Suppression of the migration and invasion is mediated by triptolide in B16F10
mouse melanoma cells through the NF-kappaB-dependent pathway
Hui-Yu Jao1, Fu-Shun Yu2, Chun-Shu Yu3, Shu-Jen Chang3, Kuo-Ching Liu4,
Ching-Lung Liao5, Da-Tian Bau6,7,*, and Jing-Gung Chung1,8,*
1
Department of Biological Science and Technology, China Medical University,
Taichung 404, Taiwan;
2
Department of Dentist, China Medical University, Taichung 404, Taiwan;
3
School of Pharmacology, China Medical University, Taichung 404, Taiwan;
4
Department of Medical Laboratory Science and Biotechnology, China Medical
University, Taichung 404, Taiwan, ROC
5
Graduate Institute of Chinese Medicine, China Medical University, Taichung 404,
Taiwan, ROC
6
Institute of Clinical Medical Science, China Medical University, Taichung
404, Taiwan;
7
Terry Fox Cancer Research laboratory, China Medical University Hospital, Taichung
404, Taiwan;
8
Department of Biotechnology, Asia University, Taichung 413, Taiwan.
Running title: Triptolide inhibited migration and invasion of B10F6 melanoma cells
* These authors contributed equally to this work.
Competing Interests: The authors have declared that no competing interests exist.
*Address correspondence to Prof. Jing-Gung Chung, Department of Biological
Science and Technology, China Medical University, No 91, Hsueh-Shih Road,
Taichung 40402, Taiwan. Tel: +886-4-2205 3366 ext 2531, fax: +886-4-2205 3764.
E-mail address: jgchung@mail.cmu.edu.tw
*Address correspondence to Prof. Da-Tian Bau, Terry Fox Cancer Research Lab.,
China Medical University Hospital, 2 Yuh-Der Road, Taichung 404, Taiwan. Tel:
+886 422052121 ext 7534. Email address: artbau@gmail.com
Abstract. Melanoma cancer is one of the major causes of death in humans worldwide.
Triptolide is one of the active components of Tripterygium wilfordii Hook F, and has
biological activities including induced cell cycle arrest and induction of apoptosis but
its antimetastatic effects on murine melanoma cells have not yet been elucidated.
Herein, we investigated the effect of triptolide on the inhibition of migration and
invasion and possible associated signal pathways in B16F10 murine melanoma cancer
cells. Wound healing assay and Matrigel Cell Migration Assay and Invasion System
demonstrated that triptolide marked inhibiting the migration and invasion of B16F10
cells. Gelatin zymography assay demonstrated that triptolide significantly inhibited
the activities of matrix metalloproteinases-2 (MMP-2). Western blotting showed that
triptolide markedly reduced CXCR4, SOS1, GRB 2, p-ERK, FAK, p-AKT, Rho A,
p-JNK, NF-B, MMP-9 and MMP-2 but increased PI3K and p-p38 and COX2 after
compared to the untreated (control) cells. Real time PCR indicated that triptolide
inhibited the gene expression of MMP-2, FAK, ROCK-1 and NF-B but did not
significantly affect TIMP-1 and -2 gene expression in B16F10 cells in vitro. EMSA
assay also showed that triptolide inhibited NF-B DNA binding in a dose-dependent
manner. Confocal laser microscopy examination also confirmed that triptolide
inhibited the expression of NF-B in B16F10 cells. Taken together, we suggest that
triptolide inhibited B16F10 cell migration and invasion via the inhibition of NF-B
expression then led to suppress MMP-2 and -9 expressions.
Keywords: migration; invasion; triptolide; B16F10 mouse melanoma cells;
NF-kappaB-dependent pathway.
Introduction
Malignant melanoma has been recognized to be one of the most lethal and aggressive
malignancies in human (Siegel et al., , 2013) and the incidence of melanoma are
worldwide. Metastatic melanoma is characterized by a high mortality rate (Garbe and
Leiter, 2009). Patients with malignant melanoma were hard to treat due to resistance
to standard chemotherapy (Jilaveanu et al., , 2009). Currently, the treatments of
melanoma in clinical patients are surgery, chemotherapy, and radiotherapy or a
combination of these therapies. However, the cure rate is still unsatisfactory. Thus,
there is an urgent need to find new compound or novel treatments for melanoma
patients. After compared to basal cell carcinoma and squamous cell carcinoma,
melanoma has a higher metastatic potential.
Metastasis is one of the factors for affecting the treatment of cancer and is
associated with mortality with metastatic diseases rather than the primary tumor
(Tang et al., , 2012). Metastasis is a multistep process, at first cancer cells to detach
from primary tumor, then to migrate, adhesive and invade to the blood or lymphatic
vessels and they need matrix metalloproteinases (MMPs) for cancer cells to the target
tissues or organs. Thus, MMPs play important roles for metastasis formation. It is
well documented that the expression and activity of MMPs can enhance many types
of human cancers with advanced tumor stage and shortened survival (Egeblad and
Werb, 2002). Therefore, inhibition of MMPs of cancer cells may lead to improve
cancer therapy in patients (Egeblad and Werb, 2002).
