Nature Reference # 2002-12738B
1
Supplementary information
Materials and methods
Plasmid construction
The full-length human NEMO was amplified by PCR from a publicly available EST
clone encompassing the entire coding region of NEMO using the primers: NEMOF1
(5’-CGGAATTCATGAATAGGCACCTCTGGAAGAGCCAAC-3’) and NEMOR1
(5’-CGGGATCCCTACTCAATGCACTCCATGACATGTAT-3’). The resulting PCR
product was digested with EcoRI and BamHI and was cloned into the corresponding
sites of pBridge vector (Clontech) to generate pBridgeNEMO. NEMOC417R was
generated by PCR using pBridgeNEMO as the template and the following primers:
NEMOF1 and mNEMOR1 (5’CGGGATCCCTACTCAATGCGCTCCATGACATGTATCTGCAG-3’). The resulting
PCR product was cloned in pBridge in the same way as WT NEMO to generate
pBridgeNEMOC417R. The correct coding region of NEMO in pBridgeNEMO and
pBridgeNEMOC417R was verified by sequencing. NEMOD406V was generated by
two PCR reactions. The first PCR was performed with pBridgeNEMO as the template
and the primers NEMOF1 and mNEMOR2 (5’GCACTCCATGACATGTATCTGCAGGGTGTCCATAACAGGGGCCTGATACTG3’). The second PCR was performed with the product of the first PCR as the template
and the primers NEMOF1 and NEMOR1. The resulting PCR product was cloned in
pBridge in the same way as WT NEMO to generate pBridgeNEMOD406V. Full length
human CYLD in pACT was digested with XhoI and inserted in the XhoI site of
Nature Reference # 2002-12738B
2
pCDNA3FLAG (plasmid GM3910, Sylla, B. S. et al. Epstein-Barr virus-transforming
protein latent infection membrane protein 1 activates transcription factor NF-kappaB
through a pathway that includes the NF-kappaB-inducing kinase and the IkappaB
kinases IKKalpha and IKKbeta. Proc Natl Acad Sci U S A 95, 10106-11 (1998)) in
frame with the FLAG epitope to generate pCDNA3FLAGCYLD. GST-CYLD(538-953)
was generated by digestion of pCDNA3FLAGCYLD with StuI and XhoI and
subcloning of the fragment encoding CYLD amino acids 538 to 953 into pGEX5X-2
(Amersham Pharmacia) digested with XhoI and SmaI or pGEX6P-2 (Amersham
Pharmacia) cut with SmaI and XhoI. GSTCYLD(538-953)C601S was generated by
standard PCR-based mutagenesis. CST-CYLD(538-932), CST-CYLD(538-864) and
CST-CYLD(538-754) were amplified by PCR from CST-CYLD(538-953) using the
forward primer GEXF1 (5’-GCCTTTGCAGGGCTGGCAAGC-3’) and the reverse
primers: 5’-GCAACCTGCGGCCGCTCATGCACAGCCTTGGA-3’or 5’GCAACCTGCGGCCGCTTATATGCAGAGAACAGC-3 or 5’GCAACCTGCGGCCGCTCAAGGCATCTGAATAATCAG-3’respectively. The
resulting PCR products were digested with BamHI and NotI and cloned into the
corresponding sites of pGEX5X-2. pCDNA3FLAGCYLD digested with XhoI gave
full-length CYLD which was cloned to pEGFPC1 (Invitrogen) in frame with GFP to
generate pGFPCYLD. The CYLD-encoding fragments of CST-CYLD(538-932), CSTCYLD(538-864) and CST-CYLD(538-754) produced by digestion with NotI, bluntending with T4 DNA polymerase and digestion with Bsu36I were cloned in
pCDNA3FLAGCYLD digested with ApaI and blunted and then digested with Bsu36I to
generate pCDNA3FLAGCYLD (538-932), pCDNA3FLAGCYLD (538-864) and
pCDNA3FLAGCYLD (538-754) respectively. pCDNA3FLAGCYLD was digested
Nature Reference # 2002-12738B
3
with BamHI, blunted with T4 DNA polymerase and digested with ApaI to produce a
full-length CYLD-encoding fragment which was inserted into a pCDNA3 derivative in
frame with three iterated myc epitopes (Aster, J. C. et al. Oncogenic forms of NOTCH1
lacking either the primary binding site for RBP-Jkappa or nuclear localization
sequences retain the ability to associate with RBP-Jkappa and activate transcription. J
Biol Chem 272, 11336-43. (1997)) digested with AgeI and blunted and then digested
with ApaI to generate pCDNA3-3MCYLD which encodes for CYLD with three amino
terminal myc epitopes. pEBGNEMO which expresses a GST fusion of NEMO in
mammalian cells was generated by subcloning the corresponding NEMO-encoding
fragment derived from pBridgeNEMO into pEBG (Tanaka, M., Gupta, R. & Mayer, B.
