Nature Chemical Biology 1, 93-97 (2005)
doi: 10.1038/nchembio713
Homomultimeric complexes of CD22 in B cells revealed
by protein-glycan cross-linking
Shoufa Han1,2, Brian E Collins1,2, Per Bengtson1 and James C Paulson1
CD22 is a negative regulator of B-cell receptor signaling, an activity mediated by
recruitment of SH2 domain−containing phosphatase 1 through a phosphorylated
immunoreceptor tyrosine inhibitory motif in its cytoplasmic domain1. As in other
members of the sialic acid−binding immunoglobulin-like lectin, or siglec, family, the
extracellular N-terminal immunoglobulin domain of CD22 binds to glycan ligands
containing sialic acid, which are highly expressed on B-cell glycoproteins2. B-cell
glycoproteins bind to CD22 in cis and 'mask' the ligand-binding domain3, modulating its
activity as a regulator of B-cell signaling4, 5, 6. To assess cell-surface cis ligand
interactions, we developed a new method for in situ photoaffinity cross-linking of glycan
ligands to CD22. Notably, CD45, surfaceIgM (sIgM) and other glycoproteins that bind to
CD22 in vitro7, 8 do not appear to be important cis ligands of CD22 in situ. Instead, CD22
seems to recognize glycans of neighboring CD22 molecules as cis ligands, forming
homomultimeric complexes.
Activation of B cells after antigen binding to the B-cell receptor (BCR) is a primary
immune response to pathogens, resulting in proliferation and production of antigenspecific antibodies. BCR activation is highly regulated by coreceptors like CD22, which
set a signaling threshold that prevents an aberrant immune response and autoimmune
disease1. Although it is clear that cis ligands modulate the activity of CD22 (refs. 4−6),
their identity has not been unequivocally established. CD22 binds specifically to the
terminal sequence N-acetylneuraminic acid (2-6) galactose (NeuAc- (2-6)-Gal) present
on many B-cell glycoproteins2. Although glycan-mediated binding of CD22 to CD45 and
sIgM has been demonstrated in vitro, in situ interactions of CD22 with these
glycoproteins detected with protein cross-linking reagents were found to be glycan
independent9. Because the bulky glycan contacting CD22 could leave a gap between the
proteins too large to be bridged by a bifunctional protein cross-linking reagent, we
reasoned that cross-linking to the glycan ligand itself would provide a more direct
approach to identifying the glycoprotein(s) comprising the cis ligands of CD22.
To achieve covalent cross-linking between CD22 and its glycan ligands in situ, we
adopted a strategy for metabolic installment of a photo-cross-linker into cell-surface
glycans (Scheme 1). The strategy relies on the ability of mammalian cells to take up sialic
acid analogs and incorporate them through the normal biosynthetic pathway into cell-
surface glycoproteins10, 11. We selected the aryl-azide (AAz) moiety as a preferred
functional group for photo-cross-linking12 and installed AAz at the C-9 position of Nacetylneuraminic acid (NeuAc, Compound 1) to give 9-AAz-NeuAc (Compound 4;
Scheme 2), as CD22 shows enhanced binding affinity to NeuAc modified to contain aryl
substituents at C-9 (refs. 5,13).
Scheme 1:
Strategy for metabolic incorporation of 9-AAz-NeuAc into cell-surface glycoproteins.
Full scheme and legend (34K) Figures, schemes & tables index
Scheme 2:
Synthesis of 9-AAz-NeuAc (Compound 4).
Full scheme and legend (6K) Figures, schemes & tables index
To determine whether cells could use 9-AAz-NeuAc in place of NeuAc, we used the Bcell line BJAB K20 (K20), which is deficient in UDP-GlcNAc-2-epimerase, a key step in
sialic acid biosynthesis14. K20 cells are thus deficient in sialic acid, unless the medium is
supplemented with NeuAc, N-acetylmannosamine (ManNAc) or substituted NeuAc
derivatives. Supplementing the medium with 3 mM NeuAc, 9-AAz-NeuAc or ManNAc
(data not shown) restores cell-surface sialic acids and CD22 ligands on K20 to levels
similar to those of wild-type BJAB K88 (K88), as detected with labeled Sambucus nigra
agglutinin (SNA) or CD22-Fc chimera (CD22-Fc), respectively (Fig. 1a). Notably, SNA,
which is specific for the NeuAc- (2-6)-Gal linkage, seems unaffected by the 9-AAz
substituent. CD22-Fc showed slightly enhanced binding to 9-AAz-NeuAc cells, as
anticipated, because of the aryl substituent at this position. We verified the presence of
the AAz moiety on the cell surface by the Staudinger-Bertozzi ligation15, which results in
covalent attachment of biotin to the cell surface for subsequent detection with labeled
streptavidin (Scheme 3 and Fig. 1b).