Triptolide, a diterpene triepoxide, is one of the components from the Chinese herb
Tripterygium wilfordii, and has been shown to induce cell death in many human
cancer cells such as breast cancer, lung cancer, pancreatic cancer, bladder cancer, and
cervical cancer and colorectal carcinomas (Banerjee et al., , 2013; Chen et al., , 2014;
Clawson et al., , 2010; Jiang et al., , 2001; Kim et al., , 2010; Li et al., , 2010; Liu et
al., , 2009; Yang et al., , 2003) including melanoma cancer cells (Hung et al., , 2013).
Triptolide have been shown to inhibit human melanoma A375 cells proliferation and
induce apoptosis through a NF-B-mediated mechanism (Tao et al., , 2012). It was
reported that triptolide reduced pancreatic cell growth and metastases of tumors in
vivo (Mujumdar et al., , 2010). Triptolide have been shown to inhibit experimental
metastasis of B16F10 cells to the lungs and spleens of mice (Yang et al. , 2003).
Triptolide induces down-regulation of hST8Sia I gene expression through NF-κB
activation in human melanoma cells (Kwon et al., , 2010).
Although triptolide have been shown to induce cell death of human melanoma and
mouse melanoma cells, however, there is no available information to show triptolide
inhibits migration and invasion of mouse melanoma cell. Thus, we investigate the
effects of triptolide on migration and invasion of mouse melanoma B16F10 cells in
vitro. The present results clearly indicate that triptolide inhibited the migration and
invasion of B16F10 melanoma cells through the inhibition of the NF-B signal
pathways.
Materials and Methods
Chemicals and reagents. Triptolide, dimethyl sulfoxide (DMSO), propidium iodide
(PI), Tris-HCl, Trypsin, Trypan blue and -Actin were purchased from Sigma
Chemical Co. (St. Louis, Missouri, USA). Control cultures received the carrier
solvent (0.5% DMSO). Dulbecco's Modified Eagle's Medium (DMEM), fetal bovine
serum (FBS), L-glutamine and penicillin-streptomycin was obtained from Invitrogen
(Carlsbad, California, USA). Triptolide was dissolved in DMSO and stored at -20˚C.
Antibodies against CXCR4 was obtained from Novus (Novus Biologicals, Littleton,
CO, USA). MMP-9, MMP-2, p-ERK, p-JNK, p-p38, PKC, p-AKT, NF-B and Rho
A were purchased from Santa cruz (Santa Cruz Biotechnology, Inc. Calif, USA).
SOS1, GRB2, Ras, PI3K, COX2 were obtained from BD (BD Biosciences,
Heidelberg, Germany). FAK was obtained from Upstate (Upstate, Lake Placid, NY).
Cell culture and viability assay. B16F10 mouse melanoma cancer cell line was
obtained from the Food Industry Research and Development Institute (Hsinchu,
Taiwan). Cells were maintained in DMEM medium supplemented with 10% FBS, 0.1
mg/mL streptomycin, and 100 units/mL penicillin at 37˚C under 5% CO2 for 24 h.
Cells (2x105 cells/well) were plated in 12-well plates with DMEM medium for 24 h
and then were treated with 0, 5, 10, 15, 20, 25, 30 and 35 nM of triptolide and were
incubated at 37°C, 5% CO2 and 95% air for 24 and 48 h. After incubation, cells were
examined under contrast phase microscopy and were collected for viability
determination, and isolated cells were stained with PI (5 μg/ml) and analyzed by flow
cytometry (Becton-Dickinson, San Jose, CA, USA) as described previously (Kuo et
al., , 2014; Wu et al., , 2011; Yeh et al., , 2013).
4
Adhesion assay. B16F10 cells (5×10 cells/well) were placed in 96-well plates
pre-coated with type I collagen (10 μg/mL) (Millipore, Temecula, CA, USA) for 60
min at 37°C and then were incubated with triptolide (0, 5, 10 and 20 nM) for 24 or 48
h at 37°C. After incubation, unattached cells were removed, and attached cells were
mixed in 1% glutaraldehydein in PBS for 20 minutes, and stained with 0.02% crystal
violet solution for 5 minutes at room temperature. And then 70% ethanol was used to
dissolve crystal violet, and O.D. was measured at 570 nm by using microplate reader
as described previously (23). Total percentage of adhesion was calculated based on
the adhesion cells compared to the control (Lu et al., , 2012).
5
Wound healing assay. B16F10 (3×10 cells/well) cells were placed on 6-well plates
for 24 h and then were wounded with scratched with a 200 l pipette tip as previously
described (Lu et al. , 2012). After wounding, medium was changed and 0, 5, 10 and
20 nM of triptolide was added to the medium. After incubation for 0, 12, 24 and 36 h,
wounding areas were examined and photographed under contrast phase light
microscopy at x200. Migrated cells that had moved to the wounded areas were
counted under a microscope for quantification of cell migration (Lu et al. , 2012).
