SUPPORTING METHODS
Characterizing Dlk1+ E14.5 fetal liver cells by immunofluorescence
To confirm that Dlk1 positive cells in the E14.5 liver were hepatoblasts, we
performed co-staining with antibodies against Dlk1 and markers of other cell types
(Fig. S3A-D). Whole embryos were fixed in 4% PFA at 4oC overnight, embedded in
OCT, and cryosectioned to obtain 4-6µm thick sagittal sections. Sections were
post-fixed in 4% PFA, washed in PBS with 0.01% Tween-20, and blocked with 2%
BSA and 10% goat serum at room temperature for 90 minutes. Primary antibodies
against Dlk1 (MBL International, 1:400), Pref1/Dlk1 (Millipore, 1:600), HNF4
(Santa Cruz, 1:100), CD45 (eBioscience, 1:100), and CD31/PECAM (BD Bioscience,
1:150) were applied at room temperature for 60 minutes. Samples were washed five
times before applying the corresponding secondary antibodies (Alexa Fluor 488, or
Alexa Fluor 594 from Invitrogen, 1:1000), at room temperature for 60 minutes.
Samples were washed five times. Nuclei were visualized by DAPI. Slides were
mounted in DABCO, and imaged on a Zeiss Axioplan 3 inverted microscope. For
cytospins, cells were spun down onto glass slides at 3500 RPM for 5 minutes, fixed in
4% PFA for 10 minutes at room temperature, and the same antibody staining
procedure was followed.
Preparation and analysis of Dlk1+ E14.5 fetal liver cells
E14.5 fetal livers were manually dissected in cold PBS, pooled together, and
dissociated in PBS containing 2% FBS, 1μg/ml DNase, 0.4mM EDTA, 0.06%
collagenase, and 0.6U/ml dispase for an hour at 37oC. The resultant cell suspension
was washed three times and stained with a FITC-conjugated anti-Dlk1 antibody
(MBL International) for 30 minutes at 4oC. Cells were washed twice with PBS
containing 2% FBS, and stained with the viability dye PI. Dead and doublet cells were
excluded by flow cytometry, and FITC-positive cells were gated for isolation. To
assess purity of the sorted population, cells were re-analyzed through flow cytometry
to detect Dlk1 expression (Fig. S4A) or through immunofluorescent staining of
cytospins to detect expression of HNF4α or Ter119 (Fig. S4B, C).
Library preparation and processing
Total RNA was extracted using Trizol (Sigma). For library construction, RNA (1μg)
was ligated for 1h at 22° to a 3' adapter using a truncated T4 RNA ligase2 (NEB) The
3’ adapter, (5'-rAppATCTCGTATGCCGTCTTCTGCTTGT /ddC/-3’),
is an
adenylated, single-stranded DNA which ligates selectively to miRNA. An RNA 5'
adapter (5'-GUUCAGAGUUCUACAGUCCGACGAUC-3') was added using T4
RNA ligase (Ambion) at 37° for 1h. First strand cDNA was synthesized by using
Superscript
II
Reverse
Transcriptase
(Invitrogen)
with
the
primer
(5'-CAAGCAGAAGACGGCATACGAGAT-3'). cDNA templates were amplified for
15 cycles by using Phusion Hot Start High Fidelity DNA polymerase (NEB) with the
primers
(5'-AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3') and
(5'-CAAGCAGAAGACGGCATACGAGAT-3'). The miRNA fraction was size
selected, the quality was checked using the Agilent Bioanalyzer DNA1000 chip, and
quantified using the Qubit fluorometer (Invitrogen). Libraries were sequenced on an
Illumina GAIIx. Following sequencing and quality control (QC), 3’ and 5’ adapter
sequences were removed from the ends of the reads. Adapter dimers and, reads less
than 15bp were discarded. The trimmed reads were aligned to the NCBI37/mm9
reference genome using BWA (1) and reads mapping to more than 3 places were
eliminated.
Reads are annotated by using the databases and priorities listed in Table S6. If the
read has multiple mappings, the read is flagged and all of its miRNA annotations are
preserved. This ensures that annotation information is retained, allowing ambiguity to
be addressed in downstream analyses. For each sample, the reads that correspond to a
particular miRNAs are summed and normalized to a million miRNA-aligned reads.
K-means Clustering
The expression of each miRNA at a time point was divided by the sum of expresssion
across all three time points to generate a number between 0 and 1. To determine the
optimal cluster number for K-means analysis, the relative expression level of miRNAs
were subjected to a figure-of-merit test using the MeV program (2). The
figure-of-merit graph showed a plateau when K is equal to 13 and this value was
chosen for subsequent K-means clustering analysis using the K-means clustering
algorithm for 100 iterations (3). The resulted 13 groups of miRNAs were designated
as Clusters A-M.