Figure 1: Introduction of a carbohydrate photoaffinity cross-linker into cell-surface glycoprotein
ligands in situ.
(a) K88 cells (red bold), K20 cells (gray shaded) and K20 cells cultured with 3 mM
NeuAc (black thin) or 9-AAz-NeuAc (blue bold), stained with CD22-Fc chimera and
FITC-labeled anti−human IgG (Fc specific) or FITC-labeled SNA to detect incorporated
NeuAc or 9-AAz-NeuAc. (b) K20 cells cultured with 3 mM NeuAc (black thin), 9-AAzNeuAc (blue bold) or no added sugar (gray shaded), then reacted with
triphenylphosphine-biotin; incorporated biotin was detected with FITC-streptavidin.
Full figure and legend (14K) Figures, schemes & tables index
Scheme 3:
Azide reactivity on the cell surface determined by the Staudinger-Bertozzi ligation
(incorporation of a biotin group).
Full scheme and legend (14K) Figures, schemes & tables index
To assess the cross-linking of 9-AAz-NeuAc to CD22, we used a biotinylated sialoside,
9-AAz-NeuAc- (2-6)-Gal- (1-4)-GlcNAc- -spacer-biotin (Compound 6; Scheme 4).
Incubation with CD22-Fc resulted in cross-linking of the 9-AAz-NeuAc−containing
sialoside to CD22-Fc after UV irradiation (Fig. 2a). We observed no cross-linking in
analogous experiments with a variety of control proteins, indicating that the reaction of 9AAz-NeuAc-sialoside with CD22 is not a result of nonspecific cross-linking (data not
shown).
Figure 2: Cross-linking of 9-AAz-NeuAc−containing glycans to CD22-Fc chimera in vitro, or
endogenous B-cell membrane−bound CD22 in situ.
(a) Western blot analysis to detect UV-induced cross-linking of 9-AAz-NeuAc- (2-6)Gal- (1-4)-GlcNAc- -Lc-Lc-biotin to CD22-Fc in vitro. (b) In situ cross-linking of
CD22. Western blot analysis of CD22 from K20 cells cultured with or without exogenous
NeuAc or 9-AAz-NeuAc for 18 h and exposed to UV light to induce cross-linking. (c)
Western blot analysis of CD22 from K20 cells cultured with or without 9-AAz-NeuAc or
NeuAc for the indicated time, and then exposed to UV light.
Full figure and legend (13K) Figures, schemes & tables index
Scheme 4:
Chemoenzymatic synthesis of 9-AAz-NeuAc- (2-6)-Gal- (1-4)-GlcNAc- -Lc-Lc-biotin
(Compound 6).
Full scheme and legend (7K) Figures, schemes & tables index
To determine whether cell-surface glycoproteins containing 9-AAz-NeuAc would crosslink to CD22 in situ, we harvested K20 cells grown in medium supplemented with
NeuAc or 9-AAz-NeuAc and irradiated them with UV light to induce cross-linking. Most
of the CD22 from cells cultured with 9-AAz-NeuAc yielded a diffuse, high-molecularweight band of >250 kDa in western blots, indicative of extensive cross-linking (Fig. 2b),
whereas CD22 from cells cultured with NeuAc gave a discrete band at the expected
molecular weight of 120 kDa. Culturing cells with 9-AAz-NeuAc for as little as 6 h
resulted in detectable CD22 cross-linking, with maximal cross-linking achieved after
14−18 h of culture (Fig. 2c and Supplementary Fig. 1).