Cell migration and invasion assay. Cell invasion was measured by Matrigel (BD
Biosciences, Franklin Lakes, New Jersey, USA) -coated transwell cell culture
chambers (8 mm pore size; Millipore, Billerica, Massachusetts, USA). B16F10 cells
was kept for 24 h in serum-free DMEM medium and were collected and placed in the
upper chamber of the transwell insert (5 x104 cells/well), and triptolide was added to
the well at the final concentration 0, 5, 10 and 20 nM and DMEM containing 10%
FBS was added to the lower chamber. The plates were incubated at 37°C in a
humidified atmosphere with 95% air and 5% CO2 for 24 or 48 h, and non-invasive
cells in the upper chamber were removed and invasive cells in the bottom were fixed
with 4% formaldehyde in PBS and stained with 2% crystal violet in ethanol and then
were counted under a light microscope at x200. For cell migration measurements that
were done as cell invasion assay, everything was the same except for no
Matrigel-coating of filter membrane. Cells located on the underside of the filter were
photographed and counted under a light microscope at x200 (Lu et al. , 2012).
Gelatin zymography assay. The conditioned medium of triptolide-treated B16F10
cells (1x107 cells/ml) at the final concentrations of 0, 5, 10 and 20 nM
for 24 and 48
h was collected and concentrated using ultrafiltration spin columns fitted with 30 kDa
MWCO membranes (Sartorius Stedim Biotech GmbH, Goettingen, Germany). The
harvest medium was separated by dilution in zymographic sample buffer and was
analyzed on 7.5% polyacrylamide gels containing 0.1% gelatin (Sigma-Aldrich). The
gel was then incubated with development buffer (50 mM Tris, pH 7.5; 200 mM NaCl;
5 mM CaCl2, 1 µM ZnCl2 and 0.02% Brij-35) at 37°C for 18 h. Gels were stained
with 0.2% Coomassie blue G-250 for 3 h, and areas of gelatinolytic activity were
visualized as transparent bands and analyzed by NIH image software as described
previously (Lu et al. , 2012).
Western blotting analysis. B16F10 cells (1x106 cells/well) were placed in 6-well
plates for 24 h and were incubated with triptolide (0, 5, 10 and 20 nM) for 24 and 48 h.
Cells were harvested and were lysed in ice-cold 50 mM potassium phosphate buffer
(pH 7.4) containing 2 mM EDTA and 0.1% Triton X-100 for sonication. The
homogenate was centrifuged and supernatant was collected and quantitated using
Bio-Rad protein assay kit (Hercules, California, USA) with bovine serum albumin
(BSA) as the standard as described previously (Kuo et al. , 2014; Lu et al. , 2012). A
total of 20 μg of protein was separated using 10%-15% SDS-PAGE and then
electrophoretically transferred to a PVDF membrane (Millipore, Temecula, CA, USA),
blotted with the relevant antibodies such as anti-CXCR4, SOS1, GRB 2, Ras, p-ERK,
FAK, PKC, PI3K, p-AKT, Rho A, p-JNK, p-p38, NF-B, COX2, MMP-2, MMP-9.
After washing three times with TBST, the membrane was incubated with horseradish
peroxidase–conjugated secondary antibody diluted in TBST. These blots were
detected by an enhanced chemiluminescence reagent (ECLTM, Amersham
Biosciences, Piscataway, NJ, USA). The relative protein bands obtained were
quantified using NIH Image analyzer (NIH, Bethesda, MD, USA) (Kuo et al. , 2014;
Lu et al. , 2012).
6
Real-time PCR of metastasis-related mRNA expressions. B16F10 cells (1×10
cells/well) were placed in 6-well plates for 24 h and then were incubated with
triptolide (0 and 20 nM) for 24 h. Cells were harvested and total RNA was extracted
and RNA samples were performed for cDNA reverse transcription according to the
protocol of the supplier (Applied Biosystems, Foster City, CA, USA). The primers
were
MMP-2-F:
CCCCAGACAGGTGATCTTGAC;
GCTTGCGAGGGAAGAAGTTG;
FAK-R:
FAK-F:
MMP-2-R:
TGAATGGAACCTCGCAGTCA;
TCCGCATGCCTTGCTTTT;
Rock-1-F:
ATGAGTTTATTCCTACACTCTACCACTTTC;
Rock-1-R:
TAACATGGCATCTTCGACACTCTAG;
NF-B-F:
AGTTGAGGGGACTTTCCCAGGC;
NF-B-R:
TCAACTCCCCTGAAAGGGTCCG; TIMP-1-F: TGTTTATCCATCCCCTGCAAA;
TIMP-R: CAAGGTGACGGGACTGGAA; TIMP-2-F: GGGCCAAAGCGGTCAGT;
TIMP-2-R:
TTGAACATCTTTATCTGCTTGATCTCA;
GAPDH-F:
ACACCCACTCCTCCACCTTT; GAPDH-R: TAGCCAAATTCGTTGTCATACC.
Each assay was performed in triplicate by the Applied Biosystems 7300 Real-Time
PCR system, and the expression (density of each band) fold changes were performed
by comparative CT (threshold cycle) method (Liu et al., , 2013).
Electrophoretic mobility shift assay (EMSA). B16F10 cells (1x107 cells/dish) were
treated with triptolide (20 nM) for 0, 6, 9 and 12 h or were treated with 0, 5, 10 and 20
nM of triptolide for 12 h. Nuclear extracts from each treatment and time periods were
prepared by using the NE-PER Nuclear and Cytoplasmic Extraction kit (Pierce) as
described previously (Kuo et al., , 2009). Each protein concentration was quantitated
and
biotin
end-labeled
oligonucleotide
sequences
were
5′-Biotin-GATCCAGGGGACTTTCCCTAGC-3′ corresponding to the consensus site
of NF-κB. Nuclear extract proteins (5 μg) from all samples were used for EMSA with
LightShift Chemiluminescent EMSA Kit according to the manufacturer’s protocol.
