Yamamoto et al., Particle size distributions and seasonal diversity of allergenic and pathogenic fungi in outdoor air Supplementary Figure 1 Rarefaction curves of observed fungal OTUs by particle aerodynamic diameter (da) and season. OTUs are based on 97% similarity. Supplementary Figure 2 Relative abundances of allergenic and infectious pathogenic fungal species by season. The allergenic (in red) and pathogenic (underlined) species are defined as those listed in Supplementary Tables 3 and 4, respectively. S1 Yamamoto et al., Particle size distributions and seasonal diversity of allergenic and pathogenic fungi in outdoor air Supplementary Figure 3 Relative abundances of known allergenic and pathogenic species in each major fungal genus. The abundances are averaged over all particle sizes and seasons. The allergenic (in red) and infectious pathogenic (underlined) species are defined based on the lists of allergenic and pathogenic fungi in Supplementary Tables 3 and 4, respectively. S2 Yamamoto et al., Particle size distributions and seasonal diversity of allergenic and pathogenic fungi in outdoor air Supplemental Table 1 Summary statistics of meteorological conditions Spring Summer Fall Winter 15:30 10:45 11:00 11:00 May 13, 2009 Aug 11, 2009 Oct 15, 2009 Jan 14, 2010 End 10:30 10:30 11:00 10:30 Jun 10, 2009 Sep 8, 2009 Nov 12, 2009 Feb 11, 2010 a Temperature (C°) Mean 16 23 10 0 Max. of daily average 21 28 17 8 Min. of daily average 12 17 4 -9 Max. of hourly average 28 32 21 13 Min. of hourly average 5 12 -3 -13 Relative humidity (%) a Mean 72 75 74 63 Max. of daily average 95 89 92 93 Min. of daily average 47 59 48 39 Max. of hourly average 100 97 100 100 Min. of hourly average 24 37 36 24 a Wind velocity (m/sec) Mean 2.4 2.2 3.2 3.3 Max. of daily average 4.0 4.6 7.0 7.0 Min. of daily average 1.0 0.8 0.2 0.9 Max. of 5 second speed 14.3 11.6 16.1 24.1 Max. of 2 minute speed 10.7 9.4 12.5 17.0 a Precipitation (mm/day) Mean 3.59 1.09 4.17 1.51 a The original data were obtained from the National Climatic Data Center of the National Oceanic and Atmospheric Administration (http://www.ncdc.noaa.gov/oa/ncdc.html). The data obtained at the Tweed New Haven Airport Station (41°15'50"N 72°53'12"W) were used. Sampling period Start S3 Yamamoto et al., Particle size distributions and seasonal diversity of allergenic and pathogenic fungi in outdoor air Supplemental Table 2 Sequences of primers and probes used for qPCR assays Assay name Fungal species Aaltr a Alternaria alternata Afumi a Aspergillus fumigatus, Neosartorya fischeri Cclad2 a Cladosporium cladosporioides, svar. 2 Enigr a Epicoccum nigrum PenGrp3 a Penicillium chrysogenum / griseofulvum / glandicola /coprophilum /expansum and Eupenicillium Universal Penicillium, Aspergillus and Paecilomyces varioti PenAsp1mgb a ITS1F/ITS4 b a b Universal fungi Primer (probe) name AaltrF1 AltrR1-1 AaltrP1 AfumiF1 AfumiR1 AfumiP1 Cclad2F1 CcladR1 CcladP1 EnigrF1 EnigrR1 EnigrP1 PchryF1 PchryR1-1 PenP2 PenAspF1 PenAspR1 PenAspP1mgb ITS1F ITS4 Sequence 5’-3’ Method GGCGGGCTGGAACCTC GCAATTACAAAAGGTTTATGTTTGTCGTA TTACAGCCTTGCTGAATTATTCACCCTTGTCTTT GCCCGCCGTTTCGAC CCGTTGTTGAAAGTTTTAACTGATTAC CCCGCCGAAGACCCCAACATG TACAAGTGACCCCGGCTACG CCCCGGAGGCAACAGAG CCGGGATGTTCATAACCCTTTGTTGTCC TTGTAGACTTCGGTCTGCTACCTCTT TGCAACTGCAAAGGGTTTGAAT CATGTCTTTTGAGTACCTTCGTTTCCTCGGC CGGGCCCGCCTTAAC GAAAGTTTTAAATAATTTATATTTTCACTCAGAGTA CGCGCCCGCCGAAGACA CGGAAGGATCATTACTGAGTG GCCCGCCGAAGCAAC CCAACCTCCCACCCGTG Adaptor A-Key-MID-CTTGGTCATTTAGAGGAAGTAA Adaptor B-Key-TCCTCCGCTTATTGATATGC TaqMan Haugland and Vesper (2002). Larena et al. (1999); Manter