To identify the candidate cis ligands of CD22, we evaluated the ability of CD22-Fc to
precipitate them from cell lysates in vitro. Although neither SNA nor CD22-Fc
precipitated glycoproteins from lysates of K20 cultured in the absence of sialic acids,
both precipitated numerous glycoproteins from lysates of K20 cultured with ManNAc,
NeuAc or 9-AAz-NeuAc at levels similar to that from wild-type K88 (Fig. 3a and
Supplementary Fig. 2). SNA precipitated lower-molecular-weight proteins more
efficiently than CD22-Fc, except in K20 cultured with 9-AAz-NeuAc, presumably
because of the enhanced affinity this sialic acid provided for CD22. Otherwise, CD22
seemed to recognize the same pattern of glycoproteins expressed on K88 or K20 cells
cultured with ManNAc, NeuAc or 9-AAz-NeuAc. Both CD22-Fc and SNA also
precipitated specific proteins previously implicated as cis ligands of CD22, including
CD45 (refs. 7,16,17), CD19 (ref. 18) and the plasma membrane calcium ATPase
PMCA19 in a sialic acid−dependent manner (Fig. 3b and Supplementary Fig. 3). Amounts
precipitated from K88 and K20 cultured with sialic acid precursors were comparable
(with ManNAc) or slightly enhanced (with 9-AAz-NeuAc) in three separate experiments.
Figure 3: Differential recognition of B-cell glycoproteins by CD22 in vitro and in situ.
(a) Streptavidin-HRP immunoblotting for proteins 'immunoprecipitated' with CD22-Fc or
SNA-agarose in a sialic acid−dependent manner from K88 cells or K20 cells cultured
exogenous NeuAc, 9-AAz-NeuAc, or ManNAc, then surface biotinylated. (b)
Immunoblotting for CD45 and CD19 in total lysate or CD22-Fc immunoprecipitants
from cells treated as in a. (c) Immunoblotting for CD22, CD45, IgM and PMCA after
CD22 immunoprecipitation of cross-linked lysates from K20 cells with or without NeuAc
or 9-AAz-NeuAc and UV light to induce cross-linking. (d) Differential recognition of
glycoproteins by CD22 in vitro as compared with in situ, possibly driven by microdomain
localization or spatial juxtaposition.
Full figure and legend (40K) Figures, schemes & tables index
To assess whether these same proteins are cis ligands of CD22 in situ, we
immunoprecipitated lysates of UV-irradiated cells cultured with NeuAc or 9-AAz-NeuAc
with anti-CD22 and sequentially probed the blots with antibodies to CD22, CD45,
PMCA, IgM and CD19. In contrast to CD22, which is extensively cross-linked in cells
cultured with 9-AAz-NeuAc, negligible cross-linking of the other glycoproteins was
observed, and none coprecipitated with CD22 (Fig. 3c and Supplementary Fig. 4).
Because CD22 is estimated to be on the surface of B cells at levels equal to or 10-fold
higher than CD19 and IgM, respectively20, 21, these glycoproteins should be detected in
the anti-CD22−immunoprecipitated pellet even if only a small fraction of them are crosslinked to CD22. CD45, however, is expressed at levels 10-fold higher than CD22 (ref.
22), and a small fraction cross-linked to CD22 could be missed. To address this
possibility, we used anti-CD45 for immunoprecipitation. Only the resulting supernatant
contained the cross-linked CD22, indicating no significant cross-linking of CD45 to
CD22 (Supplementary Fig. 4). Thus, despite the fact that these glycoproteins carry glycan
ligands recognized by CD22 (Fig. 3b)8, none of them seem to represent significant cis
ligands of CD22 in resting B cells.
Masking of CD22 to multivalent sialoside probes by cis ligands has been reported to be
partially reversed after BCR activation3. In activated cells, we observed no significant
change in the amount or size of the CD22 cross-linked complex, nor did we find any
cross-linking of CD45, PMCA or sIgM to CD22 (Supplementary Fig. 5). This is perhaps
not surprising, because in separate experiments evaluating the binding of multivalent
sialoside probes, we observed no 'unmasking' of CD22 after activation of K88 or K20
cultured in the presence of sialic acids (data not shown).
Taken together, the results suggest that many, if not most, B-cell glycoproteins carry
glycans recognized by CD22-Fc in vitro (Fig. 3a,b), but they do not seem to be
significant cis ligands in situ (Fig. 3c). It follows therefore that the extracellular ligandbinding domain of CD22 has access to only a limited subset of glycoprotein glycans
when anchored to the B-cell membrane. This could result from colocalization of
glycoproteins to the same microdomain as CD22, from a requirement that the
glycoprotein glycans be physically juxtaposed with the CD22 binding site (the same
distance from the membrane), or both (Fig. 3d).
