SuperSAGE Protocol for Solexa sequencing
7 May 2009
by Hideo Matsumura
Adapter preparation
See another sheet for adapter oligo sequences.
The ends of oligos should be blocked
by amino-modification for preventing self-ligation.
Dissolve synthesized adapter oligonucleotides in LoTE buffer (100pmol/µL).
Two complementary oligo DNAs are denatured by incubating at 95˚C for 2 min and
cool down to 20˚C for annealing.
The annealed double-stranded DNAs are
designated adapter1 and adapter 2, respectively.
For indexing multiple samples, different “adapter1” oligos are prepared. (adapter-1a,
1b, 1c…).
cDNA synthesis
Adapter-oligo dT (5’-biotin-CTGATCTAGAGGTACCGGATCCCAGCAGTTTTTTTTTTTTTTTTT)
was dissolved in DEPC water (100pmol/µL).
To 10 µl total RNA (2-10µg), 1µl adapter-oligo dT was added and incubated at 70˚C
for 10 min, and cooled on ice immediately.
Basically, follow the protocol of SuperScript II double-stranded cDNA synthesis kit
(Invitrogen).
Add 4µl 1st strand buffer (5x), 2µl DTT, 1µl dNTP to heat-treated RNA with adapter
dT.
Incubate at 45˚C for 2min and add 1µl SuperScriptII (or SuperSCriptIII).
Incubate at 45˚C for 1hr.
Add 30µl 2nd strand buffer (5x), 91µl water, 3µl dNTPs, 4µl
E.coli DNA polymerase, 1µl E.coli ligase and 1µl RNaseH to 1st strand cDNA solution
and incubate at 16˚C for 2hrs.
Synthesized cDNA was once purified by Qiagen PCR purification kit.
DNA was eluted from column with 50µl LoTE.
NlaIII digestion
Add 124µl
LoTE, BSA(100x) 2µl. NEbuffer4 (10x) 20µl, NlaIII 4µl to purified
cDNA solution. Incubate tube at 37˚C for 1hr.
Adapter 2 ligation
Prepare 0.1 mL suspension of streptavidin-coated magnetic beads (Dynabeads M270
streptavidin) in a 1.5 mL siliconyzed microtube.
Wash beads with 1x B&W once.
Add NlaIII-digested cDNA and 200µl 2xB&W buffer to the beads. Mix and incubate
at room temperature for 20min. (for association of biotin-lableled cDNA with
streptavidin on the beads)
Wash beads with 1x B&W for 2 times and LoTE for 2 times.
To ligate adapter 2 to digested cDNAs bound to the magnetic beads, add 21 µL
LoTE, 6 µL 5x T4 DNA ligase buffer, and 1-0.5 µL adapter 2 solution (about 20pmol).
After mixing with pipet, incubate the beads suspension at 50˚C for 2 min for the
dissociation of adapter dimers.
Keep the tubes at room temperature for 15 min.
Add 2µL T4 DNA ligase, and incubate at 16˚C for 2 hrs (or longer).
suspension every 20-30 min with a pipet.
Mix the bead
After ligation, wash beads 4 times with 1
x B&W buffer, and 3 times with 1x NEbuffer3.
EcoP15I digestion
For EcoP15I digestion of adapter2-cDNA on the magnetic beads, add 10 µL 10 x
NEbuffer buffer, 10 µL ATP (10x), 1µL BSA, 74 µL sterile water, and 5 µL EcoP15I to
the washed magnetic beads.
Incubate beads re-suspended in reaction solution at 37˚C
for 2 hrs with occasional mixing (every 20-30 min).
Place the bead suspension on the magnetic stand, and collect the supernatant into a
new tube.
Add 100 µL 1 x B&W to the magnetic beads, and mix.
After
separation on the magnetic stand, retrieve the supernatants and combine to the
previously collected solution.
Extract this solution, containing linker-tag fragments,
with phenol/chloroform to remove the magnetic beads completely.
Add 100 µL 10 M
ammonium acetate, 3 µL glycogen, and 900 µL cold ethanol to the collected solution
(approximately 200 µL) in the tube.
Keep it at –80˚C for 1 hr, and centrifuge at
maximum speed for 40 min at 4˚C.
Wash the resulting pellet twice with 70%
ethanol, and dry by vacuum centrifuge.
Dissolve precipitated adapter2-26 bp tag
fragments in 10 µL LoTE.
Adapter 1 ligation
Add 3µl 5x T4 ligase buffer and 0.5µl adapter1 solution (20pmol) to adapter2-26 bp
tag solution (10µl).