J. Differential inhibition of signaling pathways by dominant-negative SH2/SH3 adapter
proteins. Mol. Cel. Biol. 15, 6829-6837 (1995)) digested with BspDI and blunted and
then digested with NotI. PCDNA3FLAGTRAF2 was constructed by subcloning the
FLAGTRAF2 encoding fragment of pSG5FLAGTRAF2 (Kaye, K. M. et al. Tumor
necrosis factor receptor associated factor 2 is a mediator of NF-kappa B activation by
latent infection membrane protein 1, the Epstein-Barr virus transforming protein. Proc
Natl Acad Sci U S A 93, 11085-90 (1996)) with KpnI and XbaI into the corresponding
sites of pCDNA3. The expression vector of human CD40 was provided by Dr. H.
Kikutani, the expression vectors of XEDAR and EDAR were provided by Dr. V. Dixit,
the expression vector of murine TRAF6 was provided by Dr. H. Nakano, the expression
vector of HA-Ubiquitin was provided by Dr. B. Lim, the expression vector of
Ubc13C87A was provided by Dr Z.J. Chen, the expression vector of GST-DUB2 was
provided by Dr. A. D’Andrea and the expression plasmids for -galactosidase fusions of
ubiquitin-like molecules were provided by Dr. C. H. Chung. Dr. M. Hochstrasser
Nature Reference # 2002-12738B
4
provided MC1061 E. coli expressing a ubiquitin-Met--galactosidase fusion. The
expression vector of FLAG-tagged IKKwas previously described (Sylla, B. S. et al.
Epstein-Barr virus-transforming protein latent infection membrane protein 1 activates
transcription factor NF-kappaB through a pathway that includes the NF-kappaBinducing kinase and the IkappaB kinases IKKalpha and IKKbeta. Proc Natl Acad Sci U
S A 95, 10106-11 (1998)).
RNA interference
HEK 293T cells (125x 103 per well) were seeded in 24-well plates and the next day
were transfected with Lipofectamine 2000 transfection reagent (Invitrogen). The total
amount of DNA and short interfering RNA (siRNA) was diluted to 25μl of serum-free
medium. 1μl of Lipofectamine 2000 was also diluted to 25μl of serum-free medium. 60
pmoles per well of each siRNA were used. After 5min incubation at room temperature
the transfection reagent mix was added to the DNA-siRNA mix followed by 20min
incubation at room temperature. Cells were washed with serum free medium and
incubated with the reaction mix in 250μl of serum free medium at 37oC for 4 hours. At
the end of the incubation time the media were replaced with 1ml of D10. 44-48 hours
post-transfection media were replaced with 250μl of D10 with or without 3μg/ml human
CD40 ligand. Cells were incubated at 37oC for 5 hours and then they were assayed for
lucirerase and -galactosidase activities. SiRNAs were generated by annealing 20M
single stranded RNAs in annealing buffer (30mM HEPES-KOH pH 7.4, 100mM
potassium acetate, 2mM magnesium acetate,) for 1 min at 90oC followed by 1-hour
incubation at 37oC. The HCYLDsiRNA was generated by annealing the following
single stranded RNAs: 5’-r(GAUCGUUCUGUGGGGCAUU)dTdT-3’(sense), 5’-
Nature Reference # 2002-12738B
5
r(AAUGCCCCACAGAACGAUC)dTdT-3’ (antisense). The NSsiRNA was generated
by annealing the following single stranded RNAs: 5’r(UAUACAAGGCUCUGCAGAC)dTdT (sense) and 5’r(GUCUGCAGAGCCUUGUAUA)dTdT(antisense). The NSsiRNA targets murine
TRADD mRNA and does not match any human mRNA. For RT-PCR total RNA was
prepared using the RNAwiz reagent (Ambion) according to the instructions of the
manufacturer. Reverse transcription was performed with 4 g of total RNA using the
Reverse Transcription System (Promega) according to the instructions of the
manufacturer.