Luciferase assay and Transient transfections
HEK293T was maintained in DMEM containing 10% FBS. Transfections were
performed using lipofectamine 2000 (Invitrogen). Firefly and Renilla activity was
measured with a Dual Luciferase Reporter Assay kit (Promega) and presented as
Firefly/Renilla ratio.
For 3’UTR luciferase assays, 200ng of reporter vector were co-trasfected with
600ng miRNA overexpression or knock-down vectors into 1×105 HEK293T cells.
Lysates were collected 48h after transfection for analysis. For 3TP-lux luciferase
assay, 200ng of reporter vector were co-trasfected with 20ng TK-Renilla and 600ng
miRNA overexpression or knock-down vectors into 1×105 HEK293T cells. 2ng/ml
TGFβ1 was supplemented the day after transfection. Lysates were collected 72h after
transfection for analysis. For 3TP-lux luciferase assay with overexpression of
TGFBR2 (wild type or dominant negative), 100ng of the reporter vector was
co-transfected with 10ng TK-Renilla, 600ng miRNA overexpression or knock-down
vectors, and 200ng TGFBR2 expression vectors into 1×105 HEK293T cells. 2ng/ml
TGFβ1 was supplemented the next day after transfection. Lysates were collected 48h
after transfection for analysis.
Western blotting
Protein extracts were separated on 10% SDS-polyacrylamide gels, transferred to
nitrocellulose membranes, incubated with either anti-Tgfbr2 (1:500 dilution; Abcam)
or anti-Actin (1:2000 dilution; Abcam) at 4° overnight, and incubated with
HRP-conjugated secondary antibodies (1:5000 dilution; Santa Cruz) at room
temperature for 1.5h. Western results were quantified by ImageJ.
Embryonic stem cell (ESC) differentiation
ESCs were maintained in an ESC medium consisted of KO-DMEM (invitrogen)
supplemented with 15% FBS (invitrogen), 1X NEAA (STEMCELL Technologies
Inc.), 2mM Glutamax (invitrogen), 0.15mM 1-thioglyceral (Sigma) and 1000U/ml
mLIF (chemicon) on gelatin coated dish. ESCs were differentiated in chemically
defined medium as previously described for 11 days (4). After cells were induced into
endoderm for 4 days and treated with liver specification cocktail for another day, cells
were dissociated, plated, and supplemented with DMSO (Sigma), or 1μM SB505124
(Sigma), as indicated. For mir302b overexpression, we used a lentivirus-mediated
expression system (SBI). To produce lentiviruses, transfer vector, pCDH or
pCDH302b and packaging vectors (the third generation) were transfected into 293T
cells using linear polyethylenimine (PEI) (Polyscience) with a DNA to PEI ratio of
1:3. Supernatants were collected at 48h and 72h after transfection, and filtered
through 0.45M low protein binding filters (Millipore). Viruses were concentrated by
centrifuge the supernatants at 25,000 rpm for 90min. The viral pellets were
re-suspended in DMEM. During ESC differentiation, at day 5, cells were dissociated
and plated. The next day, lentiviruses containing pre-mir302b or control lentiviruses
were added into the medium. Transduction was repeated every day. At day 11, the
expression of liver markers was analyzed by qRT-PCR. The primers were listed in
Table S8.
SUPPORTING FIGURE LEGENDS
Figure S1. Analysis of the small RNA sequencing. A. Correlation of miRNA
expression from foregut and hepatoblast replicates. B. Comparison of two adult liver
libraries generated by short sequencing. A total of 356 miRNA/miRNA* were
detected both in our adult female liver library (MM0518) and Gao’s adult male liver
library (5). The correlation between the two libraries is 0.588. C. Breakdown of the
proportions of miRNAs grouped by genomic location in three libraries. D. Based on
the expression pattern of each miRNA, miRNAs were divided into 13 clusters by
using K-means clustering.
Figure S2. WISH results of mir29a and mir302b in E8.5 embryos. mir29a and no
probe served as negative control.
Figure S3. Dlk1 specifically labels hepatoblasts in the E14.5 liver. E14.5 embryos
were embedded in OCT, sectioned at 4µm, and stained with the indicated antibodies.
