immun. 69 (2001), pp. 4831–4838. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document | Full Text via CrossRef
McDowell et al., 2003 J.V. McDowell, J. Wolfgang, E. Tran, M.S. Metts, D.
Hamilton and R.T. Marconi, Comprehensive analysis of the factor H binding
capabilities of Borrelia species associated with Lyme disease: delineation of two
distinct classes of factor H binding proteins, Infect. Immun. 71 (2003), pp. 3597–3602.
Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order
Document | Full Text via CrossRef
Metts et al., 2003 M.S. Metts, J.V. McDowell, M. Theisen, P.R. Hansen and R.T.
Marconi, Analysis of the OspE determinants involved in binding of factor H and
OspE-targeting antibodies elicited during Borrelia burgdorferi infection, Infect.
Immun. 71 (2003), pp. 3587–3596. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document | Full Text via CrossRef
Miller and Stevenson, 2004 J.C. Miller and B. Stevenson, Increased expression of
Borrelia burgdorferi factor H-binding surface proteins during transmission from ticks
to mice, Int. J. Med. Microbiol. 293 (2004) (Suppl. 37), pp. 120–125. Abstract | PDF
(732 K)
Miller et al., 2003 J.C. Miller, K. von Lackum, K. Babb, J.D. McAlister and B.
Stevenson, Temporal analysis of Borrelia burgdorferi Erp protein expression
throughout the mammal-tick infectious cycle, Infect. Immun. 71 (2003), pp. 6943–
6952. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full
Text via CrossRef
Miller et al., 2005 J.C. Miller, K. Narayan, B. Stevenson and A.R. Pachner,
Expression of Borrelia burgdorferi erp genes during infection of non-human primates,
Microb. Pathog. 39 (2005), pp. 27–33. SummaryPlus | Full Text + Links | PDF (137
K)
Miller et al., 2004 S.T. Miller, K.B. Xavier, S.R. Campagna, M.E. Taga, M.F.
Semmelhack, B.L. Bassler and F.M. Hughson, Salmonella typhimurium recognizes a
chemically distinct form of the bacterial quorum-sensing signal AI-2, Mol. Cell. 15
(2004), pp. 677–687. SummaryPlus | Full Text + Links | PDF (911 K)
Nally et al., 2001 J.E. Nally, J.F. Timoney and B. Stevenson, Temperature-regulated
protein synthesis by Leptospira interrogans, Infect. Immun. 69 (2001), pp. 400–404.
Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Abstract-EMBASE | Order
Document | Full Text via CrossRef
Narasimhan et al., 2002 S. Narasimhan, F. Santiago, R.A. Koski, B. Brei, J.F.
Anderson, D. Fish and E. Fikrig, Examination of the Borrelia burgdorferi
transcriptome in Ixodes scapularis during feeding, J. Bacteriol. 184 (2002), pp. 3122–
3125. Abstract-Elsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE |
Order Document | Full Text via CrossRef
Nascimento et al., 2004a A.L.T.O. Nascimento, A.I. Ko, E.A. Martins, C.B.
Monteiro-Vitorello, P.L. Ho, D.A. Haake, S. Verjovski-Almeida, R.A. Hartskeerl,
M.V. Marques, M.C. Oliveira, C.F. Menck, L.C. Leite, H. Carrer, L.L. Coutinho,
W.M. Degrave, O.A. Dellagostin, H. El-Dorry, E.S. Ferro, M.I. Ferro, L.R. Furlan, M.
Gamberini, E.A. Giglioti, A. Goes-Neto, G.H. Goldman, M.H. Goldman, R. Harakava,
S.M. Jeronimo, I.L.M. Junqueira-de-Azevedo, E.T. Kimura, E.E. Kuramae, E.G.
Lemos, M.V. Lemos, C.L. Marino, L.R. Nunes, R.C. de Oliveira, G.G. Pereira, M.S.
Reis, A. Schriefer, W.J. Siqueira, P. Sommer, S.M. Tsai, A.J. Simpson, J.A. Ferro,
L.E. Camargo, J.P. Kitajima, J.C. Setubal and M.A. Van Sluys, Comparative
genomics of two Leptospira interrogans serovars reveals novel insights into
physiology and pathogenesis, J. Bacteriol. 186 (2004), pp. 2164–2172. AbstractMEDLINE | Abstract-Elsevier BIOBASE | Abstract-EMBASE | Order Document |
Full Text via CrossRef
Nascimento et al., 2004b A.L.T.O. Nascimento, S. Verjovski-Almeida, M.A. Van
Sluys, C.B. Monteiro-Vitorello, L.E.A. Camargo, L.A. Digiampietri, R.A. Hartskeerl,
P.L. Ho, M.V. Marques, M.C. Oliveira, J.C. Setubal, D.A. Haake and E.A.L. Martins,
Genome features of Leptospira interrogans serovar Copenhageni, Braz. J. Med. Biol.