Figure legends
Figure 1. Analysis of the deubiquitinating activity of CYLD in bacteria. E.coli
expressing a ubiquitin-β-galactosidase fusion, were transformed with the indicated
expression constructs for GST, GSTCYLD(538-953) or GSTCYLD(538-953) with the
cysteine codon 601 mutated to a serine codon (GSTCYLDC601S). After the induction
of the GST-domain containing proteins whole bacterial extracts from approximately
equal number of bacteria was analyzed by immunoblotting with a polyclonal anti-βgalactosidase antibody (upper panel). The positions of ubiquitin-β-galactosidase (Ubgal) and β-galactosidase (gal) are shown. All GST-containing proteins were
expressed at similar levels as determined by immunoblotting (lower panel) of whole cell
lysates prepared from equal numbers of bacteria with polyclonal anti-GST antibody (GSTAmersham Pharmacia)
Nature Reference # 2002-12738B
6
Figure 2. The effect of CYLD and CYLD(1-932) on NF-κB activation by XEDAR and
EDAR. HEK293T cells were transfected with the 3XBL and the pGK-β-galactosidase
reporter plasmids along with: (a) a FLAG-tagged XEDAR (FXEDAR) expression
vector and the indicated micrograms of FLAG-tagged CYLD (FCYLD) or FLAGtagged CYLD(1-932) (FCYLD(1-932)) expression constructs, (b) an EDAR expression
vector and the indicated micrograms of FCYLD or FCYLD(1-932) expression
constructs. After 24hrs,cell extracts were prepared and the levels of luciferase and βgalactosidase activity were determined. The results are the mean  SD of relative
luciferase activity from three independent experiments. The panels on the right show
representative western blots of whole cell lysates from equal number of HEK293T cells
subjected to transfection in one representative experiment.
Figure 3. Downregulation of CYLD expression by RNA interference. a, 293T cells
were either mock transfected or transfected with the same amount of either a nonspecific short interfering RNA (NSsiRNA) or a human CYLD-specific short interfering
RNA (HCYLDsiRNA). Approximately 48 hours posttransfection total RNA was
prepared and subjected to reverse transcription and PCR (RT-PCR) using primer pairs
to amplify CYLD and GRB2 cDNA fragments. GRB2 was used as an internal control.
The RT-PCR products were analysed by agarose gel electrophoresis. The positions of
the products corresponding to CYLD and GRB2 are shown by arrows. b, 293T cells
were either mock transfected or transfected with expression constructs for FCYLD and
FLAG-tagged TRAF3 (FTRAF3) in the presence or absence of the same amount of
NSsiRNA or HCYLDsiRNA as in a. FTRAF3 was used as a transfection efficiency
marker. Approximately 48 hours posttransfection whole cell extracts containing equal
Nature Reference # 2002-12738B
7
amounts of protein were prepared and subjected to western blot analysis with antiCYLD (upper panel) or anti-TRAF3 (lower panel) antibodies.
Figure 4. CYLDC601S does not inhibit TRAF2-mediated activation of NF-κB.
HEK293T cells were transfected with the 3XBL and the pGK-β-galactosidase reporter
plasmids along with expression vectors for FCYLD, FLAG-tagged TRAF2 (FTRAF2)
and FLAG-tagged CYLDC601S (FCYLDC601S) as indicated. After 24hrs,cell extracts
were prepared and the levels of luciferase and β-galactosidase activity were determined.
Results are the mean  SD of relative luciferase activity from three independent
experiments (a). b, Representative western blot of whole cell lysates from equal
number of HEK293T cells subjected to transfection in one representative experiment.
FTRAF2, FCYLD and FCYLDC601S were detected with M5 anti-FLAG antibody.
Figure 5. Ubc13 mediates TRAF2 ubiquitination and NF-B activation by CD40,
XEDAR and EDAR. a, HEK293T cells were transfected with the 3XBL and the pGKβ-galactosidase reporter plasmids along with expression vectors for dominant negative
Ubc13 (Ubc13C87A), CD40, FXEDAR and EDAR as indicated. After 24hrs,cell
extracts were prepared and the levels of luciferase and β-galactosidase activity were
determined. The results are the mean  SD of relative luciferase activity from three
independent experiments. b, representative western blots of whole cell lysates from
equal number of HEK293T cells subjected to transfection in one representative
experiment from a to determine the levels of CD40, FXEDAR and EDAR. c,
HEK293T cells were seeded in 6-well plates and transfected with expression vectors for
HA-tagged ubiquitin and FTRAF2 in the presence or absence of Ubc13C87A as
Nature Reference # 2002-12738B
8
indicated. After 24hrs cells were lysed with RIPA buffer and the lysates were
immunoprecipitated with M5 anti-FLAG antibody. Immunoprecipitated proteins (IP:
FLAG) and whole cell lysates (WCE) representing 1.5% of the transfected cells were
analysed by immunobloting with anti-ubiquitin antisera (WB: Ub, upper panel) and
the same blot was reprobed with M2 anti-FLAG (WB: FLAG, lower panel). The
positions of polyubiquitinated FTRAF2 (FTRAF2-Ubn) and FTRAF2 are shown.