One glycoprotein that fits both criteria is CD22 itself. Indeed, there are four potential Nlinked glycosylation sites in the N-terminal immunoglobulin domain of CD22 (ref. 23)
that have been suggested as potential cis ligands9, 24. Moreover, the high molecular
weight of cross-linked CD22 (>400 kDa) is consistent with recognition of glycans on
adjacent CD22 molecules, leading to the formation of CD22 'multimers'. Indeed, with
low sialic acid incorporation, discrete bands consistent with the formation of dimers,
trimers and tetramers of CD22 could be detected (Fig. 2c).
To test this possibility, we prepared expression vectors producing CD22 fusion proteins
with C-terminal (cytoplasmic) Flag-tag or Myc-tag (Supplementary Fig. 6) and
transfected them simultaneously into K20, then cultured them with either NeuAc or 9AAz-NeuAc. Coprecipitation of CD22-Myc with anti-Flag after irradiation with UV light
showed protein-glycan cross-linking between CD22-Flag and CD22-Myc (Fig. 4).
Notably, only the most highly cross-linked species of CD22-Myc coprecipitated with
anti-Flag, whereas the non-cross-linked CD22-Myc (120 kDa) remained in the
supernatant. Immunoprecipitation with anti-Myc gave similar results (Supplementary Fig.
6). The high degree of cross-linking between the Myc-tag and Flag-tag constructs,
coupled with the virtual absence of cross-linking with other major glycoproteins
containing glycans recognized by CD22 (Fig. 3c), suggested that glycans of neighboring
CD22 molecules are the predominant cis ligands of CD22.
Figure 4: CD22 forms homomultimeric complexes with glycans on neighboring CD22 molecules.
K20 cells transfected with CD22-Flag, CD22-Myc or both, cultured in the presence of
exogenous NeuAc or 9-AAz-NeuAc and exposed to UV light to induce cross-linking.
Western blot analysis for Myc- and Flag-tags. Lysates were immunoprecipitated with
anti-Flag M2 agarose.
Full figure and legend (10K) Figures, schemes & tables index
Interactions of cis ligands with CD22 have been variously proposed to enhance or
suppress its function as a regulator of BCR signaling4, 5, 6, 9, 25; consequently, a consensus
view of the role of these interactions on CD22 function has not emerged. We showed
here that CD22 exhibits highly restricted recognition of the glycans of neighboring CD22
molecules in situ, to the exclusion of many other B-cell glycoproteins recognized in vitro.
Although we have not excluded protein-glycan cross-linking of other glycoproteins to
CD22, mass spectrometric analysis of the cross-linked band detected only CD22 (data not
shown). We also note that protein-protein interactions documented for CD22 (refs. 9,19)
would not be detected unless the interactions simultaneously involved binding to glycans.
Nonetheless, the selectivity of CD22 for cis ligands emphasizes the need for a better
understanding of the membrane microdomain distribution of CD22 and other
glycoproteins involved in BCR regulation. Significantly, CD22 contains a cytoplasmic
motif that binds to a component of the scaffolding of clathrin-coated pits26. Additionally,
we observed colocalization of approximately 75% of CD22 with clathrin-coated pits in
murine B cells, consistent with microdomain localization being an important factor in
CD22 selectivity (data not shown). Although homomultimerization of CD22 through
protein-glycan interactions may simply be a consequence of its density in microdomains
like clathrin-coated pits, multimerization through protein-glycan interactions may also
serve to modulate the activity of CD22 as do protein-protein interactions that modulate
the activity of other regulators of lymphocyte signaling27.
In addition to binding in cis, CD22 binds ligands in trans on neighboring cells, causing
redistribution to sites of cell contact and dampening of B-cell activation28, 29. It will be of
interest to apply the 9AAz-NeuAc cross-linking approach to identifying trans ligands of
CD22. Most members of the sialic acid−binding immunoglobulin-like lectin (siglec)
family similarly interact with both cis and trans ligands30. To the extent that 9-AAzNeuAc or related analogs are recognized by siglecs13 and are incorporated into cells
bearing their ligands, the approach described here may be of general utility in identifying
the in situ ligands of other members of the siglec family.
Top of page
Methods
Antibodies.
