ISNSCCON 2016, Tiruchy: Abstracts: Clinical Nephrology
CN 1: DNA damage in children with nephrotic syndrome
Priyanka Reddy N, DhrithimanShetty,VijayaShenoy M, SudarshanShetty K, Dept
of Pediatrics, K.S.Hegde Medical Academy, Mangalore, Karnataka email:
dr.priyankareddy.n@gmail.com
Aims: 1. Determine DNA damage in children with NS.
2. Determine the difference in DNA damage in remission or relapse of NS
Materials and methods: This was a case control study of 77 patients with NS and 44 normal
controls. The study was conducted from August 2013 to august 2015 in a tertiary care centre. We
excluded children <1 year age, steroid resistant NS, treatment history of cyclophosphamide,
cyclosporin A, tacrolimus, systemic illness & major malformations . Among the 77 patients, 38
were in relapse and 39 in remission. Urine was collected for urine analysis & 3 ml of blood
collected by venupuncture for blood analysis. Blood was analysed for serum albumin, serum
cholesterol, complete blood counts, DNA damage analysis by COMET assay and values were
scored based on tail length, percentage DNA in tail and olive moment. Oxidative stress was
analysed using the antioxidant markers Superoxide dismutase (SOD), Gluthathione peroxidase
(GSH) and the oxidant marker Malondialdehyde (MDA). Statistical methods used in this study
include arithmetic mean, standard deviation, independent sample t test employed using SPSS 16
for windows software.
Observations: NS patients in relapse were compared with remission group and normal control
group using independent t-test. Mean percentage DNA in tail in relapse group was 12.16±3.15
compared to remission group which was 6.42±1.59(p=0.017)and normal controls 6.26±1.99
(p=0.077). Mean tail length in relapse group was 14.63±3.55 compared to 14.62±3.3(p=0.825) in
remission and 9.42±2.34(p= 0.188) in normal controls. Mean olive moment in relapse group was
5.86±1.35 compared to 3.7±0.94 (0.061) in remission and 3.21±1.09(0.907) in normal controls.
Among the 3 parameters, percentage DNA in tail is a more reliable parameter to assess the DNA
damage. Percentage DNA in tail was more in NS in relapse than remission group(p=0.017)
confirming significant DNA damage in relapse group. Mean tail length and mean olive momet
were more in relapse compared to remission and control but were not of statistical significance
Discussion: Higher DNA damage was found in nephrotic syndrome in relapse compared to
remission group.DNA damage was more during NSin relapse compared to normal children but
not of statistical significance. Thus we conclude that DNA damage is a possibility in children
with NS in view of oxidative stress. Larger study is needed to confirm our diagnosis
CN 2: Collapsing Glomerulopathy in a patient with Systemic Lupus
Erythematosus
Midhun Ramesh , Praveen Murlidharan , Biji K.A, Satish B, Ramdas Pisharadoy
Dept. of Nephrology & Pathology, P.B.No 1, Kerala Institute of Medical Sciences,
Anayara P. O, Trivandrum, Kerala. PIN- 695029 email:
dr.midhunramesh@gmail.com
A 17 year old girl with no past significant medical or surgical history, presented with progressive
generalized edema, puffiness of face frothy urine , dysuria , intermittent headache of one week
duration. On clinical examination she had anasarca , hypertension (BP-160/90), pallor , raised
JVP, oral ulcers, ascites, swelling of both knee joints ,tenderness over both wrists , elbow , knee
joint , subtalar joint and metacarpo-phalangeal joint. Initial Investigations were hemoglobin 7.1
g/dl , serum creatinine 2.5 mg/dl, ESR 90mm in first hour, urine protein 5445 mg/24 hours ,
Serum Anti ds DNA 800 IU/ml , Blood C3 and C4 were 0.4 g/dl (low) and 0.05g/dl(low)
respectively. She underwent a renal biopsy which revealed diffuse mesangial and endocapillary
hypercellularity with neutrophills and wire loop thickening. Two glomeruli showed collapsed
glomerular tuft with hyperplastic podocytes and Periodic acid–Schiff (PAS) positive droplets.
