1 Chloroplast CAPS1 assay
To identify CAPS differentiating B. napus chloroplast type from B. oleracea and B. rapa , a preliminary sequencing screen was performed on a B. napus accession (cultivar Apex) with the result compared to a published sequence of the whole B. rapa genome
(AC189190). CAPS1 assay used in this work is described below:
A primer pair (forward: 5’atttccttcagattgagccg 3’; reverse: 5’gaatattactctcgacagac 3’) targeting the YCF3 gene region was designed from the AC189190 accession sequence.
A PCR was performed with this primer pair using a DNA sample from the cultivar Apex.
For PCR preparation, 5 ng of template DNA was added to a 5µl final volume reaction prepared from a 2X BIOMIX PCR mix, which contained each primer at a concentration of a 200nm. The following thermocycle programme was used: 2 min at 95 o C and 35 cycles of 30s at 94 o
C, 30s at 55 o
C and 60s at 72 o
C. The amplification product was cleaned using the Nucleofast 96 PCR cleanup kit (Macherey-Nagel) and directly sequenced with both forward and reverse primers using Big Dye chemistry following the manufacturer protocol (Applied Biosystems). The resulting sequenced (GenBank accession EF374031) was aligned to the AC189190 B. rapa accession. A SNP differentiating B. napus to B. rapa was identified at the position 32375 of the accession
AC189190. The nucleotide switch from A to G (highlighted in red) disables the restriction site targeted specific to Bcl1 (highlighted in blue). B. oleracea (chloroplast
GenBank accession AC183493) has an identical sequence to B. rapa .
Apex (EF374031)
AC189190
TGGTTAATAGATACCTTTTTTGATCAGAAAAATTGGAAG
TGGTTAATAGATACCTTTTTTGATCGGAAAAATTGGAAG
A new primer pair was designed for the CAPS1 assay (forward primer:
5’gaaagtacggaaagagaggg 3’; reverse primer: 5’cttggcataggtagtaatcc 3’).
For PCR preparation, 5 ng of template DNA was added to a 5µl final volume reaction prepared from a 2X BIOMIX PCR mix, with each primer adjusted to a concentration of a

200nm. The following thermocycle programme was used: 2 min at 95 o
C and 35 cycles of 30s at 94 o
C, 30s at 55 o
C and 30s at 72 o
C.
The PCR products were then restricted for 2h at 55 o C in 20µl reaction mix comprising of
1X restriction buffer and 1 unit of Bcl1 (FERMENTAS). Products were then fractionated by agarose electrophoresis (45 min at 100V on a 1% w/v agarose in 1x TAE).
Fig. a.
Gel agarose electrophoresis of CAPS1 products. The restriction of CAPS1
(fragment size 342 bp) produces two fragments (size of 180bp and 162bp) that co-migrate under the conditions used. L: 100bp ladder; 1: B. napus cultivar Apex (restricted); 6, 7,
8, 19, 20, 21, 23 and 30: B. rapa bearing the rapeseed chloroplast haplotype (i.e. restricted PCR products); remaining samples are all B. rapa bearing the haplotype typical of the species (i.e. unrestricted products).
L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 L 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 L

2 Chloroplast High Resolution Melt SNPs
In order to identify SNPs differentiating the typical B. napus chloroplast type from those of B. oleracea and B. rapa , a preliminary sequencing screen was performed using amplicons generated from the B. napus accession ‘cultivar Apex’. These sequences were then compared with published sequences available for the B. rapa chloroplast genome
(AC189190). Two SNPs were discovered in this way. For genotype characterization of plants collected from the field, these SNPs were then used to define ‘ B. napus ’ or ‘ B. rapa
’ haplotypes using High Resolution Melt analysis (HRM). HRM involves the precise monitoring of the change in fluorescence caused by the release of an intercalating
DNA dye from a DNA duplex as it is denatured by increasing temperature. Differences in sequences are revealed by variation observed in the melting curve of the products allows for accurate allele assignation (Krypuy et al.
2006). The designing of the two SNP assays and detail of the HRM procedure are described below.
2.1
Chloroplast HRM assay SNP1
A primer pair (forward: 5’gttgcgatcaggtctcttcat 3’; reverse: 5’ tctggatattcctcaatgccc 3’) targeting the YCF2 gene region was designed from the B. rapa chloroplast genome
(accession AC189190). Following the protocols described for the design of chloroplast
CAPS1 (see above 2.1 ) the PCR product obtained from B. napus cultivar Apex was sequenced (GenBank accession EF374033) and aligned to AC189190. This revealed a single SNP. A new primer pair (forward primer: 5’tcaagaattgtctttgatccaatcc 3’; reverse primer: 5’agaaatggcagatctattcactcta 3’) was then designed such that this SNP (highlighted in red; at the position 80518 of the B. rapa accession AC189190) featured in an amplicon of 110 bases. The use of a small amplicon increases the resolution of HRM for allele binning.
Apex (EF374033)
AC189190
AATCAATAGAAAAGGCAAATCCCTTATGATACACCAGATC
AATCAATAGAAAAGGCAAATCCCGTATGATACACCAGATC

