Laboratory protocols
DNA extractions
Total Plant DNA was isolated from 40mg of ground dried leaf material, using the CTAB extraction procedure described in Dumolin et al.
(1995). DNA concentrations were estimated and standardised against known concentrations of λ DNA on 1.5% agarose gels.
Sequencing of the matK region
The matK gene was PCR-amplified as described in Robinson et al. (2001) using primers developed by Sang et al. (1997) and Dendauw et al.
(2002), with modifications to the PCR programme (Dendauw et al. 2002): 10 min at 95°C, 5 cycles of 1 min at 95°C, 30 s at 53°C, 1 min at
72°C, 35 cycles of 30 s at 95°C, 1 min at 53°C, 75 s at 72°C and finally 7 min at 72°C. The amplifications were carried out in a Perkin Elmer
Geneamp PCR system PE9600 or PE9700. In order to sequence the complete gene, new primers were developed using Primer Express v 2.0.0,
Applied Biosystems. In addition, two primers developed for sequencing the matK gene in Azalea were used (Dendauw et al. 2002). This resulted
in three primer pairs that together amplified the complete Malus matK gene. PCR products were checked for homogeneity on agarose gels and
directly sequenced, using the PCR primers as sequencing primers (forward and reverse) and the ABI Prism BigDye Terminator cycle
Sequencing kit (Applied Biosystems) according to manufacturer’s protocols. Sequencing reactions were analyzed on an ABI Prism 377 DNA
Sequencer (Applied Biosystems).
Primers used for amplification and sequencing of the matK region.
Primer pair Forward primer(start position bp)/
1
Sequence forward primer/
Length fragment
Reverse primer(start position (bp)
Sequence reverse primer
amplified (bp)
P1F1 (0)
CTGTATCGCACTATGTATCA
3
1RNL1A (643)
2
3
CTTCGCTATTGGGTGAAAGATCC
3
4FDR153R (1069)
AATTTTCTAGCATTTGACCCCG
3MF2 (992)
GTGGTCTCAACCAAGAAGG
2
trnK2R (1802)
1
GGAGGCAAGAATAATCGTGGAT
3
1FWNL1B (551)
AACTAGTCGGATGGAGTAG
2
643
: from Sang et al. 1997; : from Dendauw et al. 2002; 3: developed in this study.
518
776
Marker development
In order to detect the presence of duplication II using a simple PCR assay, we developed a new primer ‘matKdupF’ (5’ATAGAGGTCGAATTTGGTATTTGGAT-3’). The fragment containing duplication II was amplified with this newly developed primer and
primer trnK2R, using the reaction conditions described above. DNA-fragments were separated on an electrophoresis apparatus model Protean®
IIxiCell of BIO-RAD, using a 1-Kb ladder (Invitrogen) as molecular weight marker. Fragment separation was carried out on 1.5 mm thick, 8%
polyacrylamide gels (Protogel, National Diagnostics). Gels were run for 4 h at 300 V and stained with ethidium bromide.
To type the transversion at position 338, we developed a simple assay. The first part of the matK gene was amplified with primers P1F and
1RNL1A. When a G is present at position 338, a recognition site for the restriction enzyme Hpy99I is formed. For each genotype, 7 µl of PCR
product were mixed with 0.25 µl Hpy99I enzyme (New England biolabs), 1 µl restriction buffer, 0.1 µl BSA and 0.4 µl MQ H 2O and kept at
37°C for 3 hours and 65°C for 20 minutes. The reaction mixture was loaded on 1.5% agarose gels, run for 1 h at 220 V and stained with
ethidium bromide. The genotypes were scored as mutation absent (one fragment of 643 bp) or mutation present (one fragment of 338 bp and one
fragment of 305 bp).
Haplotyping of chloroplast genome with PCR-RFLP markers
PCR amplification of cpDNA regions was performed in 25 µl of a reaction mixture containing 0.2 µM of each primer, 200 µM of each of the
four dNTPs, 1.0 U Taq DNA polymerase (GeneAmp PCR Reagent Kit, Applied Biosystems), 1x PCR buffer and 25ng of genomic DNA. An
ABI GeneAmp PCR 9700 system was used, with the following cycling conditions: an initial step of 4 min at 94°C, followed by 30 cycles with
45 s at 92°C, 45 s at Tan (see original publications) and 3 min at 72°C, and a final elongation step of 10 min at 72°C. PCR amplification was
checked on agarose gels as described above. Seven µl of PCR product were restricted in a volume of 20 µl containing 10 U of restriction enzyme
following the manufacturer’s instructions (Invitrogen). Restriction fragments were separated on 8% polyacrylamide gels as described above and
stained with ethidium bromide to visualise restriction polymorphisms. Examples of the restriction patterns obtained are shown in figures S1 and
S2.