There was no fibrin deposition on special stain. Immuno flourosence showed a “ full house”
pattern.. The biopsy was suggestive of diffuse proliferative Lupus Nephritis- Class IV A with
collapsing glomerulopathy.Collapsing glomerulopathy (CG) is a podocytopathy with segmental
or global collapse of the glomerular capillary tuft and podocyte proliferation in Bowmans . These
patients carry a poor prognosis and majority of them end up on dialysis. At present there is no
evidence based treatment approach for CG with Lupus Nephritis owing to the rarity of this
disease.
CN 3: Mortality predictors in septic shock patients undergoing renal
replacement therapies.
Alai Taggu, Renuka S, Sriram Sampath, Sajish. Dept.of Nephrology, Dept.of
Critical care medicine, St.John’s Medical College and Hospital, Bangalore.
dralaitaggun@gmail.com.
Introduction and Aim: Data on mortality predictors in septic shock patient withacute kidney
injury (AKI) needing RRT are few. The aim of this study is to identify mortality predictors in
septic shock patients with AKI requiring renal replacement therapies (RRT).
Methods and Materials: A prospective observational study conducted on160 septic shock
patients with AKI requiring RRT admitted to medical intensive care unit (MICU). Exclusion
criteria were patients with CKD on dialysis, those who had undergone RRT previous to ICU
admission and those on RRT < 24 hours. RRT initiation criteria were as decided by nephrologist
on call. Baseline data were recorded at initiation of RRT. Daily fluid balance was calculated.
Mortality at 90 days was followed-up. A Cox regression model was performed to analyse
independent predictors. P < 0.05 taken as statistically significant.
Results: Mean age was 52 (sD13 )years; Male: Female 130:160; mean APACHE II score at
RRT initiation was 14(sD 4.8).Disease type : 45.8% Respiratory, 20.5% Abdominal, 10% Acute
febrile illness, 2% CNS and 21.7% as others; 90% were medical patients and 10% surgical
patients. AKIN score at RRT initiation was no AKI in 7%, AKIN-I ( 22.4%), AKIN-II (36.7%),
and AKIN-III (33.9%). Hospital mortality was 75% (64% at 90-days). Age, BMI, APACHE II
score, creatinine, potassium, bicarbonate, lactate , fluid balance in the RRT day 1, Ultra-filtration
dose, days from hospital admission to RRT were significant.
Discussion: Age, APACHE II score, lactic acidosis and fluid overload on day 1 of RRT were
significantly associated with increased mortality.
CN 4: Evaluation of micro RNA Efficacy as Therapeutic Molecule
in Transient Receptor Potential Channel 5 Gene Silencing: A
Computational Approach
Safreen Shaikh Dawood Amanulla1*, Kavitha D2, Kumaresan R1+,
Giri.P3 1Department of Biotechnology, PeriyarManiammai University,
Vallam, Thanjavur-613 403 2 Department of Botany &Microbiology,
A.V.V.M. Sri Pushpam College, Poondi, Thanjavur-613503 3Kidney
Care, C-50, 10th B Cross, Thillai Nagar, Trichy-620018, email:
safreenamanulla@gmail.com
Background& Aim: MicroRNA (miRNA) is an evolutionary conserved mechanism of gene
regulation. Glomerular filter is crucial in sorting and preventing essential molecules from spilling
into urine. Transient receptor potential channel 5 (TRPC5) intercede damage to filtration barrier
that attributes to albuminuria, an indicator of cardiovascular, metabolic and chronic kidney
disease. Inhibition of TRPC5 gene is a specific approach to protect glomerular filter barrier
damage.Designing and selecting potential microRNA (miRNA) for TRPC5 gene silencing by
computational analysis.
Materials & Methods: The mRNA sequence was retrieved from NCBI (National Center for
Biotechnology Information). We have designed three miRNA sequences using Invivogen
software. Gene silencing efficiency was assessed based on minimum free energy of hybridization
and their hybridization structure was also obtained using BIBISERV2-RNA Hybrid. Further
evaluation has been done using various factors like linearity of the mRNA-miRNA hybrid, h-b
index and GC content of miRNA.
