Supplementary Methods
Cloning and sequencing of pre-miR-30a
Pre-miR-30a was cloned by directional cloning method as originally described by
Tuschl and others1. Pre-miR-30a was prepared by in vitro processing of pri-miRNA
labeled with low specific activity and ligated to 5’ and 3’ adapter molecules, followed
by RT-PCR, cloning, and sequencing. One of the primers for each PCR was designed to
anneal to pre-miR-30a so as to amplify pre-miR-30a specifically while avoiding
amplification of tRNAs and rRNAs. The 3’ and 5’ adapters used for directional cloning
are 5’-pUUUaaccgcgaattccagidT-3’ (uppercase, RNA; lowercase, DNA; p, phosphate;
idT, inverted deoxythymidine) and 5’-acggaattcctcactAAA-3’ (uppercase, RNA;
lowercase, DNA), respectively1.
Reverse transcription was performed using reverse
transcription primer (5’-actggaattcgcggttaaa-3’).
For determination of the 5’ end of the
pre-miR-30a, forward A (5’-cagccaacggaattcctcctcactaaa-3’) and reverse A (5’gcagctgcaaacatccgactgaaagccca-3’) were used for PCR amplification. For mapping of
the 3’ end of the pre-miR-30a, forward B (5’-cagccaacggaattcctcctcactaaatgta-3’) and
reverse B (reverse transcription primer) were used for PCR amplification. PCR products
were subcloned into pGEM-T-easy (Promega) and 12 clones were sequenced for each
PCR reaction.
Plasmid construction
cDNA of human Drosha was cloned from HeLa total RNA by RT-PCR using primers,
Rnc5A
(5’-cgaggtaccatgatgcagggaaacacatgtcac-3’)
and
Rnc3D
(5’-
gtctctagattatttatcgtcatcgtctttgtagtctttcttgatgtcttcagtctcatctg-3’), and cloned into pCK2
under the control of human cytomegalovirus immediate early promoter to generate
pCK-Drosha-FLAG.
In vitro transcription
In vitro transcription was carried out as described previously3 with following
modifications. To prepare templates for in vitro transcription, the PCR products
containing the genomic sequences of miRNA were subcloned into pGEM-T-easy
(Promega). PCR primers used to construct the template plasmids are the following. For
miR-30a, 5’-cccttgaagtccgaggca-3’ was used for first-strand synthesis and 5’tgctgttgaacgtgagcg-3’ (forward) and 5’-cccttgaagtccgaggca-3’ (reverse) were used for
PCR amplification. For miR-23~27~24-2, 5’-ggcaggggctgcaggctccaagggggcttg-3’ was
used for first-strand synthesis and 5’-cgcccggtgcccccctcacccctgtgccac-3’ (forward) and
5’-ccctgttcctgctgaactgagccagtgtac-3’ (reverse) were used for PCR amplification. For
miR-15~16, 5’-cttactctgagttaaatcttgaatac-3’ was used for first-strand synthesis and 5’ccttggagtaaagtagcagcaactaatg-3’ (forward) and 5’-cttactctgagttaaatcttgaatac-3’ (reverse)
were used for PCR amplification. For let-7a-1, 5’-tttctatcagaccgcctggatgcagacttt-3’ was
used for first-strand synthesis and 5’-gattccttttcaccattcaccctggatgtt-3’ (forward) and 5’tttctatcagaccgcctggatgcagacttt-3’ (reverse) were used for PCR amplification. The
plasmids were linearized with Spe I. In the transcription reaction, 1 mM of GTP was
added instead of 0.1 mM and the cap analog was omitted.
Northern blot analysis
Probes for Drosha and Dicer were prepared by random priming method using fragments
containing part of Drosha (3439-4125) and Dicer (1-1000), respectively.
Numbering
starts from the start codon. Oligonucleotides complementary to miRNAs were endlabeled and used as probes for Northern. The sequences of the oligonucleotides are; 5’gaaaatccctggcaatgtgat-3’
gccaatatttacgtgctgcta-3’
(miR-23),
(miR-16),
5’-actatacaacctactacctca-3’
(let-7a-1),
5’-
5’-tacctgcactataagcacttta-3’
(miR-20),
5’-
tcaacatcagtctgataagcta-3’ (miR-21), 5’-agcggaacttagccactgtgaa-3’ (miR-27), and 5’caggcccgaccctgcttagcttccgagatcagacgagat-3’ (5S rRNA).
Ribonuclease protection assay
50-120 g of RNA was used for each assay using Ribonuclease T1 at 1:50 dilution from
RPA III kit (Ambion) as previously described5. Equal amount of yeast RNA was used
as a control. The probes were designed to hybridize to miRNA as well as the
surrounding sequences so that the precursors will give rise to distinctly sized fragments.
The probes were synthesized using T7 polymerase (Promega) directly from the PCR
products
that
contain
the
T7
promoter.
taatacgactcactataggtaagttggcagcatcctcggtggcag-3’
Primers
for
miR-23
(forward)
and
are
5’5’-
aattgtatacgtattatgaaatcacattgccagggatttc-3’ (reverse).
References
1.
Elbashir, S. M., Lendeckel, W. & Tuschl, T. RNA interference is mediated by
21- and 22-nucleotide RNAs. Genes Dev 15, 188-200. (2001).
2.
Lee, Y., Park, E. J., Yu, S. S., Kim, D. K. & Kim, S. Improved expression of
vascular endothelial growth factor by naked DNA in mouse skeletal muscles:
implication for gene therapy of ischemic diseases. Biochem Biophys Res
Commun 272, 230-5. (2000).
3.
Pellizzoni, L., Kataoka, N., Charroux, B. & Dreyfuss, G. A novel function for
SMN, the spinal muscular atrophy disease gene product, in pre-mRNA splicing.
Cell 95, 615-24 (1998).
4.
Elbashir, S. M. et al. Duplexes of 21-nucleotide RNAs mediate RNA
interference in cultured mammalian cells. Nature 411, 494-8. (2001).
5.
Lee, Y., Jeon, K., Lee, J. T., Kim, S. & Kim, V. N. MicroRNA maturation:
stepwise processing and subcellular localization. EMBO J 21, 4663-70. (2002).