BioSc 231
General Genetics
Exam 4
Name __________________________________
Multiple Choice. (2 points each)
_____ Type of mutation in which a pyrimidine is substituted for a purine
A. Transition
B. Transversion
C. Frameshift
D. Conversion
E. Inversion
_____ Type of mutation caused by an addition or deletion of a base in a polypeptide-encoding
part of a gene
A. Transition
B. Transversion
C. Frameshift
D. Conversion
E. Inversion
_____ Type of mutation in which a purine is substituted for a purine
A. Transition
B. Transversion
C. Frameshift
D. Conversion
E. Inversion
_____ A type of microorganism that can exist on minimal medium
A. Conditional
B. Lethal
C. Auxotroph
D. Prototroph
E. Autotroph
_____ A mutation that causes a mutant phenotype only under restrictive conditions
A. Conditional
B. Lethal
C. Auxotroph
D. Prototroph
E. Autotroph
_____ A biochemical mutant that must be supplied with a particular nutrient for growth
A. Conditional
B. Lethal
C. Auxotroph
D. Prototroph
E. Autotroph
_____ A base change resulting in a codon specifying the same amino acid as found in the wild-type polypeptide.
A. Missense
B. Silent
C. Nonsense
D. Synonymous
E. Frameshift
_____ A base change resulting in a codon specifying an amino acid which is different than in the wild-type polypeptide
A. Missense
B. Silent
C. Nonsense
D. Synonymous
E. Frameshift
_____ A base change that changes a codon for an amino acid to a stop codon
A. Missense
B. Silent
C. Nonsense
D. Synonymous
E. Frameshift
_____ After mutagen treatment, a molecule of 2-aminopurine (an adenine analogue) incorporates into DNA. During replication the
2-AP protonates caussing it to base-pair like guanine. The mutational event caused by this will be
A. AT to CG
B. GC to AT
C. AT to TA
D. AT to GC
E. GC to CG
_____ A researcher studying hemoglobin predicts that a histidine within the protein is important for binding oxygen. She used sitedirected mutagenesis to change a codon for histidine (CAU) to one for lysine (AAA). However, the mutant hemoglobin still binds
oxygen just as well as the wild-type and has no other apparent changes. This type of mutation is called
A. suppression
B. synonymous
C. nonsense
D. silent
E. frameshift
_____ A new Penicillium mutant was tested for auxotrophy. The mutant grows on:
minimal medium (M) + arginine (A) + proline (P)
M + P + histidine (H)
M+A+H+P
but not on M
or on M + A + H. The mutant requires
A. Arginine
B. Histidine and proline
C. Histidine
D. Arginine and proline
E. Proline
_____ A bacterial histidine mutant was plated on minimal medium. A single colony grew. This
colony must have arisen from a
A. forward mutation
B. suppressor mutation
C. auxotrophic mutation
D. back mutation
E. back mutation OR suppressor mutation
_____ A mutant allele of corn leads to absence of red anthocyanin pigment in the kernel (absence of anthocyanin results in a yellow
color). The allele, however, is unstable, reverting quite late, yet often, in development. The expected phenotype of kernels
homozygous for this mutation is
A. fully red
B. yellow with many large red spots
C. yellow with few large red spots
D. yellow with many small red spots
E. yellow with few small red spots
_____ The fluctuation test of Luria and Delbruck (studying resistance to bacteriophge T1 infection) established that
A. T1 phage was a mutagen.
B. Mutations could arise prior to the time they were selected
C. The mutation rate varies greatly from experiment to experiment.
D. In E. coli the number of mutants per clone was relatively constant.
_____ E. coli cells were spread on two agar plates [one containing only agar (plate 1) and the second containing streptomycin (plate 2)
which kills all cells except those that are resistant mutants]. Both plates were allowed to grow for several generations. Cells were
collected from the agar plate WITHOUT streptomycin and spread again on a fresh agar plate containing streptomycin (plate 3). More
mutants were observed on plate 3 than were observed on plate 2. The experiment demonstrates
A) how to screen for environmental mutagens
B) that mutation occurs in prokaryotes as well as in eukaryotes
C) that in some cases mutations are caused by the selective agent itself
D) that mutations occur in the absence of the selective agent
E) a direct correlation between the amount of the selective agent used and the number of resistant mutants (one-hit relationship)
_____ Forty units of enzyme A are needed to produce a wild-type phenotype. The wild-type allele produces 20 units and a new
mutation produces only five units. The mutation would be
A. dominant
B. codominant
C. recessive
D. conditional
_____ An individual cell homozygous for a mutant allele of the gene for a human enzyme contains no detectable activity for that
enzyme. The mutation is best described as
A. dominant
B. codominant
C. prototrophic
D. null
_____ The rare enol form of thymine pairs with guanine. If a thymine enolization occurs during replication, what would be the
mutational event?
A. CG to AT
B. GC to TA
C. AT to TA
D. TA to CG
_____ A missense mutation in Neurospora will revert by treatment with nitrous acid (causes transversions), but not by hydroxylamine
(causes AT -> GC transitions). The original mutation (not the reversion) must have been
A. AT to GC
B. AT to TA
C. AT to CG
D. GC to AT
_____ A wild-type chromosome can be represented as ABC * DEFGH, and from this a chromosomal aberration arises that can be
represented AED * CBFGH. This is known as
(* = centromere)
A. Deletion
B. Pericentric inversion
C. Translocation
D. Paracentric inversion
E. Duplication
_____ A female Drosophila supposedly heterozygous for two recessive mutations cn and lz that are on the same arm of the X
chromosome (cn lz/+ +) surprisingly expresses both these genes. The male progeny of the female will be
A. all wild type
B. all cn lz
C. 1/2 cn lz and 1/2 wild type
D. cn +
E. + lz
_____ A set of Drosophila deletions was assembled as follows (the lines indicate the region that has been deleted)
Regions
1
2
3
4
5
6
7
a________
b_______________
c____________
d___________
e___________
f___
A radioactive DNA fragment containing a certain gene bound only to chromosomes a and f. The gene must be in the region between
A. 1 and 2
B. 2 and 3
C. 3 and 4
D. 4 and 5
E. 5 and 6
_____ An enzyme that repairs thymine dimers in visible light in E. coli
A. resolvase
B. polymerase
C. photolyase
D. excision repair
E. DNA glycosylase
_____ An enzyme that attacks sites left after loss of a single purine
A. resolvase
B. polymerase
C. photolyase
D. AP endonuclease
E. DNA glycosylase
Problems (variable points each)
(5 pts) Using the table below, determine the amino acid sequence of the polypeptide produced by the following messenger RNA:
ACGUAUGGCGACGUUGCGUUUUCGCUGCUGCAUGAACCGAGAUUGACGCUAAGGCAUGAAAA
(2 pt) A single base change in the above sequence results in a polypeptide that is only 7 amino acids in length. Which codon is
changed and what is the change?
(2 pts) Cancer causing agents are frequently identified by their ability to cause mutations in bacteria (The Ames Test). Briefly
explain the connection between the ability to cause mutations in bacteria and the ability to cause cancer in humans.
(1 pt) Briefly explain the purpose of the mouse liver extracts used in the Ames test.
Bonus Question (5 points). Two enrichment strategies were described in class that make it easier to find mutations in a large
population of cells. One involved fungi and one involved bacteria. Describe one of those enrichment strategies.