Results: The minimum free energy of hybridization of the three designed miRNA such as
miRNA1,miRNA2 and miRNA3 are as follows :
-28.2kcal/mol, -24.1 kcal/mol and-25.6
kcal/mol with their corresponding GC content are 47.62%,52.38% and 47.62% respectively. It
was interpreted that binding efficiency was maximum with minimum free energy hybridization,
comparatively high linearity of the mRNA-miRNA hybrid and low GC content of miRNA.
Conclusion: miRNA1 is having the least minimum free energy of hybridization i.e. -28.2
kcal/mol, with low GC content of 47.62%, high linearity with minimal h-b index and loop
structure. This study predicts miRNA1to be the most efficient in TRPC5 gene silencing. Hence,
MicroRNA can be used as therapeutic drug that would serve as an important inhibitor that
suppresses the gene expression, thus developing potential therapeutic strategies for treating
glomerular filtration malfunction. Further in-vivo investigation is essential to confirm their
efficacy.
CN 5: Amplification of Human Renalase Gene from Blood
Muthukumaran T1*, Kumaresan R1, Giri P2
1 Department of Biotechnology, Periyar Maniammai University, Vallam, Thanjvaur, India
2 Kidney Care, C-50, 10thB cross, Thillai Nagar, Tiruchirappalli, India, email:
kumaranmt@gmail.com
Background & Aim: Renalase, is an enzyme with an activity of monoamine oxidase,
metabolizes catecholamines. It circulates in the blood and regulates systemic blood pressure and
cardiovascular functions. End stage renal disease (ESRD) patients have deficiency of renalase
leading to hypertension. Patients without kidney disease also develop hypertension due to
deficiency of renalase, making therapy with renalase inevitable. Cloning into expression vectors
using recombinant DNA technology, large quantities of renalase can be produced in vitro which
can be tried as therapeutic agent in cases of chronic kidney disease (CKD) and end stage renal
disease (ESRD) patients. The study aimed to amplify the renalase gene (280bp) from human
blood sample using polymerase chain reaction (PCR).
Materials and Method: Human renalase gene was amplified from genomic DNA isolated from
human blood using kit method. Specific forward and reverse primers were designed and used
along with master mix to amplify the human renalase gene. The genomic DNA and the amplified
human renalase gene were checked on 1% agarose gel electrophoresis. The initial denaturation
was done at 96 °C, annealing at 60 °C, and extension at 74 °C. The PCR was set for 28 cycles.
The primers were designed using PRIMER 3 software.
Forward primer sequence: ATGCGACCCCAGGGCCCCGCCG
Reverse primer sequence: TTTTGGTAGTTCTTCAATAAG
Result: The genomic DNA was isolated from 5mL of human blood sample. PCR with specific
forward and reverse primers with genomic DNA yielded human renalase gene having a size of
280base pairs and the number of copies of DNA obtained after 28 cycles is 26, 84, 35,456.
Conclusion: The human renalase can be was amplified from human blood using polymerase
chain reaction and the same can be utilized for HT control in CKD patients.
CN 6: Prevalence of Angiotensin Converting Enzyme (ACE) Gene
Insertion/Deletion Polymorphism in South Indian Population with
Hypertension and Chronic Kidney Disease
John Robert1*, Kumaresan Ramanathan1, Giri Padmanabhan2
1 Department of Biotechnology, Periyar Maniammai University, Vallam, Thanjavur-613403
2 Kidney Care, C-50, 10th B Cross, Thillai Nagar, Tiruchirappalli-620018, email:
jrobert354@gmail.com
Background & Aim: Chronic Kidney Disease (CKD) is associated with a high risk of
developing severe complications such as, cardiovascular disease and eventually End Stage Renal
Disease (ESRD) leading to death. Hypertension plays a key role in the progression of renal
failure and is also a chief risk factor for the progression to End Stage Renal Disease (ESRD).