and Vivanco, (2007). S4 TaqMan TaqMan TaqMan TaqMan TaqMan Pyrosequencing Yamamoto et al., Particle size distributions and seasonal diversity of allergenic and pathogenic fungi in outdoor air Supplemental Table 3 List of allergenic fungi (Simon-Nobbe et al., 2008) Allergenic fungi ASCOMYCOTA Alternaria alternata Alternaria argyranthemi Alternaria brassicicola Alternaria blumeae Alternaria brassicae Alternaria capsici Alternaria carotiincultae Alternaria cetera Alternaria cheiranthi Alternaria cinerariae Alternaria conjuncta Alternaria crassa Alternaria cucumerina Alternaria dauci Alternaria dumosa Alternaria eryngii Alternaria ethzedia Alternaria euphorbiicola Alternaria japonica Alternaria limoniasperae Alternaria longipes Alternaria macrospora Alternaria metachromatica Alternaria mimicula Alternaria mouchaccae Alternaria oregonensis Alternaria petroselini Alternaria photistica Alternaria porri Alternaria pseudorostrata Alternaria radicina Alternaria solani Alternaria smyrnii Alternaria sonchi Alternaria tagetica Alternaria tenuissima Aspergillus flavus Aspergillus fumigatus Aspergillus nidulans Aspergillus niger Aspergillus oryzae Beauveria bassiana Candida albicans Candida boidinii Cladosporium herbarum Cladosporium cladosporioides Curvularia lunata Embellisia allii Embellisia indefessa Embellisia novae-zelandiae Embellisia telluster Epicoccum purpurascens Epicoccum nigrum Fusarium culmorum Fusarium solani Nimbya caricis Penicillium brevicompactum S5 Penicillium chrysogenum Penicillium notatum Penicillium citrinum Penicillium oxalicum Pleospora herbarum Stemphylium botryosum Saccharomyces cerevisiae Stachybotrys chartarum Stemphylium callistephi Stemphylium vesicarium Thermomyces lanuginosus Trichophyton mentagrophytes Trichophyton rubrum Trichophyton schoenleinii Trichophyton tonsurans Ulocladium alternariae Ulocladium atrum Ulocladium botrytis Ulocladium chartarum Ulocladium cucurbitae BASIDIOMYCOTA Coprinus comatus Malassezia furfur Malassezia sympodialis Psilocybe cubensis Rhodotorula mucilaginosa Yamamoto et al., Particle size distributions and seasonal diversity of allergenic and pathogenic fungi in outdoor air Supplemental Table 4 List of pathogenic fungi (Makimura, 2001) Pathogenic fungi a ASCOMYCOTA Issatschenkia orientalis Cryptococcus neoformans Ajellomyces capsulatus Madurella grisae Filobasidiella neoformans Ajellomyces dermatitidis Microsporum canis Schizophyllum commune Arthroderma benhamiae Microsporum fulvum Trichosporon asahii Arthroderma fulvum Microsporum gypseum Trichosporon cutaneum Arthroderma gypseum Nectria haematococca Trichosporon inkin Arthroderma incurvatum Paecilomyces variotii Trichosporon mucoides Arthroderma otae Paracoccidioides brasiliensis Arthroderma vanbreuseghemii Penicillium marneffei ZYGOMYCOTA Aspergillus flavus Pichia anomala Absidia corymbifera Aspergillus fumigatus Pichia guilliermondii Cunninghamella sp. Aspergillus niger Pneumocystis carinii Mucor circinelloides Blastomyces dermatitidis Pseudallescheria boydii Rhizopus oryzae Candida albicans Scedosporium apiospermum Candida glabrata Sporothrix schenckii Candida guilliermondii Trichophyton mentagrophytes Candida krusei Trichophyton rubrum Candida parapsilosis Trichophyton verrucosum Candida tropicalis Trichophyton violaceum Candida pelliculosa Cladophialophora carrionii BASIDIOMYCOTA Coccidioides immitis Malassezia furfur Epidermophyton floccosum Malassezia globosa Exophiala dermatitidis Malassezia obtusa Fonsecaea pedrosoi Malassezia pachydermatis Fusarium solani Malassezia restricta Geotrichum candidum Malassezia slooffiae Histoplasma