The nuclear extracts or purified factor were incubated with biotin end-labeled duplex
DNA and electrophoresed on a 6% polyacrylamide native gel and transferred onto
nylon membrane and detection was performed following the manual of the ECL kit
(Kuo et al. , 2009).
Immuno-staining of NF-κB and was examined by confocal laser scanning microscopy.
B16F10 cells (5 x 104 cells/well) were placed in four-well chamber slides and treated
with triptolide (0 and 20 nM) for 9 h and then were fixed in 3% formaldehyde in PBS
for 15 min, followed by using 0.1% Triton X-100 in PBS for 1 h to permeable cells
and 2% BSA was used to block the nonspecific binding sites. Cells were incubated
with primary antibody anti-NF-κB (1:200 dilution) and were stained with secondary
antibody FITC-conjugated goat antimouse IgG (1:100 dilution) (green fluorescence),
followed by using PI (red fluorescence) counterstaining nuclei. Cells were examined
and photomicrographed using a Leica TCS SP2 confocal spectral microscope as
described previously (Kwon et al. , 2010).
Statistical analysis. Data are presented as mean ± standard deviation. Student's t-test
was used for comparison of quantitative real-time PCR data and other data.
Differences between the triptolide-treated and untreated control groups were
compared by Student’s t test. A p value of less than 0.05 was considered statistically
significant.
Results
Triptolide decreased the percentage of viable B16F10 mouse melanoma cancer cells.
We evaluated the effects of triptolide (0, 5, 10, 15, 20, 25, 30 and 35 nM) in B16F10
cells at 24 and 48 h post-treatment. The results are shown in Figure 1. Melanoma cells
showed growth inhibition and reduced cellular viability in a dose-dependent manner.
Increased time of treatment lead to decreased cell viability.
Triptolide inhibited the adhesion of B16F10 cells in vitro. B16F10 cells were treated
with triptolide at 0, 5, 10 and 20 nM for 24 and 48 h and were measured for the
inhibition of cell adhension by using ELSIA reader and the results are shown in
Figure 2. The results of the assay showed that triptolide significantly inhibited the
adhesion of B16F10 cancer cells studied. Cell adhension was blocked by as low
concentration of triptolide at 10 nM for 48 h treatment. However, triptolide at 20 nM
decreased cell adhension at 24 and 48 h treatment.
Triptolide suppressed the migration of B16F10 cells in vitro. Wound-healing assay
was used to investigate the migration of B16F10 cells cultured with or without
triptolide (0, 5, 10 and 20 nM) for 12, 24 and 36 h. Results shown in Figure 3
indicated that triptolide significantly reduced the migration of B16F10 cells in a doseand time-dependent manner during 6-12 h.
Triptolide inhibited the migration and invasion of B16F10 cells in vitro. In order to
further investigate the cell migration and invasion and whether or not they were
affected by triptolide, B16F10 cells were placed on Millicell chambers with uncoated
(for migration) or matrigel-coated (for invasion) filters and then triptolide (0, 5, 10
and 20 nM) was added to the cells and then were incubated for 24 and 48 h. Cell
migration and invasion were examined, counted and photographed as shown in Figure
4A, B, C and D. Results demonstrated that triptolide significantly inhibited the
migration and invasion of B16F10 cells and these effects are dose-dependent that was
in agreement with results from wound healing assay (Figure 3).
Triptolide inhibited the matrix metalloproteinases-2 activities of B16F10 cells. For
investigating triptolide suppressed cell mobility (migration and invasion) and whether
or not they involved the reduction of MMP-2 activities, they were measured by using
gelatin zymography assay and the results shown in Figure 5. Results indicated that
triptolide inhibited the MMP-2 activities at 5, 10 and 20 nM for 48 h, and these effects
are in a dose-dependent manner.
Triptolide affect the protein levels of associated with migration and invasion of
B16F10 cells. We investigated triptolide suppressing migration and invasion of
B16F10 cells and whether they mediated the altered levels of associated protein with
migration and invasion. After Western blotting examination, the representative figures
were showed in Figure 6A, B and C. The results indicated that triptolide markedly
reduced CXCR4, SOS1, GRB 2, p-ERK (Fig. 6A); FAK and p-AKT (Fig. 6B); Rho A,
p-JNK, NF-B, MMP-9 and MMP-2 (Fig. 6C) but increased PI3K (Fig. 6B) and
p-p38 and COX2 (Fig. 6C) after compared to the untreated (control) cells.
Triptolide affect gene expression of B16F10 cells. B16F10 cells were treated with
triptolide (0 and 20 nM) for 24 h. Cells were harvested and total RNA was extracted
and RNA samples were performed for cDNA reverse transcription and the results are
shown in Figure 7. Results indicated that triptolide inhibited the gene expression of
MMP-2, FAK, ROCK-1 and NF-B but did not significantly affect TIMP-1 and -2
gene expression in B16F10 cells in vitro.