Antibodies and dilutions for western blots were as follows: anti-CD22 (1:500, Santa Cruz
Biotechnology, H-221), anti-CD45 (1:500, Santa Cruz Biotechnology, 35-Z6), antiPMCA (1:1,000, Affinity BioReagents, 5F10), rabbit anti-CD19 (1:5,000, Cell Signaling
Technology), goat anti-IgM (1:1,000, Pierce Biotechnology), mouse anti-Flag (1:5,000,
Sigma, M2), rabbit anti-Myc (1:10,000, Abcam), horseradish peroxidase
(HRP)−conjugated goat anti−human IgG (Fc specific, 1:5,000, Sigma), HRP-conjugated
streptavidin (1:20,000, Jackson Immunoresearch Labs), HRP-conjugated goat anti-mouse
(1:10,000, Upstate Biotechnology), HRP-conjugated donkey anti-rabbit (1:10,000,
Amersham), and HRP-conjugated rabbit anti-goat (1:30,000 Jackson Immunoresearch
Labs). For immunoprecipitations, we used anti-CD22 (Santa Cruz Biotechnology, M20)
and anti-CD45 (Santa Cruz Biotechnology, 35-Z6).
In vitro binding of lectins to 9-(p-azidobenzoylamino)-NeuAc- (2-6)-Gal- (1-4)GlcNAc- -Lc-Lc-biotin (6).
9-AAz-NeuAc (Compound 4) and Compound 6 were synthesized and characterized as
described in Supplementary Methods online. Compound Compound 6 (40 l, 4 mM) was
incubated at room temperature (22 °C) in the dark for 30 min with agitation with each of
the following lectins (40 g): CD22-Fc (produced as described in Supplementary
Methods online), SNA-II−HRP (1 mg ml-1, E.Y. Laboratories), MAA-HRP (1 mg ml-1, E.
Y. Laboratories) and PSL-HRP (0.3 mg ml-1, E. Y. Laboratories). Aliquots (40 l) of
each in a 12-well tissue culture plate were exposed to UV light (254 nm) for 20 min at a
distance of 1.5 cm, and the remainder was kept in the dark. All samples were ultrafiltered
in the dark (Centricon, molecular weight cutoff 10,000 Da) with PBS wash (three times)
to remove unbound Compound 6 and then characterized by western blot analysis.
Cell culture and UV cross-linking.
K20 cells were cultured in RPMI/Nutridoma SP (Roche) and 10 mM HEPES. Medium
was further supplemented with 3 mM 9-AAz-NeuAc, NeuAc or ManNAc for 18 h. K88
cells were cultured in RPMI/10% FCS and 10 mM HEPES. Cells were washed with PBS
to remove unincorporated NeuAc or derivatives to yield a single cell suspension and were
used for cross-linking or flow cytometry. For cross-linking, cells were divided into
aliquots (1−2 106 cells per ml in PBS) in either 12- or 6-well tissue-culture plates, crosslinked by exposure to a handheld 254-nM UV source 1.5 cm from the cells for 20 min
with agitation, then washed and lysed at 1 107 cells per ml in 50 mM Tris (pH 8.0), 150
mM NaCl, 5 mM EDTA and 1% Nonidet P-40 with a protease inhibitor cocktail
(Calbiochem).
Lectin staining and flow cytometry.
K20 or K88 cells (1 105 cells per 100 l) were stained with 1 g of fluorescein
isothiocyanate (FITC)-labeled SNA (Vector Labs) for 30 min on ice before analysis by
flow cytometry. Alternatively, 8 g of CD22-Fc chimera was precomplexed with 4 g of
FITC-labeled anti−human IgG (Fc-specific) in 20 l for 15 min, and 10 l of the
complex was added to K20 cells as above. Cell-surface azide reactivity was detected by
means of the Staudinger-Bertozzi ligation with a triphenylphosphine-biotin probe
(Compound 5). In short, cells were resuspended in 400 l of PBS containing 5 mg ml-1 of
BSA and 1 mM Compound 5 and allowed to react for 1 h on ice. Cells were then washed
with PBS/BSA twice, and incorporated biotin was detected with FITC-conjugated
streptavidin (Jackson Immunoresearch Labs, 1 g of streptavidin-FITC per 100 l).
Western blotting and immunoprecipitations.
Precleared lysates (1 ml) were incubated overnight at 4 °C with end-over-end rotation
with 5 g of anti-CD22 or anti-Myc, followed by two additional hours with protein
A−Sepharose. Alternatively, 25 l of anti-Flag M2 affinity agarose was added to lysates
and incubated overnight. Pellets were washed three times with lysis buffer, eluted with 2
Bis-Tris sample buffer (Invitrogen), resolved on 10% NuPAGE gels, transferred to
nitrocellulose and blocked with 10% milk in TBS with 0.05% Tween-20 (TTBS). Blots
were probed with the indicated antibodies diluted in 10% milk/TTBS and visualized with
chemiluminescence. For reprobing, blots were stripped by incubation in 10 mM Tris and
150 mM NaCl (pH 2.3) at 60 °C for 30 min, washed extensively with TTBS, and blocked
again as above.
