1
Supplementary information
Sample
We analyzed a bone from a mammoth from Berelekh, Yakutia (71°N, 145°E,
Russia). The sample was dated at the Leibniz Labor für Altersbestimmung und
Isotopenforschung, Christian-Albrechts-Universität Kiel, Germany, using accelerator
mass spectrometry (Table S1). The collagen fraction contained more than the minimum
amount of one mg carbon recommended for AMS dating and the 13C-values are in the
normal range of organic bone samples. The calibrated age (two-sigma range, 95%
probability) lies between 11,900 and 13,400 years.
Table S1.
Dating
weight
carbon
collagen
radio carbon
Number
(g)
(mg)
(%)
age
KIA 25289
0.485
4.1
24.0
12,170 ± 50 BP
13C(‰)
-20.50 ± 0.13
Primer design, DNA extraction and amplification
Leipzig. Based on published sequences of African (Loxodonta africana) and Asian
(Elephas maximus) elephant as well as dugong (Dugong dugon), we designed 46 primer
pairs that are expected to amplify DNA fragments that assuming homology with extant
elephant species, are expected to amplify DNA fragments that vary in length from 291 to
580 bp (including primers) and cover the entire mtDNA of the woolly mammoth
(Mammuthus primigenius, Fig. 1, Table S3). To avoid amplification of the short
overlapping fragments during the multiplex step, we divided the primer pairs into two
sets so that the amplification products within a set do not overlap. DNA was extracted
from 747 mg bone material1 and eluted in a final volume of 70 µl 1x TE. Two multiplex
PCRs were initiated using DNA extract corresponding to approximately 15 mg of bone.
The final concentrations of reagents in amplification reactions were 1x AmpliTaq Gold
buffer, 4 mM MgCl2, 200 µM of each dNTP, 1 µM each of 46 primers (23 primer pairs,
see Table S3), and 2U of AmpliTaq Gold (Applied Biosystems). PCRs were initiated by
9 min at 94°C to activate the polymerase followed by 27 cycles of 94°C for 20 s, 52°C
2
for 30 s and 72°C for 1 min. This amplification was diluted 40 fold and 5 µl of the
dilution were used as template in each of 23 single amplification reactions. The
specificity of the secondary amplifications was improved by the use of 'nested' primers
internal to those used in the primary multiplex amplification (see Table S3). This
approach resulted in final amplification lengths of the products ranging from 291 – 567
bp (including primers, see Table S3). Reagent concentrations were as above, except that a
single primer pair was used at a concentration of 1.5 µM for each primer. The
temperature profile was identical to the one above except that 33 instead of 27 cycles
were used. To avoid amplification of contaminating modern human DNA, which is
ubiquitous in the environment2-5 at least one primer per amplified fragment carried a
mismatch to the corresponding human mtDNA sequence at the 3’-end6. Amplification
products were visualized on 2.5% agarose gels. Amplification products of the correct size
were cloned using the TOPO TA cloning Kit (Invitrogen, The Netherlands) and a
minimum of three clones were sequenced on an ABI3730 capillary sequencer (Applied
Biosystems). In cases when primer dimers were observed, products of the correct length
were isolated from the gel and purified using the QIAquick gel extraction kit (Qiagen,
Germany) before cloning. Amplification and extraction controls were negative
throughout all experiments. Of five PCRs that failed initially four were successful in later
attempts, suggesting that the initial failure was due to absence of even a single template
molecule in the PCR. The fifth PCR failed repeatedly; inspection of the sequences of the
overlapping amplimers revealed differences between the mammoth and elephant
sequences sufficient to account for the failure. Altogether, we sequenced 842 clones from
121 PCR products, obtained from 14 initial multiplex amplifications. The complete
mammoth mtDNA sequence was deposited in GenBank (accession number DQ188829).