Res. 37 (2004), pp. 459–478. Abstract-EMBASE | Order Document
Neuhierl et al., 1999 B. Neuhierl, M. Thanbichler, F. Lottspeich and A. Böck, A
family of S-methylmethionine-dependent thiol/selenol methyltransferases, J. Biol.
Chem. 274 (1999), pp. 5407–5414. Abstract-EMBASE | Abstract-MEDLINE | Order
Document | Full Text via CrossRef
Ohnishi et al., 2003 J. Ohnishi, B. Schneider, W.B. Messer, J. Piesman and A.M. de
Silva, Genetic variation at the vlsE locus of Borrelia burgdorferi within ticks and
mice over the course of a single transmission cycle, J. Bacteriol. 185 (2003), pp.
4432–4441. Abstract-MEDLINE | Abstract-EMBASE | Abstract-Elsevier
BIOBASE | Order Document | Full Text via CrossRef
Picardeau et al., 2003 M. Picardeau, H. Bauby and I. Saint Girons, Genetic evidence
for the existence of two pathways for biosynthesis of methionine in the Leptospira
spp, FEMS Microbiol. Lett. 225 (2003), pp. 257–262. SummaryPlus | Full Text +
Links | PDF (321 K)
Piesman et al., 2001 J. Piesman, B.S. Schneider and N.S. Zeidner, Use of quantitative
PCR to measure density of Borrelia burgdorferi in the midgut and salivary glands of
feeding tick vectors, J. Clin. Microbiol. 39 (2001), pp. 4145–4148. Abstract-Elsevier
BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | Order Document | Full Text
via CrossRef
Piesman et al., 2003 J. Piesman, N.S. Zeidner and B.S. Schneider, Dynamic changes
in Borrelia burgdorferi populations in Ixodes scapularis (Acari: Ixodidae) during
transmission: studies at the mRNA level, Vector-Borne Zoonotic Dis. 3 (2003), pp.
125–132. Abstract-MEDLINE | Order Document
Pollack et al., 1993 R.J. Pollack, S.R. Telford and A. Spielman, Standardization of
medium for culturing Lyme disease spirochetes, J. Clin. Microbiol. 31 (1993), pp.
1251–1255. Abstract-EMBASE | Order Document
Redfield, 2002 R.J. Redfield, Is quorum sensing a side effect of diffusion sensing?,
Trends Microbiol. 10 (2002), pp. 365–370. SummaryPlus | Full Text + Links | PDF
(90 K)
Ren et al., 2003 S.-X. Ren, G. Fu, X.-G. Jiang, R. Zeng, Y.-G. Miao, H. Xu, Y.-X.
Zhang, H. Xiong, G. Lu, L.-F. Lu, H.-Q. Jiang, J. Jia, Y.-F. Tu, J.-X. Jiang, W.-Y. Gu,
Y.-Q. Zhang, Z. Cai, H.-H. Sheng, H.-F. Yin, Y. Zhang, G.-F. Zhu, M. Wan, H.-L.
Huang, Z. Qian, S.-Y. Wang, W. Ma, Z.-J. Yao, Y. Shen, B.-Q. Qiang, Q.-C. Xia, X.K. Guo, A. Danchin, I. Saint Girons, R.L. Somerville, Y.-M. Wen, M.-H. Shi, Z.
Chen, J.-G. Xu and G.-P. Zhao, Unique physiological and pathogenic features of
Leptospira interrogans revealed by whole-genome sequencing, Nature 422 (2003), pp.
888–893. Abstract-GEOBASE | Abstract-MEDLINE | Abstract-Compendex |
Abstract-Elsevier BIOBASE | Abstract-EMBASE | Order Document | Full Text via
CrossRef
Rodionov et al., 2003 D.A. Rodionov, A.G. Vitreschak, A.A. Mironov and M.S.
