Clipson et al
KLF2 mutation is the most frequent somatic change in splenic marginal zone lymphoma and identifies a
subset with distinct genotype
Alexandra Clipson,1 Ming Wang,1 Laurence de Leval,2 Margaret Ashton-Key,3 Andrew Wotherspoon,4 George
Vassiliou,5,6 Niccolo Bolli,5,6 Carolyn Grove,5 Sarah Moody,1 Leire Escudero Ibarz,1 Gunes Gundem,5 Kim
Brugger,7 Xuemin Xue,1 Ella Mi,1 Anthony Bench,6 Mike Scott,6 Hongxiang Liu,8 George Follows,6 Eloy F.
Robles,9 Jose Angel Martinez Climent,9 David Oscier,10 A James Watkins,1,6 Ming-Qing Du1
1
Division of Molecular Histopathology, Department of Pathology, University of Cambridge, UK;
Institute of Pathology, Centre Hospitalier Universitaire Vaudois, Lausanne, Switzerland;
3
Department of Cellular Pathology, Southampton University Hospitals National Health Service Trust,
Southampton, UK;
4
Department of Histopathology, Royal Marsden Hospital, London, UK;
5
Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UK;
6
Department of Haematology, Addenbrooke's Hospital, Cambridge University Hospitals NHS Foundation
Trust, Cambridge, UK;
7
Department of Molecular Genetics, Addenbrooke's Hospital, Cambridge University Hospitals NHS
Foundation Trust, Cambridge, UK;
8
Molecular Malignancy Laboratory, Addenbrooke's Hospital, Cambridge University Hospitals NHS Foundation
Trust, Cambridge, UK;
9
Division of Oncology, Center for Applied Medical Research CIMA, University of Navarra, Pamplona, Spain;
10
Department of Haematology, Royal Bournemouth Hospital, Bournemouth, United Kingdom
2
SUPPLEMENTARY METHODS:
Somatic variant validation by Fluidigm Access Array PCR and Illumina MiSeq sequencing:
Mutations in
NOTCH2, TNFAIP3, TRAF3, MYD88, IKBKB, CARD11, BCL10, CD79A, CD79B and TP53 were screened by
Fluidigm Access Array PCR and Illumina MiSeq sequencing using our established protocol from a parallel
investigation (manuscript in preparation). With the exception of NOTCH2, BCL10 and IKBKB, the primers for
all other genes and their conditions for multiplex PCR with Fluidigm PCR were optimised in the parallel study
Supplementary Table S3). Primers for NOTCH2, BCL10 and IKBKB were similarly designed and validated for
multiplex PCR with Fluidigm Access Array according to our established protocols.
Briefly, for each sample, a small amount of genomic DNA (10-20ng HMW or 50ng from FFPE tissue) was first
subjected to preamplification with all primer pairs to enrich the targets. The preamplified products were
routinely treated with ExoSAP-IT enzyme (Affymetrix, UK) to eliminate the unincorporated primers and
dNTPs. The cleaned preamplified products (1l of the 5-fold dilution), together with primer mixtures, were
loaded on to a Fluidigm 48.48 Access Array using an IFC controller and PCR was carried out on a Fluidigm
Thermal Cycler according to the manufacturer's instruction. The amplified products for each sample were
harvested and pooled together, and 1μL of the 100-fold diluted products was used for barcoding by PCR.
The barcoded PCR products from various samples were pooled, purified using AMPure XP beads (Beckman
1
Clipson et al
Coulter, UK) and routinely sequenced on an Illumina MiSeq sequencer using a 250-base paired-end
sequencing protocol. Each sample was investigated in duplicate to eliminate any potential false positives.
MiSeq sequence Data analysis: The fastq conversion from BCL and demultiplexing were carried out using
the MiSeq Reporter software. The adaptor sequence (TGTAGAACCATGTCGTCAGTGT) was removed using
cutadapt 1. The reads were aligned to the target sequences using BWA aln and sampe with the “-e 50”
parameter for the latter 2. The coordinates of the aligned reads were transposed into GRCh37/HG19
coordinates using an in-house perl program, and transformed to a bam file using samtools 3. Variants were
identified using an in-house developed variant caller python program, which was specially designed to
identify variants by Fluidigm PCR and MiSeq sequencing, and extensively validated against a large number of
known mutations from 7 genes, which were included in this study. The identified variants were annotated
using the ensembl human database, using the ensembl Variant Effect Predictor 4, and the result was
transformed into an excel sheet using a bespoke perl script. After filtering background noise and germline
changes through SNP database search, novel variants seen in both replicates of the same sample were
recorded, and then further ascertained by an independent Fluidigm PCR and MiSeq sequencing or Sanger
sequencing.
NF-B reporter assay:
Briefly, HEK293T cells (4.5x105) were transfected with 2μg of expression vector (KLF2, MYD88-S219C or
CARD11-F130V), 0.8μg of pNF B-luc and 0.2μg of pRL-TK using TransIT®-LT1(Mirus, UK). The transfected
cells were cultured for 24 hours, where indicated stimulated by TNFα (300IU/ml) for 2 hours, and then
harvested for luciferase activity measurement.
Similarly, OCI-LY19 lymphoma cells (5x106) were
electroporated with 50µg expression vector (KLF2, MYD88-S219C or CARD11-F130V), 5.2µg pNF B-luc and
4.8μg of pRL-TK using Amaxa Nucleofector solution V programme A-30 (Amaxa, Cologne, Germany). Where
indicated, 200ng/ml recombinant human BAFF (R&D Systems) was added to the culture at the time of
transfection. Reporter assay was carried out 24 hours post transfection. For each experiment, at least three
independent transfections and triplicate reporter assays were performed, and data were presented as a
mean ± standard deviation.
References
2
Clipson et al
1 Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet journal
2011; 17: 10-12.
2 Li H, Durbin R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics
2009; 25: 1754-1760.
3 Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N et al. The Sequence Alignment/Map format and
SAMtools. Bioinformatics 2009; 25: 2078-2079.
4 McLaren W, Pritchard B, Rios D, Chen Y, Flicek P, Cunningham F. Deriving the consequences of genomic
variants with the Ensembl API and SNP Effect Predictor. Bioinformatics 2010; 26: 2069-2070.
3