We observed consistent substitutions when comparing the products derived from one
primary amplification with those from the second in 17 amplifications representing 13 of
the 46 fragments, indicating that these amplifications started from a single template
molecule7. Out of a total of 39 such substitutions, all were found to represent C to T or G
to A substitutions. This type of substitution has been shown to occur frequently in ancient
DNA8-10 and where tested represented deamination of cytosine in the ancient template
molecules9. We amplified these fragments together with fragments that had failed to
3
amplify in either of the two first amplifications using additional multiplex reactions. We
failed in obtaining a second amplification for one fragment (primer pair A23). This
fragment contains 55 copies of a 6 bp motif in the single amplification we obtained.
Varying copy numbers of this repetitive motif are also found in African and Asian
elephant and dugong. As such repeats are known to vary in copy number both between
and within individuals11 this fragment was excluded from all further analyses.
In addition to the small amounts of bone necessary to sequence a complete mtDNA
genome of extinct species, there are two other advantages of the nested primer approach
used. First, nested primers improve the specificity of the final amplification products.
Second, the risk of contamination with previously amplified PCR products is greatly
reduced as the second-stage PCR products (which are amplified to very high levels)
cannot later contaminate the primary PCRs, since they do not carry the external priming
sites.
It has recently been claimed that ancient DNA extracts may contain mutagenic
substances that affect particular positions in DNA sequences12, 13. We tested whether our
mammoth DNA extract contained such mutagenic factors. Thus, we amplified 274 bp of
the mtDNA control region from 50ng of chimpanzee DNA, in the presence of either
water, extraction blank or mammoth extract as previously described14. The obtained PCR
products were cloned and a minimum of six clones sequenced. Consistent with previous
results14, 15, we did not find any evidence for a mutagenic factor in our extract (data not
shown).
Cambridge 0.5 g of bone was extracted using the same protocol as in Leipzig.
Instead of an extraction control without bone, a second extraction using cave bear bone
was carried out in parallel to monitor for possible carrier effects16. Amplification was
done using the same PCR conditions as in Leipzig, but with a reduced number of primer
pairs. Both water controls and the cave bear extract were negative for mammoth-specific
products, although the cave bear extract yielded products different from the correct
product lengths with some primer pairs. Between two and four amplification products,
originating from independent primary PCRs, were sequenced in both directions for eight
different fragments distributed over the whole mitochondrial genome (12S, ND2, t-RNA
Ser, t-RNA Asp, COX1, COX2, COX3, ND4, Cytb, D-Loop). A total of 3,824 bp were
4
amplified and sequenced. Two amplification products representing a single fragment
carried an A at a single position each. At one of these positions three additional
amplification products of the same fragment carried a G, while at the other two additional
amplifications carried a G and the third amplification was heterogeneous for G/A. As
described above such consistent substitutions between amplifications occur most likely
due to cytosine deamination of the template DNA. The consensus sequences for all
fragments were identical to the corresponding sequences done in Leipzig.
London. DNA was extracted from 0.2 g of bone powder using the method described
in Leonard et al.17, modified by the use of a Spex freezer mill to powder the bone. For
amplifications, we used 1 µl of mammoth DNA extract in an antibody-mediated hot start
PCR of 25 µl total volume. The final concentrations of reagents in amplification reactions
were 1X Platinum Taq HiFi buffer, 2 mM MgSO4, 250 µM of each dNTP, 1 µM of each
primer, 1 mg/ml bovine serum albumin and 1 U of Platinum Taq HiFi (Invitrogen). The
PCR reactions comprised an initial denaturation of 5min at 94°C, followed by 44 cycles
of 52°C for 1 min, 68°C for 1 min and 94°C for 1 min. Amplification products were
visualized on 2.5% agarose gels. The resulting PCR products were sequenced on an
ABI3700 capillary sequencer (Applied Biosystems). Amplification and extraction
controls were negative throughout all experiments. The primers were designed using the
mitochondrial sequences from Asian and African elephant for Cytb, t-RNA Thr, t-RNA
Pro and D-Loop sequences.