Gelfand, Comparative genomics of the vitamin B12 metabolism and regulation in
prokaryotes, J. Biol. Chem. 278 (2003), pp. 41148–41159. Abstract-Elsevier
BIOBASE | Abstract-Compendex | Abstract-MEDLINE | Order Document | Full
Text via CrossRef
Sambrook et al., 1989 J. Sambrook, E.F. Fritsch and T. Maniatis, Molecular Cloning.
A Laboratory Manual (second ed), Cold Spring Harbor Laboratory Press, Cold Spring
Harbor, New York, USA (1989).
Schauder et al., 2001 S. Schauder, S. Shokat, M.G. Surette and B.L. Bassler, The
LuxS family of bacterial autoinducers: biosynthesis of a novel quorum-sensing signal
molecule, Mol. Microbiol. 41 (2001), pp. 463–476. Abstract-Elsevier BIOBASE |
Abstract-EMBASE | Abstract-MEDLINE | Order Document | Full Text via
CrossRef
Schwan, 1996 T.G. Schwan, Ticks and Borrelia: model systems for investigating
pathogen-arthropod interactions, Infect. Agents Dis. 5 (1996), pp. 167–181. AbstractMEDLINE | Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Sekowska et al., 2004 A. Sekowska, V. Denervaud, H. Ashida, K. Michoud, D. Haas,
A. Yokota and A. Danchin, Bacterial variations on the methionine salvage pathway,
BMC Microbiol. 4 (2004), p. 9. Abstract-MEDLINE | Order Document | Full Text
via CrossRef
Seshadri et al., 2004 R. Seshadri, G.S.A. Myers, H. Tettelin, J.A. Eisen, J.F.
Heidelberg, R.J. Dodson, T.M. Davidsen, R.T. DeBoy, D.E. Fouts, D.H. Haft, J.
Selengut, Q. Ren, L.M. Brinkac, R. Madupu, J. Kolonay, S.A. Durkin, S.C.
Daugherty, J. Shetty, A. Shvartsbeyn, E. Gebregeorgis, K. Geer, G. Tsegaye, J. Malek,
B. Ayodeji, S. Shatsman, M.P. McLeod, D. Smajs, J.K. Howell, S. Pal, A. Amin, P.
Vashisth, T.Z. McNeill, Q. Xiang, E. Sodergren, E. Baca, G.M. Weinstock, S.J.
Norris, C.M. Fraser and I.T. Paulsen, Comparison of the genome of the oral pathogen
Treponema denticola with other spirochete genomes, Proc. Natl. Acad. Sci. USA 101
(2004), pp. 5646–5651. Abstract-Elsevier BIOBASE | Abstract-EMBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Seshu and Skare, 2001 J. Seshu and J.T. Skare, The many faces of Borrelia
burgdorferi. In: M.H. Saier and J. García-Lara, Editors, The Spirochetes: Molecular
and Cellular Biology, Horizon Press, Oxford, UK (2001), pp. 147–158.
Steere et al., 1983 A.C. Steere, R.L. Grodzicki, A.N. Kornblatt, J.E. Craft, A.G.
Barbour, W. Burgdorfer, G.P. Schmid, E. Johnson and S.E. Malawista, The
spirochetal etiology of Lyme disease, N. Engl. J. Med. 308 (1983), pp. 733–740.
Abstract-MEDLINE | Abstract-EMBASE | Order Document
Stevenson and Babb, 2002 B. Stevenson and K. Babb, LuxS-mediated quorum
sensing in Borrelia burgdorferi, the Lyme disease spirochete, Infect. Immun. 70
(2002), pp. 4099–4105. Abstract-EMBASE | Abstract-Elsevier BIOBASE | AbstractMEDLINE | Order Document | Full Text via CrossRef
Stevenson et al., 1995 B. Stevenson, T.G. Schwan and P.A. Rosa, Temperaturerelated differential expression of antigens in the Lyme disease spirochete, Borrelia
burgdorferi, Infect. Immun. 63 (1995), pp. 4535–4539. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Stevenson et al., 1998 B. Stevenson, J.L. Bono, T.G. Schwan and P. Rosa, Borrelia
burgdorferi Erp proteins are immunogenic in mammals infected by tick bite, and their
synthesis is inducible in cultured bacteria, Infect. Immun. 66 (1998), pp. 2648–2654.
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order
Document
Stevenson et al., 2002 B. Stevenson, N. El-Hage, M.A. Hines, J.C. Miller and K.
