Supplemental information
Enhancement of leptin receptor signaling by SOCS3 deficiency induces development of
gastric tumors in mice
Kyoko Inagaki-Ohara1,2,3, Hirokazu Mayuzumi1, Seiya Kato4, Yasuhiko Minokoshi2,
Takeshi Otsubo3, Yuki I. Kawamura3, Taeko Dohi3, Goro Matsuzaki1, Akihiko Yoshimura,5.
1
Molecular Microbiology Group, Center of Molecular Biosciences (COMB), Tropical
Biosphere Research Center, University of the Ryukyus, Senbaru 1, Nishihara, Okinawa
903-0213, Japan
2
Division of Endocrinology and Metabolism, Department of Developmental Physiology,
National Institute for Physiological Sciences, 38 Nishigonaka Myodaiji, Okazaki, Aichi
444-8585, Japan
3
Department of Gastroenterology, Research Center for Hepatitis and Immunology,
Research Institute, National Center for Global Health and Medicine, Toyama 1-21-1,
Shinjuku, Tokyo 162-8655, Japan
4
Division of Pathology and Cell Biology Graduate School and Faculty of Medicine
University of the Ryukyus, 207 Uehara, Nishihara, Okinawa 903-0215, Japan
5
Department of Microbiology and Immunology, Keio University School of Medicine
35 Shinanomachi, Shinjyuku, Tokyo, 160-8582, Japan
Supplementary information
Supplementary Material and Methods
Preparation and culture of gastric EC
Gastric EC were dissociated with Triple LETM Express (Invitrogen, Carlsbad, CA) for 15
min at 37°C, passed through nylone mesh, washed with PBS. Separated gastric EC were
collected by centrifugation and cultured in RPMI1640 medium including 50 ng/ml EGF,
1g/ml hydrocortisone, 10g/ml insulin, 2g/ml trasnferin, 5nM sodium selenite (all
reagents were purchased by Sigma), penicillin, streptomycin (Invitrogen), 5% cosmic calf
serum (Thermo Scientific, South Logan UT) as modification of previous report (Roig et al.,
2010). Culture medium was changed every 4 day. XTT (25M, Wako) was added to the
cultured EC during the last 4h cultured and was measured by colorimetric counting.
Abs
Abs used in immunohistochemical analysis are as follows: rabbit anti-SOCS3 (C005) Ab
(Immuno-Biological Laboratories, Gunma, Japan), rabbit anti-p-STAT3 (D3A7) Ab (Cell
Signaling Technology, Danvers, MA) and rabbit anti-STAT3 (C-20) Ab, rabbit anti-ObR
Ab, anti-Muc2 (H-300) Ab, (Ab, goat anti-p-ObR Ab (sc-16421), mouse anti-Bcl-xL (H-5)
Ab, goat anti-IL-6 (M-19) Ab and rabbit anti-IL-11 (H-169) Ab, anti-p21 (F-5) Ab,
anti-p53 (FL-393) Ab (Santa Cruz Biotechnology Inc., Santa Cruz, CA USA), rabbit
anti-mouse TFF3 (TFF-A) mAb (Alpha Diagnostic Intl Inc., San Antonio, TX), rabbit
anti-leptin (L3410) Ab and mouse anti--actin (AC-74) Ab (Sigma, St. Louis, MO), rabbit
anti-Ki67 (ab15580) Ab and rabbit anti-Snail (ab17732) Ab, mouse anti-H+K+ ATPase beta
(2G11) mAb
(Abcam, Cambridge, UK), goat anti-E-cadherin (AF748) Ab (R&D
Systems, Minneapolis, MN, USA), rat anti-mouse CD45 (30-F11) Ab, mouse
anti--catenin (14) Ab (BD Bioscience, San Jose, CA). Anti-leptin (AF498) Ab (R&D
Systems, Minneapolis, MN) was used for administration in vivo. Abs used in FACS
analysis are as follows: fluorescein isothiocyanate (FITC)-conjugated anti-CD4 (RM4-5),
antii-Gr1 (RB6-8C5), phycoerythrin (PE)-conjugated anti-CD8 (53-6.7), allophycocyanin
(APC)-conjugated anti-CD3 (145-2C11) and biotin-conjugated CD11b (M1/70) mAbs
and streptavidin-PerCP (BD Bioscience) and PE-conjugated anti-F4/80 (BM8)
(e-bioscience, San Diego, CA).
