Chromosomes – Genes – DNA
Instructions and Blue Prints to Who We Are
Organism ← Cell ← Nucleus ← Chromosomes ← Genes ← DNA
http://gs lc.genetics.utah.edu
Chromosomes – In the nucleus of each ____________, the DNA
is packed into thread-like structures called chromosomes. The
chromosomes contain genetic information that controls ________.
Figure 1.4: Diagram of a human cell
Each chromosome is made up of ___________ tightly coiled
many times around proteins. Humans have _________
chromosomes that come in _________ pairs. A mother passes 23
chromosomes to her child through her _________ and a father
passes _______________ chromosomes through his sperm. DNA
works by ___________________ information chemically in its
structure. The chemical information contains instructions for the
body to create ______________. In more detail it provides the
instructions to make proteins which allows for the
___________________ and development of an organism. Also it
can make _______________ of itself that has the exact same
instructions to build a new organism.
DNA (Deoxyribonucleic Acid) – When organisms reproduce,
_________________ are passed from parent to parent to
____________________. These traits are carried in ___________,
the genetic material found in ____________________ located in
the cell’s nucleus. ______________ acts like a blueprint for the
cells of an organism, instructing them how to put together
materials to produce certain ____________. DNA is a large
molecule with a shape similar to a twisted _____________
(double helix). The ends are joined to form a continuous loop, like
a rubber band.
Rungs of ladder base pairs
The DNA’s twisted-zipper or ladder shape is because of the ________________ called nucleotides. A _________________ is
a molecule made up of a nitrogen base, a sugar, and a phosphate
group. The sides or backbone of the zipper or ladder are made up
of ________________and______________.
The rungs or steps of the zipper or ladder are made up of
_________________ called nitrogen bases. The rungs or steps of
the zipper or ladder are made up of four nitrogen bases called
adenine, thymine, guanine, and cytosine. These bases always pair
up so that adenine is joined with a thymine (_________) and
cytosine is joined with guanine (_____________). It is the
arrangement of these nitrogen base pairs that determine whether
the organism is a rose, hawk, fly, or human.
Only 2 percent of your DNA determines everything from your eye
______________ to what diseases you might be easy for you to
get. The other 98% (junk DNA) is largely a mystery to what the
job of these DNA molecules do. The total sum of all your
hereditary information is called the genome. There are a total of
approximately 3 billion __________ pairs in the human genome.
For humans 99.9% of the base pairs are the same and 0.1% is
different. This 0.1 percent makes every person a little bit
___________________.
An important property of DNA is that it can replicate, or make
______________ of itself. This is important when cells divide
because each new cell needs to have an exact copy of
________________ present in the old cell.
http://teach.genetics.utah.edu/content/
Genes – A gene is a section on a chromosome that has genetic
information in the form of _________ for one _________. The
DNA making up the ________________ is usually coiled up
tightly. If we imagine it stretched out, it would look like beads on a
string. Each of these beads is called a ____________. Each gene is
located at a definite place on the _____________________.
Figure 1.3. Chromosomes are like strings of genes
Genes, which are made up of_____________, act as
__________________ to make or synthesis molecules called
proteins. In humans genes vary in size from a few hundred DNA
bases to more than 2 million bases. Humans have between 20,000
and 25,000 genes which are located in the chromosomes.
Genes control and determine ___________ and direct the
production of ________________. Proteins are very important
molecules in our______________. They are involved in virtually
all cell functions. Each different protein within the body has a
specific function or ___________. Some proteins are involved in
structural support, while others are involved in bodily movement,
or in defense against germs. For an example imagine a cat with
white and black fur. The genes in the nuclei of this cat’s cells
direct the production or synthesis of _________________ that
cause black or white fur to grow on certain parts of the body.
Your genes are like switches that turn ______ or _________.
Some ______________ turn on, others are always ___________,
and still others turn ______ and ___________. An example is the
gene that determines neck size. This special gene is carried by
many different __________________________. Both a giraffe and
mouse have this same gene but in the giraffe it is turned on for a
__________________ time than in a mouse.
The end result is that the giraffe has a _____________ neck and
the mouse has a ________________ neck. Like chromosomes
every person has ___________ copies of each gene, one inherited
from each __________________. Most genes are the same in all
people, but a small number of genes (less than 1 percent of the
total) are slightly different between people.
Another place in the cell where DNA is found is in very small compartments
called mitochondria that are found randomly scattered in the cytoplasm
outside the nucleus. The mitochondria are the energy centers of the cell.
Mitochondrion contains genes too, although the mitochondria DNA is in one
long string of genes and is not arranged as _______________________.
“Simplified explanation of how DNA, Genes, and Chromosomes
relate to each other.”
 In simple terms think of the strands of _______ as letters –
ATCGGCTAATATCGCGGCGCGCATCGAT
 The letters combine to form __________.
ATCG GCTAAT ATCG CGGCGC GCAT CGAT
 These words make sentences –
(ATCG GCTAAT ATCG.) (CGGCGC GCAT CGAT.)
These “sentences” are called____________. Each gene will read the
arrangement of the DNA “sentence” in it which will then tell the cell to
make a molecule called a_____________. The proteins will tell the cell to
perform a certain function or _________.
 __________________ are efficient storage units for the DNA that is
contained in the genes. For humans a chromosome can have hundreds of
genes. Each gene will read a different DNA “sentence” to produce a
different ____________ to do a different task or_________.
https://www.youtube.com/watch?v=_POdWsii7AI show cartoon of dna,
structure
http://www.pbs.org/wgbh/nova/body/cracking-your-geneticcode.html