Babb, Differential binding of host complement inhibitor factor H by Borrelia
burgdorferi Erp surface proteins: a possible mechanism underlying the expansive host
range of Lyme disease spirochetes, Infect. Immun. 70 (2002), pp. 491–497. AbstractEMBASE | Abstract-Elsevier BIOBASE | Abstract-MEDLINE | Order Document |
Full Text via CrossRef
Stevenson et al., 2003 B. Stevenson, K. von Lackum, R.L. Wattier, J.D. McAlister,
J.C. Miller and K. Babb, Quorum sensing by the Lyme disease spirochete, Microbes
Infect. 5 (2003), pp. 991–997. SummaryPlus | Full Text + Links | PDF (189 K)
Suk et al., 1995 K. Suk, S. Das, W. Sun, B. Jwang, S.W. Barthold, R.A. Flavell and E.
Fikrig, Borrelia burgdorferi genes selectively expressed in the infected host, Proc.
Natl. Acad. Sci. USA 92 (1995), pp. 4269–4273. Abstract-MEDLINE | AbstractEMBASE | Abstract-Elsevier BIOBASE | Order Document
Sun et al., 2004 J. Sun, R. Daniel, I. Wagner-Dobler and A.P. Zeng, Is autoinducer-2
a universal signal for interspecies communication: a comparative genomic and
phylogenetic analysis of the synthesis and signal transduction pathways, BMC Evol.
Biol. 4 (2004), p. 36. Abstract-MEDLINE | Order Document | Full Text via
CrossRef
Surette and Bassler, 1998 M.G. Surette and B.L. Bassler, Quorum sensing in
Escherichia coli and Salmonella typhimurium, Proc. Natl. Acad. Sci. USA 95 (1998),
pp. 7046–7050. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | AbstractEMBASE | Order Document | Full Text via CrossRef
Surette and Bassler, 1999 M.G. Surette and B.L. Bassler, Regulation of autoinducer
production in Salmonella typhimurium, Mol. Microbiol. 31 (1999), pp. 585–595.
Abstract-MEDLINE | Abstract-EMBASE | Order Document | Full Text via
CrossRef
Surette et al., 1999 M.G. Surette, M.B. Miller and B.L. Bassler, Quorum sensing in
Escherichia coli, Salmonella typhimurium, and Vibrio harveyi: a new family of genes
responsible for autoinducer production, Proc. Natl. Acad. Sci. USA 96 (1999), pp.
1639–1644. Abstract-MEDLINE | Abstract-EMBASE | Order Document | Full Text
via CrossRef
Taga, 2005 M.E. Taga, Methods for analysis of bacterial autoinducer-2 production.
In: R.T. Coico, T.F. Kowalik, J. Quarles, B. Stevenson and R. Taylor, Editors,
Current Protocols in Microbiology, Wiley, Hoboken, NJ (2005), p. 1C.1.
Taga et al., 2001 M.E. Taga, J.L. Semmelhack and B.L. Bassler, The LuxS-dependent
autoinducer AI-2 controls the expression of an ABC transporter that functions in AI-2
uptake in Salmonella typhimurium, Mol. Microbiol. 42 (2001), pp. 777–793. AbstractElsevier BIOBASE | Abstract-EMBASE | Abstract-MEDLINE | Order Document |
Full Text via CrossRef
Taga et al., 2003 M.E. Taga, S.T. Miller and B.L. Bassler, Lsr-mediated transport and
processing of AI-2 in Salmonella typhimurium, Mol. Microbiol. 50 (2003), pp. 1411–
1427. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full
Text via CrossRef
Thanbichler et al., 1999 M. Thanbichler, B. Neuhierl and A. Böck, Smethylmethionine metabolism in Escherichia coli, J. Bacteriol. 181 (1999), pp. 662–
665. Abstract-MEDLINE | Abstract-EMBASE | Order Document
Urbanowski et al., 1987 M.L. Urbanowski, L.T. Stauffer, L.S. Plamann and G.V.
Stauffer, A new methionine locus, metR, that encodes a trans-acting protein required
for activation of metE and metH in Escherichia coli and Salmonella typhimurium, J.
Bacteriol. 169 (1987), pp. 1391–1397. Abstract-MEDLINE | Abstract-EMBASE |
Order Document
Vieira and Messing, 1987 J. Vieira and J. Messing, Production of single-stranded
plasmid DNA, Methods Enzymol. 153 (1987), pp. 3–11. Abstract-EMBASE |
Abstract-MEDLINE | Order Document
von Lackum and Stevenson, 2005 K. von Lackum and B. Stevenson, Carbohydrate
utilization by the Lyme borreliosis spirochete, Borrelia burgdorferi, FEMS Microbiol.