Triptolide inhibits the NF-κB signaling pathways in B16F10 cells. The effect of
triptolide on DNA binding of NF-κB was determined using EMSA. B16F10 cells as
they are after exposure to 20 nM of triptolide for 6, 9 and 12 h or exposed to triptolide
(0, 5, 10 and 20 nM) for 12 h. The results are shown in Fig. 8A and B, which
demonstrated that triptolide inhibited NF-κB DNA binding in a dose-dependent
manner. Binding of NF-κB was particularly inhibited by treatment with 20 nM of
triptolide. Therefore, we suggest that triptolide might block the invasion, migration
and adhesion in B16F10 cells by suppressing the NF-κB signaling.
Triptolide inhibits the NF-κB protein levels in B16F10 cells. For further confirming
triptolide inhibits NF-B levels in B16F10 cells. The protein expressions of NF-κB in
B16F10 cells was examined by confocal laser system microscopy and the results are
shown in Figure 9. The results indicated that triptolide markedly inhibited the NF-κB
protein levels in cytosol but did increase the protein levels in nuclei.
Discussion
Triptolide is known to induce cell death through cell cycle arrest and induction of
apoptosis in numerous malignancies cells (Corson and Crews, 2007). Although it was
reported that triptolide inhibited human colon rectal cancer cell migration as well as
proliferation (Johnson et al., , 2011) and inhibited migration and invasion of ovarian
cancer cells (Zhao et al., , 2012), however, there is no available information to show
triptolide affecting cell mobility such as migration and invasion of mouse melanoma
B16F10 cells. Thus, we went on to identify the mechanistic background of this
phenomenon and, we further examined the migration and invasion of B16F10 cells in
vitro after exposed to various concentrations of triptolide and the results indicated that
the adhension, migration and invasion were inhibited (Figs. 2 and 3). In this report we
show for the first time that triptolide inhibits the adhesion, migration and invasion of
melanoma cancer B16F10 cell, hereby suppressing the very initial stage of cancer cell
migration. These finding are in agreement with other reports shown that triptolide
inhibited ovarian cancer cell migration and invasion in vitro.
Matrix metalloproteinases (MMPs) have been recognized to play an important
role in cell motility and invasion via to degrade extracellular matrix (ECM)
components. Degradation of ECM is a critical step in cancer cell invasion into
neighboring tissues or organs and also for cancer cell to initiate metastasis. In the
pathogenesis of diverse diseases, such as periodontitis, rheumatoid arthritis, and skin
wound healing, it has been shown that the MMPs were induced or over-expressed
(Kanbe et al., , 2011; Sorsa et al., , 2004; Vu and Werb, 2000). It was reported that
triptolide significantly inhibited the migration and invasion of ovarian cancer SKOV3
and A2780 cells by suppression of MMP7 and MMP19 and up-regulation of
E-cadherin expression (Johnson et al. , 2011). To this end we examined the effect of
triptolide on the expression of associated proteins involved in B16F10 melanoma
cancer cell adhesion, migration and invasion such as MMP-2, MMP-9 and
down-regulated major factor of NF-B. Our results showed that triptolide inhibited
the protein expression of MMP-2 and -9 (Fig. 6C). MMP-2 and MMP-9 have the
ability to degrade collagen IV and V and counteract fibrosis (Sato et al., , 1994). It
was reported that MMP activity is regulated via tissue inhibitors of metalloproteinases
(TIMPs) which form complexes with MMPs for inhibiting the active form of enzymes
(Mazanowska et al., , 2014). Results showed that triptolide did not significantly affect
the expression of TIMP-1 and TIMP-2 (Fig. 7).
Rho A is a critical factor and also plays an important roles for cells cytoskeleton
reorganization, adhesion and motility (Jackson et al., , 2011). Results from Figure 6C
have shown that triptolide significantly decreased the expressions of Rho A and
p-JNK in B16F10 cells. Furthermore, triptolide also inhibited the protein expressions
of FAK and p-AKT (Fig. 6B) and p-ERK (Fig. 6A). Thus, we suggest that
triptolide-induced MMP-9 expression is primarily regulated by PKC, PI3K/Akt,
p-ERK, and p38 MAPK.
CXCR4 expression exists in many types of human cancers and it is generally
recognized and associated with metastasis (Ruffini et al., , 2007). It was reported to
play an essential role of SOS1/EPS8/ABI1 tri-complex in cell migration and
metastasis (Chen et al., , 2010). It was also reported that GRB2 expression status
could be as a positive biomarker of esophageal squamous cell carcinoma (ESCC)
progression and lymph node metastasis (Li et al., , 2014). Furthermore, it was
demonstrated that the blockage of the Ras-ERK pathway will lead to decreased cell
migration and invasion (Li et al. , 2014). In the present study, we showed that
triptolide inhibited the protein levels of CXRC4, SOS1, GRB2 but did not significant
affect Ras (Fig. 6A).
The results from figure 6C showed that triptolide down-regulated NF-B protein
levels in B16F10 cells. Furthermore, we also used confocal laser microscopy
examination to confirm triptolide inhibited the NF-B expression (Fig. 9). In order to
investigate triptolide inhibited NF-B protein expression, we used real time PCR
which indicated that triptolide inhibited the gene expression of NF-B (Fig. 7). We
also used EMSA method to show that triptolide inhibited the NF-B-DNA binding
(Fig. 8). Thus, we suggest that triptolide inhibited NF-B to binding DNA promoter
then inhibited MMP-9 expression in B16F10 cells. It was reported that MMP-9
promoter contains cis-acting regulatory elements for transcription factors NF-B site
(Huang et al., , 2014).
