Lab Assignments.
In this manual all or parts of Assignments 1, 2 and 3 have been adapted from the series
‘Voyages through Time’ produced by the SETI institute for educational purposes.
Copyright 2002 SETI Institute
Assignment #1 – Chemical Compounds and DNA/RNA
This lab will look at some of the basic chemical structures of life. This lab focussed on
carbon compounds and on the code for life – DNA and RNA. You will be required to
assemble and draw several compounds and to examine the similarities in several samples
of RNA from different organisms. In DNA/RNA each protein is represented by a 3 base
(the bases are represented by A, C, T/U, G) condon. The sequence of amino acids then
represents a protein
There are two parts to this lab,
In the first you will be using organic modelling kit pieces to try on construct chemical
compounds. Carbon forms the basis of organic life. As carbon can form 4 bonds it can
form a wide array of chemical compounds and structures. Two substances might have the
same basic atoms, but different ways of connecting the carbons can result in vastly
different chemical properties. Organic chemistry is the study of the compounds formed
with carbon. To be considered an organic compound, a molecule MUST have carbon and
hydrogen atoms in its make up. Organic compounds may also contain other atoms,
oxygen and nitrogen are particularly common in organic compounds.
1. Take out 6 carbon atoms, and see how many different ways you can arrange the
bonding structure. Remember the angle of the bonds is irrelevant; the important
factor here is how the carbons are joined. Please sketch each 3 straight line and
3 cyclical arrangements you come up with.
PART B
In the second part you will be examining several strands of DNA/RNA on a sheet
provided in the lab. DNA is a double strand (twisted to form the famous double helix)–
where as RNA is a single strand. In this exercise you will be comparing several strands
for similarities and differences. Condons are pieces of information representing amino
acids. Each condon has 3 letters, which represent 1 amino acid (see table page 177 of
text)
RNA Sequences
Cut the following into strips, leaving the name of the organism attached. See your lab
manual for further instructions.
-------------------------------------------------------------------------------cut------------------------Human (even)
GUGCCAGCAGCCGCGGUAAUUCCAGCUCCAAUAGCGUAUAUUA
AAGUUGCUGCAGUUAAAAG
-----------------------------------------------------------------------------------------------------------Yeast (odd)
GUGCCAGCAGCCGCGGUAAUUCCAGCUCCAAUAGCGUAUAUUA
AAGUUGUUGCAGUUAAAAG
-----------------------------------------------------------------------------------------------------------Escherichia coli (bacterium)(odd)
GUGCCAGCAGCCGCGGUAAUACGGAGGGUGCAAGCGUUAAUCG
GAAUUACUGGGCGUAAAGC
-----------------------------------------------------------------------------------------------------------Thermotoga maratima (bacterium)(even)
GUGCCAGCAGCCGCGGUAAUACGUAGGGGGCAAGCGUUACCCG
GAUUUACUGGGCGUAAAGG
-----------------------------------------------------------------------------------------------------------Thermococcus celer (bacterium) (odd)
GUGGCAGCCGCCGCGGUAAUACCGGCGGCCCGAGUGGUGGCCG
CUAUUAUUGGGCCUAAAGC
-----------------------------------------------------------------------------------------------------------Sulfolobus sulfotaricus (bacterium) (even)
GUGUCAGCCGCCGCGGUAAUACCAGCUCCGCGAGUGGUCGGGG
UGAUUACUGGGCCUAAAGC
Comparing Molecular Data
In this activity you are going to contrast sequences of about 60 bases and look for areas
where the sequences are DIFFERENT.
Cut the RNA Sequences sheet into strips. Compare the letters of the sequence for the six
organisms above. Fill in the table given.
Interpreting the data:
1. According to the number of substitutions (differences in the sequence) found for
the rRNA fragment, which pair of organisms have the greatest similarities?
2. Which pair of organisms are the least closely related?
3. Make three different lists placing those organisms most alike together.
4. How many condons are shown for all organisms?
5. Based on whether the LAST digit of your student number is even or odd, interpret
the sequence of amino acids for one of the organisms. (i.e. some with an even last
digit would do Humans or Thermotoga maratima or Sulfolobus sulfotaricus .
(please note there may not be an exact number of condons)
Name:
Answer Sheet - Lab # 1
Part A
1. Sketch carbon compounds
Student Number:
Name:
Answer Sheet - Lab # 1
Student Number:
.
Part B
Organism
Human
Yeast
E. coli
Thermotoga
Thermococcus
Sulfolobus
Thermococcus
Thermotoga
E. Coli
Yeast
Interpreting the data:
1. According to the number of substitutions (differences in the sequence) found for
the rRNA fragment, which pair of organisms have the greatest similarities?
2. Which pair of organisms are the least closely related?
3. Make three different lists placing those organisms most alike together.
4. How many condons are shown for all organisms?
5. Based on whether the LAST digit of your student number is even or odd, interpret
the sequence of amino acids for one of the organisms. (i.e. some with an even last
digit would do Humans or Thermotoga maratima or Sulfolobus sulfotaricus) Use
the genetic code table found on page177 of your text.