Surface biotinylation and CD22-Fc immunoprecipitations.
K88 cells or K20 cells cultured with or without 3 mM ManNAc, NeuAc or 9-AAzNeuAc for 18 h were biotinylated (2.5 107 cells per ml in PBS (pH 8.0), 0.5 mg ml-1
sulfo-NHS-biotin (Pierce)) for 30 min at room temperature with end-over-end rotation,
washed three times with cold PBS, and lysed as above. CD22-Fc chimera (20 g) was
incubated with lysate (0.5 ml, 10 106 cells per ml) overnight at 4 °C with end-over-end
rotation. Protein A−Sepharose beads were added for an additional 2 h, pelleted, washed,
eluted and subjected to western blot analysis as above. Alternatively, SNA-agarose beads
(20 l) were incubated overnight at 4 °C with end-over-end rotation, pelleted, washed,
eluted and subjected to western blot analysis as above.
Transfection of K20 cells with CD22-Flag and CD22-Myc.
Full-length CD22 was cloned from human peripheral B-cell mRNA with the sense
primer 5'- ACCCAGATCTGACACCATGCATCTC-3' and antisense primer 5'CCATGTCGACTCAATGTTTGAGGATCAC-3'. The PCR product was purified and
subcloned into pCR-Blunt II-TOPO (Invitrogen). The C-terminal end of CD22 was
modified to contain the FLAG or Myc epitope with CD22-FLAG antisense primer 5'CTACTTGTCATCGTCGTCCTTGTAATCCGCATGTTTGAGGATCACATAGTC-3'
or CD22-Myc antisense primer 5'CTACAGATCCTCTTCTGAGATGAGTTTTTGTTCCGCATGTTTGAGGATCACAT
AGTC-3', and each construct was subcloned into pcDNA3.1 (Invitrogen). K20 (6 106)
cells were suspended in 200 l OptiMEM (Invitrogen) together with 4−8 g of DNA in
PBS before being electroporated at 600 V, 360 , 75 F resulting in a 0.5 ms pulse
(Electro cell manipulator 600, BTX electroporation system). Cells were cultured for 1 h
before addition of NeuAc or 9-AAz-NeuAc as described. Expression of the recombinant
CD22 molecules was estimated by western blot to increase the total amount of CD22 by
about two-fold.
Accession code.
BIND identifier (http://bind.ca/): 295632.
Note: Supplementary information is available on the Nature Chemical Biology website.
Top of page
Acknowledgments
We wish to thank M. Pawlita for the K20 cell line, A. Varki for the plasmid encoding for
CD22-Fc plasmid, O. Blixt for the Gal 1-4GlcNAc -Lc-Lc-biotin, H. Li and M. Iufer
for expert technical assistance, L.K. Allin for preparation of enzymes used in synthesis,
and A. Tran-Crie for assistance in manuscript preparation. This work was funded by the
US National Institutes of Health grants GM60938 and AI050143 and a Wenner-Gren
Foundation fellowship to P.B.
Competing interests
The authors declare that they have no competing financial interests.
Top of page
References
1. Cyster, J.G. & Goodnow, C.C. Tuning antigen receptor signaling by CD22:
integrating cues from antigens and the microenvironment. Immunity 6, 509–517
(1997). | Article |
2. Powell, L.D., Jain, R.K., Matta, K.L., Sabesan, S. & Varki, A. Characterization of
sialyloligosaccharide binding by recombinant soluble and native cell-associated
CD22. Evidence for a minimal structural recognition motif and the potential
importance of multisite binding. J. Biol. Chem. 270, 7523–7532 (1995). | Article |
3. Razi, N. & Varki, A. Masking and unmasking of the sialic acid-binding lectin
activity of CD22 (Siglec-2) on B lymphocytes. Proc. Natl. Acad. Sci. USA 95,
7469–7474 (1998). | Article |
4. Jin, L., McLean, P.A., Neel, B.G. & Wortis, H.H. Sialic acid binding domains of
CD22 are required for negative regulation of B cell receptor signaling. J. Exp.
Med. 195, 1199–1205 (2002). | Article |
5. Kelm, S., Gerlach, J., Brossmer, R., Danzer, C.P. & Nitschke, L. The ligandbinding domain of CD22 is needed for inhibition of the B cell receptor signal, as
demonstrated by a novel human CD22-specific inhibitor compound. J. Exp. Med.