Primer Sequences
Mammoth_14125_F
ATCTGAAAAACCATCGTTGTATTTC
Mammoth_14387_R
GATGCTCCGTTTGAGTGTAGTTG
Mammoth_14232_F
CTACCCCATCCAACATCTCAAC
Mammoth_14585_R
TAAGGGATTGCTGAGAAAAGGTTAGT
Mammoth_15038_F
5
GGCGTCCTAGCCCTACTCCTATCAAT
Mammoth_15399_R
TTGTTTGCAGGGAATAGTTTAAGAAG
Mammoth_15178_F
TGAATTGGCAGCCAACCAGTAGAA
Mammoth_15530_R
TATAAGCATGGGGTAAATAATGTGATG
Mammoth_15393_F
CCTCGCTATCAATACCCAAAACTG
Mammoth_15780_R
CGAGAAGAGGGACACGAAGATG
Amplification products were sequenced directly from both strands. The determined
sequences are identical to the corresponding sequences determined in Leipzig except for
one position. At this position, a single amplification in London carried a T whereas three
independent primary amplifications in Leipzig gave a C. Thus, the overall consensus
nucleotide for this position is a C, by a ratio of 3:1 primary amplifications. Moreover, the
minority nucleotide (T) can be explained by cytosine deamination of the template DNA.
Therefore, we conclude that the majority nucleotide (C) represents the correct sequence.
Combining the data from all three laboratories, 42 consistent changes were observed
in 20 amplification products representing 14 different fragments. Given a previously
estimated damage rate of 2% for cytosine deamination9 and following the approach that
each position is determined from two independent PCRs, and in case of a discrepancy, a
third PCR is done and the nucleotide observed twice is assumed to represent the correct
sequence, the chance of incorrectly determining a position is 0.012%9. Thus, it is not
surprising that the consensus sequences from Leipzig and Cambridge where this
approach was followed are identical. Conversely, the sequences from London, which
were determined only from single PCRs, differ at one position from the Leipzig
consensus sequences. Given that 456 cytosines are found in both strands of the fragments
amplified this result is not surprising for ancient DNA analyses.
6
Analyses
The entire mitochondrial genome of the mammoth is 16,770 bp long and, like its
extant relatives, carries 22 tRNA genes, 13 protein coding genes and two rRNA genes.
All genes that are inferred to encode proteins show open reading frames of the expected
length and all tRNAs show the expected anticodon sequence when folded into their twodimensional structures, both facts arguing against the amplification of nuclear insertions.
The total length of the mtDNA genome is likely to vary among and perhaps even within
individual mammoths since the control region contains a repeat motif that is also found in
African and Asian elephants and dugong. Such repeats are known to vary in copy number
both between and within individuals11 and may also induce in vitro recombination during
PCR18. Hence, the number of repeat units reported here cannot be taken to be
representative without further study. The length of the mtDNA genomes from African
(accession number NC000934) and Asian (accession number NC005129) elephant is
16866 and 16831bp, respectively.
We estimated phylogenetic trees using maximum parsimony, maximum likelihood,
neighbor joining and Bayesian tree building methods and both hyrax and dugong either
alone or in combination as outgroups, using 1000 bootstrap replicates and 3 million
chains in the Bayesian analyses. However, we could not resolve the phylogeny of
mammoth, African and Asian elephant unambiguously (Table S2). As two different tests
did not reject the assumption of a molecular clock for these three species, we restricted
the analyses to the three elephantidae species.
To test whether the phylogenetic signal in the data is strong enough to warrant a
resolution of the sequence tree we proceeded as following: The likelihood of the data was
assessed under two alternative models i) a simple model with only a single free parameter
corresponding to a star-like tree topology, and ii) a more complex model with two free
parameters resembling the resolved tree topology. Subsequently, we applied a likelihood
ratio test to infer whether the more complex model explains the data significantly better
than
the
simpler
model.
This
test
assumes
that
the
test
variable
  2  log lik resolved   log lik star is approximately 2 distributed with one degree of
freedom. A rejection of the simpler model indicates that the information in the data is

sufficient to allow a meaningful reconstruction of the phylogenetic relationships of the
7
taxa under study. To infer the posterior probabilities by which each of the three possible
resolved sequence trees is supported by the data, we calculated the likelihoods of the data
individually for all three topologies. Posterior probabilities were then calculated as
following: P( | D)  P(D | T)  P(T) /P(D) , where P(D | T) denotes the likelihood of the
data given the tree, P(T) is the prior probability of the tree (set to 1/3 for each of the
three trees) and P(D) is the total probability of the data over all three possible


hypotheses. Our analysis obtained the following log likelihoods: ((Asian elephant,

mammoth), African elephant): -26076.00, ((African elephant, mammoth), Asian

elephant): -26079.4, and ((African elephant, Asian elephant), mammoth): -26078.8.