This study investigates the possible association of insertion (I) and deletion (D) polymorphism of
Angiotensin Converting Enzyme (ACE) gene in patients of CKD with and without hypertension
(HT).
Materials and Methods: Total 120 participants with 30 members in each group (Control, HT,
CKD without and CKD with HT) were chosen following by informed consent. Blood samples
were collected and subjected to biochemical analyses and nested PCR amplification was
performed to genotype the DNA, for ACE I/D using specific primers. Statistical analyses were
performed using SPSS version 13. Allele and genotypic frequency was calculated by direct gene
counting method. Comparison of the different genotypes was done by using Chi square test.
Odd’s ratios were calculated with a 95% confidence interval limit.
Results: The ACE genotype were distributed as
In control
: II, 27 (90%); DD, 2 (6.67%) and ID, 1 (3.33%)
In HT
: II, 1 (3.33%); DD, 5 (16.67%) and ID, 24 (80%),
In CKD without HT: II, 4 (13.33%); DD, 24 (80%) and ID, 2 (6.67%)
In CKD-HT
: II, 0 (0%); DD, 2 (6.67%) and ID, 28 (93.33%)
Conclusions: D allele of ACE gene confers a greater role in genetic variations underlying CKD
and hypertension. This result suggest that CKD patients should be offered analysis for defects in
ACE I/D polymorphisms, especially if they are hypertensive.
CN 8: Study on Regulation of Low Density Lipoprotein Cholesterol
Metabolism using PCSK9 Gene Silencing: A computational
Approach
Azra Khanam M1*, Kumaresan R1, Giri.P2
1
Department of Biotechnology, Periyar Maniammi University, Vallam, Thanjavur613403 2 Kidney Care, C50, 10TH B Cross, Thillai Nagar, Trichy, Email:
azrakhanamm@gmail.com
Background & Aim: With nearly 32.4 million people are affected every year with Myocardial
infarction (MI), Cardiovascular Diseases (CVD) and strokes in chronic kidney disease (CKD)
due to abnormal lipid metabolism. Combating and preventing abnormality in lipid metabolism
becomes a pivotal criteria for research. Proprotein convertase subtilisin/kexin type 9 (PCSK9) is
a circulating protein, it promotes the degradation of low density lipoprotein receptors (LDL-R)
and hence increases LDL-C levels. Mutations that block the secretion of PCSK9 reduce LDL-C
level. Silencing the gene PCSK9 at the post-transcriptional level with the help of small
interfering Ribo nucleic acid (siRNA) gives a new insight and a novel therapeutic way to
regulate LDL-C metabolism. Designing and selecting an efficient siRNA for silencing PCSK9
mRNA through computational approach.
Method: We have designed seven siRNAs to silence the mRNA of PCSK9 through
computational analysis. The designing of siRNA was done using a software Invivogen. After
designing, their minimum free energy of hybridisation was evaluated and their hybridization
structure obtained from the software BiBiServ. We also deduced that the binding efficiency
varies with factors like linearity of mRNA, h-b index, low GC content of siRNA. Of all the
factors h-b index of mRNA plays the most influential role in establishing a better knock down
efficiency. If the mRNA has low h-b index, it tends to be more linear and hence binding of
siRNA is more efficient.
Result: The minimum free energy of hybridization of the seven designed siRNA is as follows 22.7 kcal/mol, -32.4 kcal/mol, -29.1 kcal/mol, -27.5 kcal/mol, -23.0 kcal/mol, -22.9 kcal/mol, 24.8 kcal/mol.
Conclusion: siRNA2 having the least minimum free energy of hybridization i.e. -32.4 kcal/mol,
is predicted to be the most efficient towards the PCSK9 gene silencing. Further in vivo studies
have to be carried out to confirm the knock down efficiency.