195, 1207–1213 (2002). | Article |
6. Poe, J.C. et al. CD22 regulates B lymphocyte function in vivo through both
ligand-dependent and ligand-independent mechanisms. Nat. Immunol. 5, 1078–
1087 (2004). | Article |
7. Sgroi, D., Varki, A., Braesch-Andersen, S. & Stamenkovic, I. CD22, a B cellspecific immunoglobulin superfamily member, is a sialic acid-binding lectin. J.
Biol. Chem. 268, 7011–7018 (1993).
8. Hanasaki, K., Powell, L.D. & Varki, A. Binding of human plasma
sialoglycoproteins by the B cell-specific lectin CD22. Selective recognition of
immunoglobulin M and haptoglobin. J. Biol. Chem. 270, 7543–7550
(1995). | Article |
9. Zhang, M. & Varki, A. Cell surface sialic acids do not affect primary CD22
interactions with CD45 and surface IgM nor the rate of constitutive CD22
endocytosis. Glycobiology 14, 939–949 (2004). | Article |
10. Oetke, C. et al. Versatile biosynthetic engineering of sialic acid in living cells
using synthetic sialic acid analogues. J. Biol. Chem. 277, 6688–6695
(2002). | Article |
11. Luchansky, S.J., Goon, S. & Bertozzi, C.R. Expanding the diversity of unnatural
cell-surface sialic acids. ChemBioChem 5, 371–374 (2004). | Article |
12. Shapiro, R.E. et al. Identification of a ganglioside recognition domain of tetanus
toxin using a novel ganglioside photoaffinity ligand. J. Biol. Chem. 272, 30380–
30386 (1997). | Article |
13. Zaccai, N.R. et al. Structure-guided design of sialic acid-based Siglec inhibitors
and crystallographic analysis in complex with sialoadhesin. Structure 11, 557–
567 (2003). | Article |
14. Keppler, O.T. et al. UDP-GlcNAc 2-epimerase: a regulator of cell surface
sialylation. Science 284, 1372–1376 (1999). | Article |
15. Saxon, E. & Bertozzi, C.R. Cell surface engineering by a modified Staudinger
reaction. Science 287, 2007–2010 (2000). | Article |
16. Law, C.L., Aruffo, A., Chandran, K.A., Doty, R.T. & Clark, E.A. Ig domains 1
and 2 of murine CD22 constitute the ligand-binding domain and bind multiple
sialylated ligands expressed on B and T cells. J. Immunol. 155, 3368–3376
(1995).
17. Greer, S.F. & Justement, L.B. CD45 regulates tyrosine phosphorylation of CD22
and its association with the protein tyrosine phosphatase SHP-1. J. Immunol. 162,
5278–5286 (1999).
18. Fujimoto, M., Bradney, A.P., Poe, J.C., Steeber, D.A. & Tedder, T.F. Modulation
of B lymphocyte antigen receptor signal transduction by a CD19/CD22 regulatory
loop. Immunity 11, 191–200 (1999). | Article |
19. Chen, J. et al. CD22 attenuates calcium signaling by potentiating plasma
membrane calcium-ATPase activity. Nat. Immunol. 5, 651–657 (2004). | Article |
20. D'Arena, G. et al. Flow cytometric characterization of human umbilical cord
blood lymphocytes: immunophenotypic features. Haematologica 83, 197–203
(1998).
21. D'Arena, G. et al. Quantitative flow cytometry for the differential diagnosis of
leukemic B-cell chronic lymphoproliferative disorders. Am. J. Hematol. 64, 275–
281 (2000). | Article |
22. Borowitz, M.J. et al. Prognostic significance of fluorescence intensity of surface
marker expression in childhood B-precursor acute lymphoblastic leukemia. A
Pediatric Oncology Group Study. Blood 89, 3960–3966 (1997).
23. Sgroi, D., Nocks, A. & Stamenkovic, I. A single N-linked glycosylation site is
implicated in the regulation of ligand recognition by the I-type lectins CD22 and
CD33. J. Biol. Chem. 271, 18803–18809 (1996). | Article |
24. Braesch-Andersen, S. & Stamenkovic, I. Sialylation of the B lymphocyte
molecule CD22 by alpha 2,6-sialyltransferase is implicated in the regulation of
CD22-mediated adhesion. J. Biol. Chem. 269, 11783–11786 (1994).