Supplementary Figure Legends
Supplemental Figure S1
High mortality and growth suppresion in T3b-SOCS3 cKO
mice. (a) Survival rate of the T3b-SOCS3 cKO and control mice. Values are cumulative
survival rates. cKO (n=52), CNT (n=50). (b) Body weight changes after birth in the
T3b-SOCS3 cKO and control mice. Body weight was measured weekly from 3-16 weeks
after birth (left) (*p < 0.05). Apperearance of the T3b-SOCS3 cKO and control mice at 4
weeks of age (right). (c) Cumulative food intake for 7 days at 5 week of age (n=5). Food
intake was monitored by daily measurement. Representative data show mean + SD. *p <
0.05.
Supplementary Figure S2
No tumorigenesis in bowels in T3b-SOCS3 cKO mice.
HE-staining of small and large bowels in 8-week-old SOCS3-deficient and control mice
(scale 100 m).
Supplementary Figure S3
An increase in DNA damage, cell cycle and anti-apoptosis in
the T3b-SOCS3 cKO mice. Gastric paraffin-embedded sections stained for (a) p53, (b)
p21and Bcl-xL, (c) -catenin, E-cadherin and snail in 8 week-old the T3b-SOCS3 cKO
and control mice. (Scale, p53; 100 m, p21, Bcl-xL, -catein and E-cadherin/Snail; 50
m).
Supplementary Figure S4
SOCS3-deficient gastric EC were autonomously proliferated.
Gastric EC separated from the cKO and control mice were cultured in the medium
described in Materials and Methods for 2 and 16 days. On day 16, the proliferated EC of
cKO mice were stained with PAS/alcian blue.
Supplementary Figure S5 Lower STAT3 activation of bowels than stomach in
SOCS3-deficient mice. Sections of duodenum and colon were stained for p-STAT3 in the
8-wks-old cKO mice (Magnification; x400).
Supplementary Table
Primer sequences used in the experiments.
muc1
muc2
muc5ac
muc6
tff3
lept
atp4a
atp4b
gast
gif
ghrl
cdx2
barx1
sense: 5’-aatggcactcagccttcagt
anti-sense: 5’-gaaggagaccccaacagaca
sense: 5’-acaaaaaccccagcaacaag
anti-sense: 5’-gagcaagggactctggtctg
sense: 5’-gcaactggaccaagtggttt
anti-sense: 5’- tgacccagatcctccatctc
sense: 5’-tgcatgctcaatggtatggt
anti-sense: 5’- tgtgggctctggagaagagt
sense: 5’-cagattacgttggcctgtctcc
anti-sense: 5’- atgcttgctacccttggccac
sense: 5’-tga cac caa aac cct cat ca-3’
anti-sense: 5’- tcattggctatctgcagcac-3’
sense: 5’-gtctggagggaacagctcag
anti-sense:taccacaatggccatgaaga
sense: 5’- cct tga gac cgg acg tgt at-3’
anti-sense: 5’-ggcctgagcagttttgtagc-3’
anti-sense: 5’-taccacaatggccatgaaga-3’
sense: 5’-accaatgaggacctggaaca-3’
anti-sense: 5’-atccatccgtaggcctcttc-3’
sense: 5’- cttggccctgacctgtatgt-3’
anti-sense: 5’-taggttgctcaggtgtcacg-3’
sense: 5’- tctgcagtttgctgctactca-3’
anti-sense: 5’-cctctttgacctcttcccaga-3’
sense: 5’-cacaactcggagatcagcaa
anti-sense: 5’- ctccgggaagcgtgtactta
sense: 5’- ggagtcgcaccgtattcact
anti-sense: tggggatggagttcttcttg
Supplemental reference
Roig AI, Eskiocak U, Hight SK, Kim SB, Delgado O, Souza RF, Spechler SJ, Wright
WE and Shay JW. (2010). Gastroenterology, 138, 1012-1021 e1011-1015.