Supplementary online information
Detailed Materials and Methods, extension to Manuscript Part 2
2.1. Cell growth
Cells (Zea mays Black Mexican Sweet (BMS)) were grown in suspension in 25 mL aseptic
solution in 250 mL beakers, shaken at 100 rpm in dark, and subcultured every two weeks. The
growing medium composed of 4.4 g/L MS+vitamins (sigma M-6899, Murashige and Skoog
Basal Salts), 3% sucrose, 40 µL/L 2,4-D, 0.2 g/L asparagine, at pH 5.7. The medium for cells
grown with silicon (+Si cells) was supplemented with 2 mM Na2SiO3 (Sigma 33844-3) and pH
titrated with 1 M HCl solution (approximately 950 µL in 800 mL solution). The cells grown
without additional silicon (-Si cells) were supplemented with 1 M NaCl added to the same
concentration of HCl.
2.5. Transmission Electron Microscopy (TEM)
Cells cultured for 14 days were pelleted, and a drop of pellet was placed in an aluminum disc
with a 100 m-deep cavity and covered with a flat disc. The sample was then high-pressure
frozen in a HPM 010 high-pressure freezing machine according to the manufacturer's
specifications (Bal-Tec, Liechtenstein). Cells were subsequently freeze-substituted in an AFS2
freeze substitution device (Leica Microsystems, Vienna, Austria) in anhydrous acetone
containing 2% glutaraldehyde and 0.1% tannic acid for 3 days at -90°C and then warmed up to
-30°C over 24 hours and washed 3 times in anhydrous acetone at room temperature. Samples
were then incubated for 1 hour with 1% osmium tetroxide in anhydrous acetone, washed 3 times
in anhydrous acetone and infiltrated in a series of increasing concentration of Epon resin (Agar
Scientific, UK). After polymerization at 60°C, 70 nm sections were mounted on a Quantifoil
(Germany) R 3.5/1 grid. Imaging and elemental mapping were performed in a Tecnai F20
transmission electron microscope (FEI, Eindhoven, The Netherlands) operating at 200 kV and
equipped with a Gatan Imaging Filter (GIF, Gatan) as well as with an UltraScan 1000, 2K x 2K
CCD camera. Silicon maps were obtained at the L2,3 ionization edge using the 3 windows
method.
2.6. Expression level of the silicon transporters, quantified by real-time PCR
Cells cultured for 14 days were washed twice in DDW and frozen at -80°C. RNA was isolated
from 250 mg cells using ZR plant, RNA miniprep kit (Zymo research, USA). Next, cDNA was
prepared using RevertAid H Minus Reverse Transcriptas kit (Fermentas: Thermo Fisher
Scientific Inc), according to the manufacturer's instructions. Specific primers were synthesized
(Sigma Aldrich, Rehovot Israel) to amplify the cDNA of the maize silicon transporters (Table
1S). Maize Ubiquitin (gi248338) [1] was used as a reference for normalizing the cDNA amounts.
The expression level of the transporters was measured in the presence of Platinum SYBR
1
GREEN qPCR reaction mix, (Invitrogen technologies, USA), in an ABI PRISM 7300 (Applied
Biosystemsinc, USA), according to the manufacturer's specifications. The reaction, in a final
vol. of 20 l was heated to 95°C for 10 min., followed by 40 cycles of 95°C for 15 sec and 60°C
for 1 min. Analysis was done on three technical replicates (meaning cell samples grown in the
same vessel), and three biological replicates (meaning cells grown in different growth cycles).
Data analysis was carried out by 7300 system SDS software study application's software.
Table 1S: Primer sequences used to amplify targets on the transcribed sequences of silicon
transporters and ubiquitin genes.
Gene
Lsi1 [1]
Lsi2
Lsi6 [1]
Ubiquitin [1]
Forward primer
GGACCTACACCTACATCCGCTTC
CTCGCTGCTCGTCTTCTTCT
TGGCTGAGAGAGTGAGTGAGAGA
ACAACATCCAGAAGGAGAGCAC
Reverse primer
CGAGAGAAGAGCGACACATAGAC
AGAAGCACTGTTGGCACGTT
AAACCAGCAAAGCCAGACACAT
CAGGTCCATTAAACCAACGAAG
Reference
1. Moshelion M, Hachez C, Ye Q, et al. (2009) Membrane water permeability and
aquaporin expression increase during growth of maize suspension cultured
cells. Plant Cell Environ 32:1334–1345. doi: 10.1111/j.13653040.2009.02001.x
2
Supplementary Figures
Figure 1S: The development of cell culture under silicon supplementation. The medium pH
(A) and osmolarity (B) and the cells' fresh weight (C) were measured during 15 days of cells
growth. Each point is an average of three biological replicates (meaning cells grown in different
vessels). Bars represent standard deviation. Every biological replicate is an average of three
technical measurements (meaning cell samples grown in the same vessel). No differences were
found between the +Si (black) and -Si (gray) cells.
3
Figure 2S: Micrographs of the cell cultures. Samples supplemented with silicon and starved
for silicon were indistinguishable. A) Cluster of cells under a light microscope. B) The same
cells in calcofluor-white staining, staining the cell wall -glucan chains. C) Light micrograph of
a section through cell cluster. D) The same cross section stained with calcofluor-white. E) Cross
section embedded in Epon resin, stained for starch (arrows) by iodine. F) Transmission electron
micrograph of section of the cells, showing vesicles in the cytoplasm. Arrows mark the
amyloplast bodies.
4
Relative expression
ZmLSi1
ZmLSi2
ZmLSi6
Figure 3S: Expression levels of the silicon transporters. The Y-axis represents the relative
level of expression of the transporters, calibrated to ubiquitin. In the -Si cells we detected a
statistically significant increase in the expression of ZmLsi1 (x1.8) and ZmLsi2 (x2.2), but not
of ZmLsi6. Averages of three biological replicates are reported. Bars represent standard errors.
Letters within each panel represent significantly different groups (based on t-tests).
5
Figure 4S: Relative rates of the weight loss of commercial cornstarch treated with Si or
salt solution, reflecting pyrolysis as a function of increasing temperature. Starch was
immersed overnight in 2 mM sodium silicate, where the pH was corrected by HCl, or water
supplemented with NaCl in a concentration similar to that of the HCl. The samples were rinsed
three times in deionized water, and dried at 65°C for two days. The maximal rates of pyrolysis
of the salt-treated sample (306°C) is lower than the Si-treated sample (310°C).
6
Figure 5S: Raman spectroscopy of cell walls before amylase treatment. The spectra are
identical between the samples supplemented with silicon and those starved for silicon.
Comparing to commercial cornstarch shows that most of the scattering peaks are of the starch.
The marked peaks represent aromatic rings (1607, 1630 cm-1), and amide I protein bond, (1660
cm-1), missing from the starch spectrum. The protein peak is reduced after starch degradation
(compare to Fig. 5).
7