CN 8: Idiopathic erythrocytosis in IgA nephropathy
P Rakesh Madhyastha, M S Ramaiah Medical College, Bengaluru, Karanataka
email: rakeshmadhyastha@gmail.com
IgA nephropathy (IgAN) is one of the most frequent forms of glomerulonephritis (GN). There
have been several case reports citing Polycythemia Vera in IgA nephropathy. PV associated with
renal disease is rare and generally considered to be associated with hypervolemia or
high‑viscosity‑induced renal hyperperfusion and hyperfiltration (1). A literature search of
polycythemia in renal disease revealed IgAN, focal segmental glomerulosclerosis and
membranoproliferative glomerulonephritis. Here we report a case of Idiopathic erythrocytosis in
a 31 year old male who was incidentally detected to have hypertension during his preemployment checkup. Urine routine showed proteinuria and hematuria . Biochemical parameters
revealed raised serum creatinine andHistological findings of the renal biopsy showed IgA
nephropathy.
Case report: A 31 year old male was referred to nephrology in view of hypertension associated
with renal dysfunction and urine routine showing proteinuria and active urinary sediments. He
was admitted in Department of Nephrology of M S Ramaiah Hospital for further work up.
Complete blood count revealed polycythemia with haemoglobin of 19.2 g/dl, normal total count
and platelet count. Renal function test revealed serum creatinine of 2.2mg/dl with raised uric
acid of 10.6 mg/dl. A 24 hour urine protein was done which showed a nephrotic range
proteinuria of 7.5 g/day. Hematologist consult was sought for polycythemia and possible causes
of secondary erythrocytosis were ruled out. Serum erythropoietin levels were normal and JAK 2
exon mutation was negative.The liver function, uric acid, electrolytes, glucose, complement 3
(C3) and C4 serum levels were normal. Coagulation and the levels of anti-streptolysin O and
high-sensitivity C-reactive protein were also normal. ANA profile was done and antibodies to
anti-myeloperoxidase, proteinase 3 (PR3), double-stranded DNA (dsDNA), nucleosome and
Sjögren's syndrome type A (SS-A) and type B (SS-B) antibodies, tested negative and excluded
an autoimmune disorder or systemic disease. Renal ultrasound revealed normal sized kidneys
with right kidney maximum dimension measuring 9.6cm and left kidney measured 9.4 cm. Radio
isotope scan was done to reveal a GFR of 78 ml/min with a right and left differential of 33
ml/min and 35 ml/min. Bone marrow biopsy was done which revealed normal cellular marrow.
Renal biopsy showed chronic Ig A nephropathy.
Patient was treated with 2 sittings of phlebotomy .He was administered Amlodpedine 5mg and
Ramipril 2.5 mg for control of hypertension along with allopurinol 100 mg and aspirin 150 mg
for hyperuricemia and polycythemia respectively. He was followed up every 2 weeks on
outpatient basis. At the end of 8 weeks his blood pressure was within normal limits. His lab
parameters had improved with serum creatinine stable at 1.8 mg/dl, uric acid 6.5 mg/dl. 24 hour
urine protein at the end of 8 weeks was 4.1 g/day
Discussion: To the best of author’s knowledge there have been just 24 cases of polycythemia
associated with renal disease described so far and out of them only 10 have been associated with
IgA nephropathy (2-7). The other renal histological findings in a patient with polycythemiawere
as follows, focal segmental glomerulosclerosis (FSGS) ,membranoproliferative
glomerulonephritis (MPGN) and rapidly progressive glomerulonephritis. Furthermore out of the
10 cases of polycythemia associated with IgA nephropathy described so far all of them happen to
be males. 66% of presented with nephrotic syndrome and 34% had sub nephrotic range of
proteinuria. Only 3 cases reported to have normal renal function whereas others had either
moderate to severe renal dysfunction. All of the 10 patients had hypertension and 3 cases had
hyperuricemia
Recent reports have shown that several cytokines and growth factors play a role in the
progression of renal disease in polycthemia; Namakuraet al. demonstrated abnormally
upregulated mRNA expression of platelet-derived growth factor and insulin like growth factor.
