Additional Information
Culture Progression of Air-Liquid Interfaced Cells
On days 1, 10, 24, and 28 of air-liquid interface, one culture well was fixed with formalin
and paraffin embedded to observe signs of progressive cell differentiation. Paraffinembedded cultures were sectioned on a microtome, affixed to a microscope slide, and
stained with hematoxylin and eosin using a standard procedure (Veterinary Diagnostic
Lab, Colorado State University). Slides were then imaged using transmitted light
microscopy at 312x magnification (Leitz Light Microscope, Orthoplan, Germany; SPOT
RT Slider Camera, SPOT imaging solutions, Sterling Heights, MI).
On days 1, 10, 24, and 28, total mRNA transcripts from two additional culture wells were
isolated using a standardized kit and protocol (RNeasy mini kit, Qiagen, Valencia, CA).
A DNase digestion step was added to minimize the risk of DNA contamination (RNase
Free DNase Set, Qiagen, Valencia, CA). The purity and quantity of mRNA was assessed
by spectrophotometry at wavelengths of 260 and 280 nm (Nanodrop ND-1000,
ThermoScientific, Wilmington, DE). A sample of mRNA was run through a denaturing
gel to assess the RNA integrity by using a standard protocol (Denaturing Agarose Gel
Electrophoresis of RNA, Ambion Applied Biosystems, Carlsbad, CA). Transcripts were
stored at -80ºC prior to analysis with real-time RT PCR. A starting quantity of 50 ng
RNA was used to follow a standard real-time RT PCR protocol (Biorad One-Step RTPCR Kit with SYBR Green, Bio-Rad Laboratories, Hercules, CA) to amplify three genes
associated with cell mucociliary progression of human bronchial epithelial cells:
MUC5AC and MUC5B for mucus production and TUBA3 for ciliogenesis. The Livak
ΔΔCt method was used to normalize copy numbers with gylceraldehyde-3-phosphate
dehydrogenase (GAPDH) as the reference gene. A water blank and a non-reverse
transcriptase control were run to identify any DNA contamination. The following primer
and probe sets were synthesized by Integrated DNA Technologies (Coralville, IA) for the
RT-RT PCR analysis[sense, antisense]: MUC5AC
[CTGAGGGTCTCAGGAATGACGC; TTTATGCAACAGATTGGCCGTG]; MUC5B
[CTCAGCCCTGAGTTACCCTG;
AACTAAGCATGTGCGGGC]; TUBA3 [CTTCACCTTCTTCAGCCTCG;
AAGGTGCAGCGGGCT]; GAPDH [GAAGGTGAAGGTCGGAGTC;
GAAGATGGTGATGGGATTTC; CAAGCTTCCCGTTCTCAGCC].
Deposition Efficiency Tests
Particle deposition efficiency tests were conducted to determine PM exposure levels
received by each cell culture well within the EAVES. Up to nine air-liquid interfaced cell
cultures could be exposed at a single time within the EAVES. The objective of these tests
was to determine the magnitude and uniformity of particle deposition across the cell
culture growth area. These tests were conducted under the same operating conditions as
the cook stove exposures, except that ammonium fluorescein of similar size was used as
the test aerosol. The relative flux of fluorescence was measured using a fluorescent plate
reader (FLX-800, BioTek Inc, Winooski, VT).
Real time RT PCR analysis of pro-inflammatory markers
A starting quantity of 50 ng RNA was used to follow a standard real-time RT PCR
protocol (Biorad One-Step RT-PCR Kit with SYBR Green, Bio-Rad Laboratories,
Hercules, CA). Water blanks and non-Reverse transcriptase controls were used to detect
DNA contamination. Primers were designed for IL-8, COX-2, HOX-1, and GAPDH. The
reliability of the primers was tested through the generation of standard curves prior to
analysis (see below). The Livak ΔΔCt method was used to normalize copy numbers with
gylceraldehyde-3-phosphate dehydrogenase (GAPDH) as the reference gene. The
following primer and probe sets were synthesized by Integrated DNA Technologies
(Coralville, IA) for the real-time-RT PCR analysis
[sense, antisense]: IL-8 [TTGGCAGCCTTCCTGATTTC;
TATGCACTGACATCTAAGTTCTTTAGCA]; HOX-1
[CAGCAACAAAGTGCAAGATTCTG; AGTGTAAGGACCCATCGGAGAAG] COX2 [GAATCATTCACCAGGCAAATTG; TCTGTACTGCGGGTGGAACA]; GAPDH
[GAAGGTGAAGGTCGGAGTC; GAAGATGGTGATGGGATTTC].
Real time RT PCR Reaction Efficiency
A tenfold dilution series of total mRNA was used with each primer set to create a
standard curve to assess the reliability of each primer set and the PCR efficiency for
GAPDH, IL-8, HOX-1, COX-2, MUC5AC, MUC5B, and TUBA3. A standard real-time
RT PCR protocol (Biorad One-Step RT-PCR Kit with SYBR Green, Bio-Rad
Laboratories, Hercules, CA) was followed for the generation of the standard curve for
each gene of interest.
Results
Air-Liquid Interfaced NHBE Cells
The physical progression of the NHBE cells grown at an air-liquid interface (ALI) can be
seen in Figure 2. The NHBE cells underwent progressive differentiation over the course
of 24 days. The expression profiles for mRNA transcripts (MUC5B, MUC5AC, and
TUBA3) associated with NHBE ALI mucociliary progression can be seen in Figure 3.
Day 24 and 28 ALI images capture cell cultures with a pseudo-stratified columnar
epithelium with signs of basal, goblet, and ciliated cell types.
Collection Efficiency and Percent Deposition within the EAVES
Six of the nine cell culture wells were identified as having consistent, uniform
ammonium fluorescein aerosol deposition. These six wells were used for cell exposures.
The average percent deposition of ammonium fluorescein particles into the cell culture
wells ranged from 4.2-5.6% of the total ammonium fluorescein deposited within the
EAVES chamber.
Real time RT PCR Reaction Efficiency
A starting RNA quantity of 0.5 ng, 5 ng, 50 ng, and 500 ng yielded a PCR efficiency for
all primer sets that was between 94-108%. R2 values for the standard curves ranged from
0.95-1.00.
Supplementary Figure 1. Photographs of Traditional and Improved Cook Stoves: A)
Example of a traditional ‘three-stone fire’; B) The Gen3300 rocket elbow cook stove
distributed by Envirofit International, Inc.; C) The Phillips Gasifier stove distributed by
Phillips, Inc.
Supplementary Figure 2. Formalin-fixed and paraffin-embedded sections from airliquid interface cultures of NHBE cells grown upon a collagen-coated membrane. Cells
were stained with hematoxylin and eosin. Images are shown at 312x magnification.
Supplementary Figure 3. Box-Whisker Plots of mRNA transcript expression profiles
for mucin and alpha tubulin genes (Day of ALI/Day 1 ALI Expression Level). Expression
levels are also normalized to glyceraldehydes 3-phosphate dehydrogenase (GAPDH).
Days 10, 24, and 28 are shown relative to expression level measured on day 1 of ALI.
The center line within the box indicates the median and the top and bottom ends of the
box represent the upper and lower quartiles, respectively.
Supplementary Figure 1
day 1
10 µm
collagen-coated membrane
day 10
day 24
Supplementary Figure 2
50
TUBA3
40
30
Relative mRNA Expression, Dayi / Day1
20
10
0
MUC5B
300
250
200
150
100
50
0
MUC5AC
300
250
200
150
100
50
0
Day 1
Day 10 Day 24 Day 28
Supplementary Figure 3