In summary, we found that triptolide significantly inhibited migration and
invasion in murine melanoma B16F10 in vitro with by suppression of MMP-2 and
MMP-9 expressions. We also found that triptolide inhibited Rho A, SOS1/GRB2,
AKT and FAK to lead to suppress migration and invasion of B16F10. Furthermore,
triptolide down-regulated the NF-B expression through inhibited binding to
promoter of NF-B and inhibited genes expression. These observations can be
summarized in Figure 10. This finding suggests that triptolide is a potential candidate
for the development of chemotherapeutic treatments for melanoma in the future.
Declaration of Conflicting Interests
The authors have no conflicts of interests.
Acknowledgements
This study is supported in part by a research grant from China Medical University
[CMU102-ASIA-20]. Experiments and data analysis were performed in part through
the use of the Medical Research Core Facilities Center, Office of Research &
Development at China medical University, Taichung, Taiwan, R.O.C.
References
Banerjee S, Sangwan V, McGinn O, Chugh R, Dudeja V, Vickers SM, Saluja AK.
2013. Triptolide-induced cell death in pancreatic cancer is mediated by
O-GlcNAc modification of transcription factor Sp1. J Biol Chem
288:33927-33938.
Chen H, Wu X, Pan ZK, Huang S. 2010. Integrity of SOS1/EPS8/ABI1 tri-complex
determines ovarian cancer metastasis. Cancer Res 70:9979-9990.
Chen Z, Sangwan V, Banerjee S, Chugh R, Dudeja V, Vickers SM, Saluja AK. 2014.
Triptolide sensitizes pancreatic cancer cells to TRAIL-induced activation of
the death receptor pathway. Cancer Lett 348:156-166.
Clawson KA, Borja-Cacho D, Antonoff MB, Saluja AK, Vickers SM. 2010. Triptolide
and TRAIL combination enhances apoptosis in cholangiocarcinoma. J Surg
Res 163:244-249.
Corson TW, Crews CM. 2007. Molecular understanding and modern application of
traditional medicines: triumphs and trials. Cell 130:769-774.
Egeblad M, Werb Z. 2002. New functions for the matrix metalloproteinases in cancer
progression. Nat Rev Cancer 2:161-174.
Garbe C, Leiter U. 2009. Melanoma epidemiology and trends. Clin Dermatol 27:3-9.
Huang Y, Zhao M, Xu H, Wang K, Fu Z, Jiang Y, Yao Z. 2014. RASAL2
down-regulation in ovarian cancer promotes epithelial-mesenchymal transition
and metastasis. Oncotarget 5:6734-6745.
Hung FM, Chen YL, Huang AC, Hsiao YP, Yang JS, Chung MT, Chueh FS, Lu HF,
Chung JG. 2013. Triptolide induces S phase arrest via the inhibition of cyclin
E and CDC25A and triggers apoptosis via caspase- and
mitochondrial-dependent signaling pathways in A375.S2 human melanoma
cells. Oncol Rep 29:1053-1060.
Jackson B, Peyrollier K, Pedersen E, Basse A, Karlsson R, Wang Z, Lefever T,
Ochsenbein AM, Schmidt G, Aktories K, et al. 2011. RhoA is dispensable for
skin development, but crucial for contraction and directed migration of
keratinocytes. Mol Biol Cell 22:593-605.
Jiang XH, Wong BC, Lin MC, Zhu GH, Kung HF, Jiang SH, Yang D, Lam SK. 2001.
Functional p53 is required for triptolide-induced apoptosis and AP-1 and
nuclear factor-kappaB activation in gastric cancer cells. Oncogene
20:8009-8018.
Jilaveanu LB, Aziz SA, Kluger HM. 2009. Chemotherapy and biologic therapies for
melanoma: do they work? Clin Dermatol 27:614-625.
Johnson SM, Wang X, Evers BM. 2011. Triptolide inhibits proliferation and migration
of colon cancer cells by inhibition of cell cycle regulators and cytokine
receptors. J Surg Res 168:197-205.
Kanbe K, Chiba J, Nakamura A. 2011. Decrease of CD68 and MMP-3 expression in
synovium by treatment of adalimumab for rheumatoid arthritis. Int J Rheum
Dis 14:261-266.
Kim MJ, Lee TH, Kim SH, Choi YJ, Heo J, Kim YH. 2010. Triptolide inactivates Akt
and induces caspase-dependent death in cervical cancer cells via the
mitochondrial pathway. Int J Oncol 37:1177-1185.
Kuo TC, Yang JS, Lin MW, Hsu SC, Lin JJ, Lin HJ, Hsia TC, Liao CL, Yang MD,
Fan MJ, et al. 2009. Emodin has cytotoxic and protective effects in rat C6
glioma cells: roles of Mdr1a and nuclear factor kappaB in cell survival. J
Pharmacol Exp Ther 330:736-744.