Posterior probabilities were calculated from these log likelihoods using the perl script
post_prob.pl.
The short internal branch of the phylogenetic tree for mammoth, African and
Asian elephant makes it likely that polymorphisms from the ancestral species may have
persisted between the two speciation events19. This situation occurs, for example, for
nuclear markers in humans, chimpanzees and gorillas20. As the internal branch for
mammoth, African and Asian elephant is even shorter relative to the overall length of the
tree than for the three primate species, the problem of lineage sorting is likely to also be
even more severe for mammoth, African and Asian elephant than for humans and African
great apes. Thus, it is possible that, despite the smaller effective population size of
mitochondrial DNA compared to nuclear sequences, and contrary to the case of humans
and African great apes, the phylogeny obtained for the mtDNA genomes of mammoth,
African and Asian elephant does not represent the species phylogeny. However, as no
comprehensive data are available for either the generation time or the effective
population size of mammoth and the living elephants, it is not possible to estimate the
likelihood that the mtDNA sequence phylogeny does not represent the species phylogeny.
Finally, the comparison between the mammoth, African and Asian elephant tree and
the human-chimp-gorilla (HCG) tree (Fig. 3b) reveals striking differences. The HGC
mtDNA divergence is more than twice as great and the internal branch is more than twice
as long, relative to the total number of changes in the tree (17.6% vs. 7.3%). Both an
excellent fossil record21 and molecular estimates22 indicate that humans and chimpanzees
diverged roughly six million years ago. Evidently, either the substitution rates on the
8
HGC and elephantidae trees differ by more than a factor of two or the common ancestor
of the elephantidae was present much more recently than six million years ago. However,
the fossil record indicates a common ancestor around six million years ago also for
elephantidae23 Thus, the fact that the overall length of the phylogenetic tree for
mammoth, African and Asian elephant is only about half the length of the tree for human,
chimpanzee and gorilla (Fig. 3a), indicates a slower rate of nucleotide substitution in the
mitochondrial DNA of mammoth, African and Asian elephant. The temporally close
divergence events around six million years ago thus inferred for both species groups raise
the possibility that both population divergences may have been triggered by the same
cause. Further analyses are necessary to either confirm or reject this hypothesis.
Table S2. Results using various tree-building methods and outgroups. NJ: neighbor
joining; MP: maximum parsimony; ML: maximum likelihood. For each combination of
tree building method and outgroup, the bootstrap value (or posterior probability for the
Bayesian trees) and the sister group relationship are shown (M-L: mammoth – African
elephant; M-E: mammoth – Asian elephant).
Tree
reconstruction
method
NJ
MP
ML
Bayesian
Outgroup
Dugong
73 / M-L
62 / M-E
56 / M-L
97 / M-L
Hyrax
83 / M-E
93 / M-E
79 / M-E
91 / M-E
Both
87 / M-E
90 / M-E
54 / M-L
100 / M-E
Addition of the published nuclear DNA sequences that are shared between mammoth,
Asian and African elephants and the outgroup species does not change the tree topologies
inferred for the mtDNA sequence alone. In all cases, the bootstrap values and posterior
probabilities did not differ significantly from those obtained for the mtDNA-only
alignment. Thus, on multiple runs, scores did not vary by more than ±3 from the values
for the mtDNA-only analyses.
9
References
1.
2.
3.
4.
5.
6.
7.
8.
9.
10.
11.
12.
13.
14.
15.
16.
17.
Hofreiter, M. et al. Evidence for reproductive isolation between cave bear
populations. Curr Biol 14, 40-3 (2004).
Kolmann, C. J. & Tuross, N. Ancient DNA Analysis of Human Populations.
American Journal of Physical Anthropology 111, 5-23 (2000).