The HRM analysis was run on a Rotorgene 6000 (Corbett). 10 ng DNA was added to 10 micro of a PCR mixture prepared from a 2X Sensimix (Quantace) which contained both primers at a concentration of 200nM and 1µl of 1/100 solution of Syto9 (Invitrogen).
PCR amplifications were performed using the following conditions: 95 o
C for 10 min and
35 cycles of 5s at 95 o C,
5s at 50 o
C and 5s at 72 o
C. This step was followed by a melting stage including a rise in temperature from 70 o C to 79 o C with an initial hold at 70 o C for 90s followed by a gradual increase of the temperature by 0.1 o C with a 2s hold at each step. Fluorescence levels were acquired at the end of each step and a melting curve of the PCR product was obtained from the recorded values. The generated data were analysed using the High
Resolution Melt option available on the Rotor-Gene 6000 Series Software 1.7.
Fig. b.
Normalised melting curve of HRM SNP1 PCR products. The orange melting curve is typical of the haplotype found in B. napus (SNP: T). The red melting curve represents PCR products with the alternative ( B. rapa ) haplotype (SNP: G). Fluorescence is on the Y axis and temperature in degrees Celsius on the X-axis.
100
40
30
20
70
60
90
80
50
10
72 72.25 72.5 72.75
73 73.25 73.5 73.75
74 74.25 74.5 74.75
75 75.25 75.5 75.75
76 76.25 76.5 76.75
77 77.25 77.5 77.75
ºC

2.2
Chloroplast HRM assay SNP2
A primer pair (forward: 5’caagatccattacgtgtccaagg3’; reverse: 5’gtgtcgaagactcgcaagac 3’) targeting cytochrome F was designed from the B. rapa chloroplast genome (accession
AC189190). Following the protocols described for CAPS1 (see above 2.1), the PCR amplicon from B. napus cultivar Apex was sequenced (GenBank accession EF374036) and aligned to AC189190. A SNP was identified between the two sequences. In order to distinguish the two haplotypes, a new primer pair was designed (forward primer:
5’tagatctgtctatttcgccttatca 3’; reverse primer: 5’gacaagtaattcctgacacctggtc 3’) such that the amplicon containing this SNP (positioned at 14705 on the accession AC189190) was contained in a product of 121bases. .
Apex (EF374036)
AC189190
TAAAAAAGAAAGAACAAAAAAAATTATCAAAAGCC
TAAAAAAGAAAGAACCAAAAAAATTATCAAAAGCC
This SNP was screened by High Resolution Melt analysis on a Rotorgene 6000 (Corbett).
For this, 10 ng DNA was added to 10 ul of a PCR mixture prepared from a 2X Sensimix
(Quantace) which contained both primers at a concentration of 200nM and 1µl of 1/100 solution of Syto9 (Invitrogen).
PCR amplifications were performed using the following conditions: 95 o
C for 10 min and 35 cycles of 5s at 95 o
C, 5s at 50 o
C and 5s at 72 o
C. This was followed by a melting stage including a rise in temperature from 70 o
C to 79 o
C with an initial hold at 70 o
C for
90s followed by a gradual increase of the temperature by 0.1 o
C with a 2s hold at each step. Fluorescence levels were acquired at the end of each step with the collective and a melting curve of the PCR product being obtained from all recorded values. Data were analysed using the High Resolution Melt option available on the Rotor-Gene 6000 Series
Software 1.7.

Fig. c.
Normalised Melting curve of SNP2 PCR products. The orange melt curve representing that typical of the B. napus haplotype (SNP: A). The red melting curve representing the alternate allele typical of B. rapa (SNP: C). Fluorescence is on the Y axis and temperature in degrees Celsius on the X-axis.
50
40
30
70
60
100
90
80
20
10
70.5
71 71.5
72 72.5
73 73.5
ºC
74 74.5
75 75.5
76 76.5
Reference
Krypuy M, Newnham GM, Thomas DM, Conron M, Dobrovic A (2006) High resolution melting analysis for the rapid and sensitive detection of mutations in clinical samples:
KRAS codon 12 and 13 mutations in non-small cell lung cancer. BMC Cancer, 6 , 295.