Kuo YJ, Yang JS, Lu CC, Chiang SY, Lin JG, Chung JG. 2014. Ethanol extract of
Hedyotis diffusa willd upregulates G0/G1 phase arrest and induces apoptosis
in human leukemia cells by modulating caspase cascade signaling and altering
associated genes expression was assayed by cDNA microarray. Environ
Toxicol.
Kwon HY, Kim SJ, Kim CH, Son SW, Kim KS, Lee JH, Do SI, Lee YC. 2010.
Triptolide downregulates human GD3 synthase (hST8Sia I) gene expression in
SK-MEL-2 human melanoma cells. Exp Mol Med 42:849-855.
Li H, Takai N, Yuge A, Furukawa Y, Tsuno A, Tsukamoto Y, Kong S, Moriyama M,
Narahara H. 2010. Novel target genes responsive to the anti-growth activity of
triptolide in endometrial and ovarian cancer cells. Cancer Lett 297:198-206.
Li LY, Li EM, Wu ZY, Cao HH, Shen JH, Xu XE, Chen B, Wu JY, Xu LY. 2014.
Overexpression of GRB2 is correlated with lymph node metastasis and poor
prognosis in esophageal squamous cell carcinoma. Int J Clin Exp Pathol
7:3132-3140.
Liu J, Jiang Z, Xiao J, Zhang Y, Lin S, Duan W, Yao J, Liu C, Huang X, Wang T, et al.
2009. Effects of triptolide from Tripterygium wilfordii on ERalpha and p53
expression in two human breast cancer cell lines. Phytomedicine
16:1006-1013.
Liu KC, Ho HC, Huang AC, Ji BC, Lin HY, Chueh FS, Yang JS, Lu CC, Chiang JH,
Meng M, et al. 2013. Gallic acid provokes DNA damage and suppresses DNA
repair gene expression in human prostate cancer PC-3 cells. Environ Toxicol
28:579-587.
Lu CC, Yang JS, Chiang JH, Hour MJ, Amagaya S, Lu KW, Lin JP, Tang NY, Lee TH,
Chung JG. 2012. Inhibition of invasion and migration by newly synthesized
quinazolinone MJ-29 in human oral cancer CAL 27 cells through suppression
of MMP-2/9 expression and combined down-regulation of MAPK and AKT
signaling. Anticancer Res 32:2895-2903.
Mazanowska O, Zabinska M, Koscielska-Kasprzak K, Kaminska D, Banasik M,
Krajewska M, Madziarska K, Zmonarski SC, Chudoba P, Biecek P, et al. 2014.
Advanced age of renal transplant recipients correlates with increased plasma
concentrations of interleukin-6, chemokine ligand 2 (CCL2), and matrix
metalloproteinase 2, and urine concentrations of CCL2 and tissue inhibitor of
metalloproteinase 1. Transplant Proc 46:2640-2643.
Mujumdar N, Mackenzie TN, Dudeja V, Chugh R, Antonoff MB, Borja-Cacho D,
Sangwan V, Dawra R, Vickers SM, Saluja AK. 2010. Triptolide induces cell
death in pancreatic cancer cells by apoptotic and autophagic pathways.
Gastroenterology 139:598-608.
Ruffini PA, Morandi P, Cabioglu N, Altundag K, Cristofanilli M. 2007. Manipulating
the chemokine-chemokine receptor network to treat cancer. Cancer
109:2392-2404.
Sato H, Takino T, Okada Y, Cao J, Shinagawa A, Yamamoto E, Seiki M. 1994. A
matrix metalloproteinase expressed on the surface of invasive tumour cells.
Nature 370:61-65.
Siegel R, Naishadham D, Jemal A. 2013. Cancer statistics, 2013. CA Cancer J Clin
63:11-30.
Sorsa T, Tjaderhane L, Salo T. 2004. Matrix metalloproteinases (MMPs) in oral
diseases. Oral Dis 10:311-318.
Tang F, Zhang R, He Y, Zou M, Guo L, Xi T. 2012. MicroRNA-125b induces
metastasis by targeting STARD13 in MCF-7 and MDA-MB-231 breast cancer
cells. PLoS One 7:e35435.
Tao Y, Zhang ML, Ma PC, Sun JF, Zhou WQ, Cao YP, Li LJ. 2012. Triptolide inhibits
proliferation and induces apoptosis of human melanoma A375 cells. Asian Pac
J Cancer Prev 13:1611-1615.
Vu TH, Werb Z. 2000. Matrix metalloproteinases: effectors of development and
normal physiology. Genes Dev 14:2123-2133.
Wu MF, Lu HF, Hsu YM, Tang MC, Chen HC, Lee CS, Yang YY, Yeh MY, Chung
HK, Huang YP, et al. 2011. Possible reduction of hepatoma formation by
Smmu 7721 cells in SCID mice and metastasis formation by B16F10
melanoma cells in C57BL/6 mice by Agaricus blazei murill extract. In Vivo
25:399-404.
Yang S, Chen J, Guo Z, Xu XM, Wang L, Pei XF, Yang J, Underhill CB, Zhang L.
2003. Triptolide inhibits the growth and metastasis of solid tumors. Mol
Cancer Ther 2:65-72.
Yeh MY, Wu MF, Shang HS, Chang JB, Shih YL, Chen YL, Hung HF, Lu HF, Yeh C,
Wood WG, et al. 2013. Effects of chitosan on xenograft models of melanoma
in C57BL/6 mice and hepatoma formation in SCID mice. Anticancer Res
33:4867-4873.