Lett. 243 (2005), pp. 173–179. SummaryPlus | Full Text + Links | PDF (139 K)
Wallich et al., 1995 R. Wallich, C. Brenner, M.D. Kramer and M.M. Simon,
Molecular cloning and immunological characterization of a novel linear-plasmidencoded gene, pG, of Borrelia burgdorferi expressed only in vivo, Infect. Immun. 63
(1995), pp. 3327–3335. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | AbstractEMBASE | Order Document
Winzer et al., 2002a K. Winzer, K.R. Hardie, N. Burgess, N. Doherty, D. Kirke,
M.T.G. Holden, R. Linforth, K.A. Cornell, A.J. Taylor, P.J. Hill and P. Williams,
LuxS: its role in central metabolism and the in vitro synthesis of 4-hydroxy-5-methyl3(2H)-furanone, Microbiology 148 (2002), pp. 909–922. Abstract-MEDLINE |
Abstract-EMBASE | Abstract-Elsevier BIOBASE | Order Document
Winzer et al., 2002b K. Winzer, K.R. Hardie and P. Williams, Bacterial cell-to-cell
communication: sorry, can’t talk now—gone to lunch!, Curr. Opin. Microbiol. 5
(2002), pp. 216–222. SummaryPlus | Full Text + Links | PDF (106 K)
Winzer et al., 2003 K. Winzer, K.R. Hardie and P. Williams, LuxS and autoinducer-2:
their contribution to quorum sensing and metabolism in bacteria, Adv. Appl. Microbiol.
53 (2003), pp. 291–396. Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order
Document
Wyss, 1992 C. Wyss, Growth of Porphyromonas gingivalis, Treponema denticola, T.
pectinovorum, T. socranskii, and T. vincentii in a chemically defined medium, J. Clin.
Microbiol. 30 (1992), pp. 2225–2229. Abstract-MEDLINE | Abstract-EMBASE |
Order Document
Wyss and Ermert, 1996 C. Wyss and P. Ermert, Borrelia burgdorferi is an adenine
and spermidine auxotroph, Microb. Ecol. Health Dis. 9 (1996), pp. 181–185.
Abstract-Elsevier BIOBASE | Order Document
Xavier and Bassler, 2003 K.B. Xavier and B.L. Bassler, LuxS quorum sensing: more
than just a numbers game, Curr. Opin. Microbiol. 6 (2003), pp. 191–197.
SummaryPlus | Full Text + Links | PDF (353 K)
Zeh et al., 2002 M. Zeh, G. Leggewie, R. Hoefgren and H. Hesse, Cloning and
characterization of a cDNA encoding a cobalamin-independent methionine synthase
from potato (Solanum tuberosum L.), Plant Mol. Biol. 48 (2002), pp. 255–265.
Abstract-MEDLINE | Abstract-Elsevier BIOBASE | Order Document | Full Text via
CrossRef
Zhang and Norris, 1998a J.-R. Zhang and S.J. Norris, Genetic variation of the
Borrelia burgdorferi gene vlsE involves cassette-specific, segmental gene conversion,
Infect. Immun. 66 (1998), pp. 3698–3704. Abstract-EMBASE | Abstract-MEDLINE |
Abstract-Elsevier BIOBASE | Order Document
Zhang and Norris, 1998b J.-R. Zhang and S.J. Norris, Kinetics and in vivo induction
of genetic variation of vlsE in Borrelia burgdorferi, Infect. Immun. 66 (1998), pp.
3689–3697. Abstract-EMBASE | Abstract-MEDLINE | Abstract-Elsevier
BIOBASE | Order Document
Zhang et al., 1997 J.-R. Zhang, J.M. Hardham, A.G. Barbour and S.J. Norris,
Antigenic variation in Lyme disease borreliae by promiscuous recombination of
VMP-like sequence cassettes, Cell 89 (1997), pp. 1–20.
International Journal of Medical Microbiology
Article in Press, Corrected Proof
Corresponding author. Tel.: +1 859 257 9358; fax: +1 859 257 8994.
The first three authors contributed equally to these studies.
2
Present address: Yale University School of Medicine, 333 Cedar Street, New Haven,
CT, USA.
1