After mixing with pipets, incubate the beads suspension at 50˚C
for 2 min for the dissociation of adapter dimers.
temperature for 15 min.
Keep the tubes at room
Add 1.5µl T4ligase, and incubate at 16˚C for 2 hrs (or
longer).
PCR amplification
Prepare PCR mixture in each tube as follows;
4µl
5xPhusion HF buffer
0. 4µl
10mM dNTPs
0. 2µl
100pmol/µl GEX PCR primer1 (see another sheet)
0. 2µl
100pmol/µl GEX PCR primer2 (see another sheet)
0. 5µl
50mM MgCl2
13.5 µl
1µl
water
ligates (adapter2-tag-adapter1 ligates)
0.2 µl
Hot Start Phusion High DNA polymerase
This mixture was prepared in eight tubes (20µl in each).
PCR cycle:
98˚C for 1min, then 5-15 cycles each at 98˚C for 20sec, and 60˚C for
30sec. (10-cycles are recommended.)
Check amount and size of PCR product by 8% PAGE.
Prepare an 8% PAGE gel by mixing 3.5 mL 40% acrylamide/bis solution, 13.5 mL
distilled water, 350 µL 50x TAE buffer, 175 µL 10% ammonium persulfate, and 15 µL
TEMED.
Pour the solution onto the gel plate (12 cm x 12cm, 1 mm thickness), and
insert a comb (no stacking gel).
Prepare running buffer, (1 x TAE), and add to the
upper and lower electrophoresis chambers.
Then, add 2 µL 6 x loading dye to 10 µL
of purified PCR products, and load the sample in the well.
Also, load 1.5µl of a 20
bp ladder marker as molecular size marker. Run the polyacrylamide gel at 75 V for 10
min, and then at 150 V for 30 min (until the BPB dye front migrated two-third down the
gel).
After electrophoresis, remove the gel from the plate.
Pour 1 mL SYBR green
solution (diluted in 1 x TAE buffer) on the plastic wrap, and place the gel on it.
Further, disperse 1 mL SYBR green solution onto the gel and wrap the gel.
min staining period, place the gel on a UV transilluminator.
After a 2
Under UV light, 123bp
band (if longer adapter2 is employed) should be prominent.
If apparent band around120bp was observed by SyBR-green staining, prepare 8-15
tubes of PCR products at the same condition.
Purification of PCR product
Collect all the PCR products in a tube and concentrated by EtOH precipitation or
Qiagen MinElute reaction clean kit. Dissolve or elute concentrated DNA in 10µl
LoTE, and apply to PAGE.
Only the band at expected size (123-125bp) is cut out from the gel with a knife and
transferred to a 0.5 mL microtube.
Make holes at the top and the bottom of the tube
with a needle, and place it in a 1.5 mL microtube.
speed for 2-3 min.
Centrifuge the tube at maximum
Polyacrylamide gel pieces are collected at the bottom of the
microtube. Add 300 µL LoTE to the gel pieces, and suspend.
After incubation at
37˚C for 2 hrs, transfer the gel suspension to a Spin-X column, and centrifuge at
maximum speed for 2 min. Extract the eluate with phenol/chloroform, and precipitate
by adding 100 µL 10 M ammonium acetate, 3µL glycogen and 950 µL cold ethanol.
Keep it at –80˚C for 1hr and centrifuge at 15,000 x g for 40 min at 4˚C.
with 70% ethanol and dry.
Wash once
Dissolve the resulting pellet in 10 µL LoTE.
Take 1µl purified DNA for analyzing quantity and quality by Agilent bioanalyzer.
After mixing equal amount of purified DNA (123-125bp PCR products) from several
samples, it is ready for Illumina sequencing (>100ng in total).
List of Buffers
LoTE: 3 mM Tris-HCl, pH7.5, 0.2 mM EDTA
B&W buffer: 5mM Tris-HCl, pH7.5, 0.5mM EDTA, 1M NaCl
adapters
(Adapter-1)
oligo A: 5‘-ACAGGTTCAGAGTTCTACAGTCCGACGATCGCCC
oligo B:
amino-3’-TGTCCAAGTCTCAAGATGTCAGGCTGCTAGCGGGNN-5’
Blue letters= index
(Adapter-2)
oligo A: 5‘- CAAGCAGAAGACGGCATACGATCTAACGATGTACGCAGCAGCATG
oligo B:
amino-3’-GTTCGTCTTCTGCCGTATGCTAGATTGCTACATGCGTCGTC-5’
PCR primers
GEX PCR primer1:
5’-AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3’
GEX PCR primer2:
5’-CAAGCAGAAGACGGCATACGA-3’