Hofreiter, M., Serre, D., Poinar, H. N., Kuch, M. & Pääbo, S. Ancient DNA. Nat
Rev Genet 2, 353-9. (2001).
Wandeler, P., Smith, S., Morin, P. A., Pettifor, R. A. & Funk, S. M. Patterns of
nuclear DNA degeneration over time--a case study in historic teeth samples. Mol
Ecol 12, 1087-93 (2003).
Serre, D. et al. No evidence of neandertal mtDNA contribution to early modern
humans. Plos Biology 2, 313-317 (2004).
Kwok, S. et al. Effects of primer-template mismatches on the polymerase chain
reaction: human immunodeficiency virus type 1 model studies. Nucleic Acids Res
18, 999-1005. (1990).
Handt, O., Krings, M., Ward, R. H. & Pääbo, S. The retrieval of ancient human
DNA sequences. Am J Hum Genet 59, 368-76 (1996).
Hansen, A., Willerslev, E., Wiuf, C., Mourier, T. & Arctander, P. Statistical
evidence for miscoding lesions in ancient DNA templates. Mol Biol Evol 18, 2625. (2001).
Hofreiter, M., Jaenicke, V., Serre, D., Haeseler Av, A. & Pääbo, S. DNA
sequences from multiple amplifications reveal artifacts induced by cytosine
deamination in ancient DNA. Nucleic Acids Res 29, 4793-9. (2001).
Gilbert, M. T. et al. Characterization of genetic miscoding lesions caused by
postmortem damage. Am J Hum Genet 72, 48-61 (2003).
Lunt, D. H., Whipple, L. E. & Hyman, B. C. Mitochondrial DNA variable number
tandem repeats (VNTRs): utility and problems in molecular ecology. Mol Ecol 7,
1441-55 (1998).
Pusch, C. M. & Bachmann, L. Spiking of Contemporary Human Template DNA
with Ancient DNA Extracts Induces Mutations Under PCR and Generates
Nonauthentic Mitochondrial Sequences. Mol Biol Evol 21, 957-964 (2004).
Pusch, C. M. et al. PCR-induced sequence alterations hamper the typing of
prehistoric bone samples for diagnostic achondroplasia mutations. Mol Biol Evol
21, 2005-11 (2004).
Serre, D., Hofreiter, M. & Pääbo, S. Mutations Induced by Ancient DNA
Extracts? Mol Biol Evol 21, 1463-1467 (2004).
Hofreiter, M. et al. Lack of phylogeography in European mammals before the last
glaciation. Proc Natl Acad Sci U S A 101, 12963-8 (2004).
Handt, O., Höss, M., Krings, M. & Pääbo, S. Ancient DNA: methodological
challenges. Experientia 50, 524-9 (1994).
Leonard, J. A., Wayne, R. K. & Cooper, A. Population genetics of ice age brown
bears. Proc Natl Acad Sci U S A 97, 1651-4 (2000).
10
18.
19.
20.
21.
22.
23.
Shinde, D., Lai, Y., Sun, F. & Arnheim, N. Taq DNA polymerase slippage
mutation rates measured by PCR and quasi-likelihood analysis: (CA/GT)n and
(A/T)n microsatellites. Nucleic Acids Res 31, 974-80 (2003).
Nei, M. in Evolutionary perspectives and the new genetics (eds. Gershowitz, H.,
Rucknagel, D. L. & Tashian, R. E.) 133-147 (Alan R. Liss, Inc., New York,
1986).
Chen, F. C., Vallender, E. J., Wang, H., Tzeng, C. S. & Li, W. H. Genomic
divergence between human and chimpanzee estimated from large- scale
alignments of genomic sequences. J Hered 92, 481-9. (2001).
Brunet, M. et al. A new hominid from the Upper Miocene of Chad, Central
Africa. Nature 418, 145-51 (2002).
Glazko, G. V. & Nei, M. Estimation of divergence times for major lineages of
primate species. Mol Biol Evol 20, 424-34 (2003).
Tassy, P. Elephantoidea from Lothagam (ed. Leakey, M. H., JM, eds) (Columbia
University Press, New York, 2003).