capsulatum Malassezia sympodialis Hortaea werneckii Rhodotorula rubra a The fungal species are selected from the Alphabetical List of Pathogenic Fungi ver.1.2.7. in Pathogenic Fungi Database ver. 1.9.6.1 (http://timm.main.teikyo-u.ac.jp/pfdb/cover/alphabetical_list.html). S6 Yamamoto et al., Particle size distributions and seasonal diversity of allergenic and pathogenic fungi in outdoor air Supplemental Table 5 Summary statistics of fungi ITS sequences Season Aerodynamic Number of Number of sequences determined to each taxonomic level (no. of taxa identified) diameter, da (μm) sequences Phylum Class a Order a Genus Species Spring >9.0 831 824 (2) 724 (11) 658 (34) 556 (119) 476 (145) 5.8-9.0 766 766 (2) 718 (11) 698 (29) 584 (105) 542 (144) 4.7-5.8 739 737 (2) 696 (11) 676 (28) 610 (100) 576 (132) 3.3-4.7 677 677 (2) 662 (7) 595 (21) 547 (81) 510 (102) 2.1-3.3 433 433 (2) 420 (7) 351 (15) 319 (64) 296 (80) Summer >9.0 664 664 (2) 658 (9) 651 (20) 588 (54) 535 (68) 5.8-9.0 918 918 (2) 906 (13) 881 (34) 737 (149) 633 (186) 4.7-5.8 955 948 (2) 934 (12) 916 (32) 780 (151) 689 (203) 3.3-4.7 518 517 (2) 515 (8) 494 (22) 423 (106) 372 (137) 2.1-3.3 315 315 (2) 314 (8) 291 (17) 268 (79) 237 (99) Fall >9.0 875 874 (2) 840 (10) 712 (27) 661 (100) 522 (127) 5.8-9.0 749 739 (2) 703 (10) 655 (32) 587 (142) 465 (201) 4.7-5.8 501 500 (2) 485 (10) 475 (28) 439 (121) 384 (168) 3.3-4.7 777 774 (2) 762 (11) 751 (26) 729 (124) 627 (180) 2.1-3.3 311 310 (2) 309 (7) 299 (15) 294 (56) 280 (64) Winter >9.0 487 482 (2) 454 (10) 423 (34) 363 (101) 306 (138) 5.8-9.0 916 914 (2) 817 (10) 802 (35) 764 (130) 665 (174) 4.7-5.8 2062 2062(2) 1983 (12) 1970 (26) 1895 (68) 1593 (90) 3.3-4.7 893 893 (2) 885 (8) 866 (26) 837 (76) 742 (101) 2.1-3.3 939 938 (2) 935 (9) 897 (19) 883 (63) 830 (77) Total 15326 15285 (2) 14720 (19) 14061 (68) 12864 (558) 11280 (1172) a Fungi that are categorized as incertae sedis at these taxonomic levels are excluded from counting the numbers of identified taxa. S7 Yamamoto et al., Particle size distributions and seasonal diversity of allergenic and pathogenic fungi in outdoor air Supplemental Table 7 Diversity parameters for sampled atmospheric fungi based on 97% OTU similarity Season Spring Summer Fall Winter Aerodynamic diameter, da (μm) > 9.0 5.8-9.0 4.7-5.8 3.3-4.7 2.1-3.3 > 9.0 5.8-9.0 4.7-5.8 3.3-4.7 2.1-3.3 > 9.0 5.8-9.0 4.7-5.8 3.3-4.7 2.1-3.3 > 9.0 5.8-9.0 4.7-5.8 3.3-4.7 2.1-3.3 Number of observed OTUs 336 300 368 374 173 203 385 544 268 194 256 359 280 545 195 185 418 350 283 358 S8 Chao1 Shannon index 2387 1686 1983 1942 908 746 2482 4273 2662 2044 5157 3320 1650 3579 1010 892 1563 808 1086 1117 6.7 7.4 7.6 7.7 6.7 6.0 6.9 8.0 7.0 7.1 5.2 6.8 7.4 8.7 7.4 6.8 7.7 6.0 7.1 7.5 Yamamoto et al., Particle size distributions and seasonal diversity of allergenic and pathogenic fungi in outdoor air Supplementary References Haugland R, Vesper S (2002). Method of identifying and quantifying specific fungi and bacteria. U.S. Environmental Protection Agency: USA. Larena I, Salazar O, Gonzalez V, Julian MC, Rubio V (1999). Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. J Biotechnol 75: 187-194. Makimura K (2001). Alphabetical List of Pathogenic Fungi Ver.1.2.7. Pathogenic Fungi Database (PFDB) Ver. 1.9.6.1. Manter DK, Vivanco JM (2007). Use of the ITS primers, ITS1F and ITS4, to characterize fungal abundance and diversity in mixed-template samples by qPCR and length heterogeneity analysis. J Microbiol Meth 71: 7-14. Simon-Nobbe B, Denk U, Poll V, Rid R, Breitenbach M (2008). The spectrum of fungal allergy. Int Arch Allergy Immunol 145: 58-86. S9