Applied Microbiology and Biotechnology Supplementary materials Fine-tuning of ecaA and pepc gene expression increases succinic acid production in Escherichia coli Names of authors: Jing Wang1, Dandan Qin1, Baoyun Zhang2, Qiang Li3, Sha Li4, Xiaohua Zhou1, Lichun Dong1, Dan Wang1,4* Affiliations: 1 School of Chemistry and Chemical Engineering, Chongqing University, Chongqing 400044, China 2 School of Bioengineering, Chongqing University, Chongqing 400044, China 3 National Key Laboratory of Biochemical Engineering, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100190, China 4 State Key Laboratory of Materials-Oriented Chemical Engineering, Nanjing University of Technology, Nanjing 210009, China *Corresponding Author: Dan Wang Tel: +86-23-65111179 Fax: +86-23-65111179 E-mail address: dwang@cqu.edu.cn (Dan Wang) Mailing address: P. O. box 94#, Shazheng Street 174, Shapingba District, College of Chemistry and Chemical Engineering, Chongqing University, Chongqing, 400044, China Table S1 Primers, plasmids, plasmid libraries, strains and strain libraries used in this study. Primers/Plasmids/ Plasmid Description Source/Restriction libraries/ site Strains/Strain libraries Primers rbSSR-ecaA-up1 5’CGCGGATCCGCGCAGGAAAAAAAAAAAAAAA This study/BamHI AATGAGTAGTACTTTATATCGAAGGC3’ rbSSR -ecaA-up2 5’CGCGGATCCGCGCAGGACACACACACACACAC This study/BamHI ATGAGTAGTACTTTATATCGAAGGC3’ rbSSR -ecaA-up3 5’CGCGGATCCGCGCAGGATATATATATATATATATG This study/BamHI AGTAGTACTTTATATCGAAGGC3’ rbSSR -ecaA-up4 5’CGCGGATCCGCGCAGGCCCCCCCCCCCCCCCC This study/BamHI ATGAGTAGTACTTTATATCGAAGGC3’ rbSSR -pepc-up1 5’CGCGGATCCGCGCAGGAAAAAAAAAAAAAAA This study/BamHI AATGGTGGATTTGTTACGGCAGT3’ rbSSR -pepc-up2 5’CGCGGATCCGCGCAGGACACACACACACACAC This study/BamHI ATGGTGGATTTGTTACGGCAGT3’ rbSSR -pepc-up3 5’CGCGGATCCGCGCAGGATATATATATATATATATG This study/BamHI GTGGATTTGTTACGGCAGT3’ rbSSR -pepc-up4 5’CGCGGATCCGCGCAGGCCCCCCCCCCCCCCCC This study/BamHI ATGGTGGATTTGTTACGGCAGT3’ rbSSR -up 5’CTGTACGACGATGACGATAAGG3’ This study rbSSR -ecaA-down 5’GGGAAGCTTCCCAGAAGTGTCTAGGGATTGAG This study 3’ rbSSR -pepc-down 5’GGGAAGCTTCCCAACCTGTATTTCTCATCCCT3’ This study CA-RT-up 5’AGTGTCTTGGGAACCTCAT3’ This study CA-RT-down 5’CGTTTGTTTCTGCCTATT3’ This study PC-RT-up 5’GCTTCTTGAGTAGCAATG3’ This study PC-RT-down 5’GCCAAAATCGCCTCGTG3’ This study AMP-RT-up 5’GCGACTTAGCCGTTATGGGT3’ This study AMP-RT-down 5’TGTTGTGCTGGGAGAATTG3’ This study pTrchisB Expressing vectors with Trc promoter Invitrogen pTrc-ecaA1 ecaA gene cloned from Anabaena sp. PCC 7120 under This study Plasmids the Trc promoter of pTrchisB with (A)16 as spacer motif pTrc-ecaA2 ecaA gene cloned from Anabaena sp. PCC 7120 under This study the Trc promoter of pTrchisB with (Ac)8 as spacer motif pTrc-ecaA3 ecaA gene cloned from Anabaena sp. PCC 7120 under This study the Trc promoter of pTrchisB with (AT)8 as spacer motif pTrc-ecaA4 ecaA gene cloned from Anabaena sp. PCC 7120 under This study the Trc promoter of pTrchisB with (C)16 as spacer motif pTrc-pepc1 pepc gene cloned from Anabaena sp. PCC 7120 under This study the Trc promoter of pTrchisB with (A)16 as spacer motif pTrc-pepc2 pepc gene cloned from Anabaena sp. PCC 7120 under This study the Trc promoter of pTrchisB with (Ac)8 as spacer motif pTrc-pepc3 pepc gene cloned from Anabaena sp. PCC 7120 under This study the Trc promoter of pTrchisB with (AT)8 as spacer motif pTrc-pepc4 pepc gene cloned from Anabaena sp. PCC 7120 under This study the Trc promoter of pTrchisB with (C)16 as spacer motif Plasmid libraries pTrc-ecaA ecaA gene cloned from Anabaena sp. PCC 7120 under This study the Trc promoter of pTrchisB with different base sequences as spacer motif pTrc-pepc pepc gene cloned from Anabaena sp. PCC 7120 under This study the Trc promoter of pTrchisB with different base sequences as spacer motif Strains DC1515 pflA::Cam ldhA::Tn 10 ptsG400::Kan in W1485 Clark, unpublished Anabaena sp. PCC Providing ecaA gene and pepc gene Pasteur Institute in 7120 France KCO111 DC1515 harboring plasmids pTrc-ecaA and pTrc-pepc This study which overexpressing ecaA gene 3.53-fold and pepc gene 1.06 fold Strain libraries KCA1 DC1515 harboring pTrc-ecaA libraries, overexpressing This study ecaA gene KPC1 DC1515 harboring pTrc-pepc libraries, overexpressing This study pepc gene KCO1 DC1515 harboring pTrc-ecaA libraries and pTrc-pepc libraries, overexpressing ecaA gene and pepc gene This study