Nuclei were visualized by DAPI. Dlk1 cells were positive for the liver marker HNF4α
(A), but not Desmin - a mesenchymal marker (B), CD45 - a myeloid lineage marker
(C), or PECAM - a endothelial marker (D), suggesting that Dlk1 is a specific marker
of hepatic cells but not other cell types in the fetal liver. Bar=25µm.
Figure S4. FACS and purity check of Dlk1 cells from E14.5 liver cells. A. E14.5
livers were enzymatically dissociated, and single-cell suspensions were stained with
an anti-Dlk1 FITC-conjugated antibody. Approximately 4% of the cells from the
initial population were positive for Dlk1, and these cells were gated for sorting by
flow cytometry. Re-analysis of the sorted population showed purity. B. Respective
fractions of E14.5 liver cells were placed onto glass slides and stained with the
anti-HNF4α antibody to visualize hepatic cells in the population. The top panel shows
the staining with unsorted fetal liver cells, where very few cells showed positive
HNF4α staining. In the bottom panel, Dlk1+ cells sorted to high purity showed
significant enrichment of HNF4α-positive cells. Bar=50µm. C. Respective fractions
of E14.5 liver cells were placed onto glass slides, stained with the anti-Ter119
antibody (to visualize red blood cells) and anti-HNF4α antibody, and positive nuclei
were manually counted and tabulated. As expected, high purity Dlk1+ cells were
significantly enriched for HNF4α-positive hepatic cells but depleted of blood cells.
Figure S5. mir302b expression in early embryos. A, B: mir302b expression in early
streak embryo (E6.5); lateral view (A) and sagittal section (B). C-F: mir302b
expression in E7.5 embryo; lateral view (C) and sagittal section (D-F). G-I: lateral
view of mir302b expression in somite 0 stage embryo (E8.5) (G) and sagittal sections
(H, I). J-L: lateral view of mir302b expression in somite 3 stage embryo (E8.5) (J) and
transverse sections (K, L). M, N: mir302b expression in E8.75 embryo; lateral view
(M) and sagittal sections (N). O, P: mir302b expression in E9.5 embryo; lateral view
(O) and sagittal sections (P). Epi, epiblast; ve, visceral endoderm; en, endoderm; m,
mesoderm; a, allantois; ht, heart.
Figure S6. mir302b and mir20a are dynamically expressed during early liver
development. The expression of mir302b (A) and mir20a (B) during early liver
development by q-RT-PCR. C. The relative expression of mir20a and mir302b in
foregut.
Figure S7. Neither mir302b nor mir20a targets Camk2n1. A. 3’UTR sequences
from Camk2n1 showing the predicted miRNA binding regions were cloned into
luciferase vectors. B. Relative luciferase activity of Camk2n1 wildtype (WT), mutant
(Mut) and backbone (Vector) reporters transfected into 293T cells containing
302b_OE (↑), Ctrl_OE (-),20a_KD (↓) or Ctrl_KD (+).
Figure S8. mir302b overexpression or mir20a knock-down in 293T. q-RT-PCR of
mir302b and mir20a expression in 293T cells with mir302b overexpression or mir20a
knock-down.
Figure S9. Repressing TGFβ signal enhance liver development in ESC
differentiation model. A. Schematic view of ESC differentiation. B. The expression
of endoderm marker, Foxa2, Sox17 and Gsc during ESC differentiation. C. The
expression of liver marker, Alb, Afp, Hnf4a, Ttr, Hpx, and Serpina1a during ESC
differentiation. D. After cultured with liver specification medium for 1 day, cells were
dissociated and replated with hepatoblast expansion medium supplemented as
indicated.
References
1. Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler
transform. Bioinformatics 2009;25:1754-1760.
2. Saeed AI, Bhagabati NK, Braisted JC, Liang W, Sharov V, Howe EA, Li J, et al.
TM4 microarray software suite. Methods in enzymology 2006;411:134-193.
3. Cai L, Huang H, Blackshaw S, Liu JS, Cepko C, Wong WH. Clustering analysis
of SAGE data using a Poisson approach. Genome biology 2004;5:R51.
4. Gouon-Evans V, Boussemart L, Gadue P, Nierhoff D, Koehler CI, Kubo A,
Shafritz DA, et al. BMP-4 is required for hepatic specification of mouse embryonic
stem cell-derived definitive endoderm. Nature Biotechnology 2006;24:1402-1411.
5. Gao Y, Schug J, McKenna LB, Le Lay J, Kaestner KH, Greenbaum LE.
Tissue-specific regulation of mouse microRNA genes in endoderm-derived tissues.
Nucleic Acids Res 2011;39:454-463.