Zhao H, Yang Z, Wang X, Zhang X, Wang M, Wang Y, Mei Q, Wang Z. 2012.
Triptolide inhibits ovarian cancer cell invasion by repression of matrix
metalloproteinase 7 and 19 and upregulation of E-cadherin. Exp Mol Med
44:633-641.
Figure legends
Figure 1. Triptolide decreases the percentage of viable B16F10 murine melanoma
cancer cells. Cells (2×105 cells/well) were incubated with 0, 5, 10, 15, 20, 25, 30 and
35 nM of triptolide for 24 h and 48 h and then were harvested for measuring the
percentage of viable cells by flow cytometry as described in Materials and Methods.
*p < 0.05, significant difference between triptolide-treated and control groups as
analyzed by Student’s t test.
Figure 2. Triptolide inhibited the cell-matrix adhension of B16F10 cells.
4
B16F10 cells (5×10 cells/well) were placed in 96-well plates pre-coated with type I
collagen (10 μg/mL) (EMD Millipore) for 60 min at 37∘C and then were incubated
with triptolide (0, 5, 10 and 20 nM) for 24 or 48 h at 37∘C. Unattached cells were
removed, and attached cells were mixed in 1% glutaraldehydein in PBS for 20
minutes, and stained with 0.02% crystal violet solution for 5 minutes. And then 70%
ethanol was used to dissolve crystal violet, and O.D. was measured at 570 nm by
using microplate reader as described in Materials and Methods. *p < 0.05, significant
difference between triptolide-treated and control groups as analyzed by Student’s t
test.
Figure 3. Triptolide inhibits the migration of B16F10 cell. Cells were kept on the
6-well dish for 24 h before a wound was created by a yellow pipette tip to scrape the
confluent cell layers. Triptolide at various concentrations were added to the well then
incubation for 24 h. A: Some of the representative photographs of invading treated
and untreated cells are presented. B: the percentage of inhibition of cell migration was
quantitated. *p < 0.05, significant difference between triptolide-treated and control
groups as analyzed by Student’s t test.
Figure 4. Triptolide suppressed the migration and invasion of B16F10 cells in vitro.
Cells (5 x104 cells/well) were treated with 0, 5, 10 and 20 nM of triptolide for 24 h
after cells penetrated through to the lower surface of the filter (without Matrigel) for
migration measurement (A and B) or the filter (with Matrigel) for invasion
measurements as described in Materials and Methods. Representative columns (mean)
from three independent experiments. *p < 0.05, significant difference between
triptolide-treated groups and the control as analyzed by Student’s t test.
Figure 5. Triptolide affects the activities of matrix metalloproteinase-2 (MMP-2)
activities in B16F10 cells. Cells were treated with 0, 5, 10 and 20 nM of triptolide and
then were harvested and perform by gelatin zymography. A: representative zymogram
from three independently experiment was used to detect the activity of secreted
MMP-2. B: the different activity of MMP-2 was determined by densitometric analysis
and results are expressed as a percentage of the control (100%). *p < 0.05, significant
difference between triptolide-treated groups and the control as analyzed by Student’s t
test.
Figure 6. Triptolide affect the levels of associated proteins in migration and invasion
of B16F10 cells. Cells (5 x105 cells/well) were treated with 0, 5, 10 and 20 nM of
triptolide for 24 and 48 h and then cells were collected and the total protein extracted
and determined as described in Materials and Methods section. A: CXCR4, SOS1,
GRB2, p-ERK; B: Fak, PKC, PI3K, p-AKT; C: Rho A, p-JNK, NF-kB, MMP-9 and
MMP-2, p-p38 and COX2 expressions were estimated by Western blotting as
described in Materials and Methods.
Figure 7. Triptolide affect gene expression of metastatic association in B16F10 cells.
6
Cells (1×10 cells/well) were placed in 6-well plates for 24 h and then were incubated
with triptolide (0 and 20 nM) for 24 h. Cells were harvested and total RNA was
extracted and RNA samples were performed for cDNA reverse transcription according
to the protocol of the supplier as described in Materials and Methods. Each assay was
performed in triplicate by the Applied Biosystems 7300 Real-Time PCR system.
Figure 8. Triptolide inhibits the NF-κB signaling pathways in B16F10 cells. B16F10
cells after exposure to triptolide (0, 5, 10 and 20 nM) for 12 h or exposed to 20 nM of
triptolide for 6, 9 and 12 h. Then cells were harvested for examining the DNA
promoter binding assay by using EMSA as described in Materials and Methods. A:
dose-dependent assay. B: Time-dependent assay.
Figure 9. Triptolide affects the NF-κB p65 expression in B16F10 cells. Cells (5 x104
cells/well) were placed on 6-well chamber slides then were treated with 0 and 20 nM
of triptolide for 9 h, then were fixed and stained using anti-NF-κB p65 then stained
with a secondary antibody (green fluorescence) followed by nuclear counterstaining
with PI (red fluorescence). Photomicrographs were obtained using a Leica TCS SP2
confocal spectral microscope as described in Materials and Methods.
Figure 10. The possible signaling pathways for triptolide inhibited cell migration and
invasion in B16F10 murine melanoma cells.