25. Hennet, T., Chui, D., Paulson, J.C. & Marth, J.D. Immune regulation by the
ST6Gal sialyltransferase. Proc. Natl. Acad. Sci. USA 95, 4504–4509
(1998). | Article |
26. John, B. et al. The B cell coreceptor CD22 associates with AP50, a clathrincoated pit adapter protein, via tyrosine-dependent interaction. J. Immunol. 170,
3534–3543 (2003).
27. Xu, Z. & Weiss, A. Negative regulation of CD45 by differential
homodimerization of the alternatively spliced isoforms. Nat. Immunol. 3, 764–771
(2002). | Article |
28. Lanoue, A., Batista, F.D., Stewart, M. & Neuberger, M.S. Interaction of CD22
with 2,6-linked sialoglycoconjugates: innate recognition of self to dampen B cell
autoreactivity? Eur. J. Immunol. 32, 348–355 (2002). | Article |
29. Collins, B.E. et al. Masking of CD22 by cis ligands does not prevent
redistribution of CD22 to sites of cell contact. Proc. Natl. Acad. Sci. USA 101,
6104–6109 (2004). | Article |
30. Crocker, P.R. Siglecs: sialic-acid-binding immunoglobulin-like lectins in cell-cell
interactions and signalling. Curr. Opin. Struct. Biol. 12, 609–615
(2002). | Article |
Top of page
1. Departments of Molecular Biology and Molecular and Experimental Medicine,
The Scripps Research Institute, 10550 North Torrey Pines Road, MEM-L71, La
Jolla, California 92037, USA.
2. Both authors contributed equally to this work.
3. Email: jpaulson@scripps.edu
Correspondence to: James C Paulson1 Email: jpaulson@scripps.edu
Strategy for metabolic incorporation of 9-AAz-NeuAc into cell-surface glycoproteins.
Synthesis of 9-AAz-NeuAc (4).
Azide reactivity on the cell surface determined by the Staudinger-Bertozzi ligation
(incorporation of a biotin group).
Chemoenzymatic synthesis of 9-AAz-NeuAc- (2-6)-Gal- (1-4)-GlcNAc- -Lc-Lc-biotin
(6).
(a) K88 cells (red bold), K20 cells (gray shaded) and K20 cells cultured with 3 mM
NeuAc (black thin) or 9-AAz-NeuAc (blue bold), stained with CD22-Fc chimera and
FITC-labeled anti−human IgG (Fc specific) or FITC-labeled SNA to detect incorporated
NeuAc or 9-AAz-NeuAc. (b) K20 cells cultured with 3 mM NeuAc (black thin), 9-AAzNeuAc (blue bold) or no added sugar (gray shaded), then reacted with
triphenylphosphine-biotin; incorporated biotin was detected with FITC-streptavidin.
(a) Western blot analysis to detect UV-induced cross-linking of 9-AAz-NeuAc- (2-6)Gal- (1-4)-GlcNAc- -Lc-Lc-biotin to CD22-Fc in vitro. (b) In situ cross-linking of
CD22. Western blot analysis of CD22 from K20 cells cultured with or without exogenous
NeuAc or 9-AAz-NeuAc for 18 h and exposed to UV light to induce cross-linking. (c)
Western blot analysis of CD22 from K20 cells cultured with or without 9-AAz-NeuAc or
NeuAc for the indicated time, and then exposed to UV light.
(a) Streptavidin-HRP immunoblotting for proteins 'immunoprecipitated' with CD22-Fc or
SNA-agarose in a sialic acid−dependent manner from K88 cells or K20 cells cultured
exogenous NeuAc, 9-AAz-NeuAc, or ManNAc, then surface biotinylated. (b)
Immunoblotting for CD45 and CD19 in total lysate or CD22-Fc immunoprecipitants
from cells treated as in a. (c) Immunoblotting for CD22, CD45, IgM and PMCA after
CD22 immunoprecipitation of cross-linked lysates from K20 cells with or without NeuAc
or 9-AAz-NeuAc and UV light to induce cross-linking. (d) Differential recognition of
glycoproteins by CD22 in vitro as compared with in situ, possibly driven by microdomain
localization or spatial juxtaposition.
K20 cells transfected with CD22-Flag, CD22-Myc or both, cultured in the presence of
exogenous NeuAc or 9-AAz-NeuAc and exposed to UV light to induce cross-linking.
Western blot analysis for Myc- and Flag-tags. Lysates were immunoprecipitated with
anti-Flag M2 agarose.