Insulin like growth factor has been implicated in exacerbation of polycythemia (9). Furthermore
the increased blood viscosity and blood volume leads to vascular microthrombi and glomerular
capillary occlusion thus reducing the GFR. Capillary oocclusion leads to ischemia which leads to
chronic renal damage if not reversed on time. Interferon therapy used in polycythemia has also
been reported to cause renal damage
This is the 10th case of polycythemia associated with IgA nephropathy being reported and this is
the first case of idiopathic erythrocytosis being associated with IgA nephropathy. Striking
similarities with other similar case reports are the preponderance in males ( all 10 case reports
being males) and the presence of hyperuricemia, hypertension and renal failure.
Conclusion: There has been an increased presence of IgA nephropathy worldwide and it has
become one of the leading causes of renal failure in young adults. Hypertension and active
urinary sediment is a common finding in most of these individuals, what makes this case report
rare is the presence of idiopathic polycythemia as an additional co factor. As nly 9 such reports
have been made so far and it is essential to dig further into the pathogenesis of polycythemia in
these individuals to know more about this causal relationship.
Our patient improved in terms of renal failure, hyperuricemia and 24 hour urine protein at the
end of 8 weeks further prognosis is not yet known.
CN 9: To Study the clinical profile, management strategies and
predictors of outcome in 90 patients of Emphysematous
pyelonephritis
Hari Krishna Reddy M, Anil kumar. C V, Sangeetha Lakshmi B, Chaitanya V,
Sandeep P, Ram R, Siva Kumar V email: hkrmogili@gmail.com
Objective: To analyze the outcomes of emphysematous pyelonephritis (EPN), the impact of
different treatment modalities, and to determine risk factors associated with mortality.
Methods: We retrospectively reviewed patients of EPN from 2009-2015 at a tertiary care
institute SVIMS in Tirupati. The diagnosis was confirmed with CT scan. Treatment was
classified as follows: medical management (MM), minimally invasive, and surgical.
Demographic, clinical, biochemical, and radiological characteristics were assessed and compared
between survivors and non survivors. Comparison was assessed using 1-way analysis of variance
and chi-square. Univariate and multivariate logistic regression analyses were performed to
determine prognostic factors. Main end point was mortality.
Results: A total of 90 patients were included (64 women and 26 men), with a mean age of
53.9 years. The most common comorbidities were diabetes (95%) and hypertension
(40.3%). Escherichia coli was the most common isolated microorganism (90%).Most common
CT grade is class II (60%). Medical management was provided to 14.0%, minimally invasive
treatment to 62..0%, open drainage to 26.0, and nephrectomy to 4.8%. Overall mortality was
5.0%. Survivors were younger ( P= .004), had lower creatinine ( P = .002), and better estimated
glomerular filtration rate ( P = .007). In univariate analysis, age ( P = .009), creatinine ( P =
.009), and need for nephrectomy ( P = .03) were associated with mortality. In multivariate
logistic regression analysis, creatinine (odds ratio 1.56, 95% confidence interval 1.03-2.35, P =
.03) and nephrectomy (odds ratio 9.7, 95% confidence interval 1.007-93.51, P = .049) remained
significant predictors of mortality.
Conclusion: EPN needs an aggressive medical management and stepwise approach;
nephrectomy should be the last resort of treatment. Creatinine level and need for nephrectomy
are the strongest predictors of mortality according our analysis.
CN 10: Clinical features and outcomes of malignant nephrosclerosis
R Jayasurya, P S Priyamvada, S Haridasan, S Parameswaran, Department of
Nephrology, Jawaharlal Institute of Post graduate Medical Education and Research
(JIPMER), Puducherry 06 email: priyamvadaps@gmail.com
Aim: The current study was performed to find out the etiology, clinical and histopathological
features and outcomes of patients with biopsy proven malignant nephrosclerosis.
Materials and methods: We identified all patients with a kidney biopsy diagnosis of malignant
hypertension from June 2011 to October 2015 . Patients with a clinical diagnosis of HUS/TTP,
APLA syndrome , scleroderma and preeclampsia were excluded . 29 patients were identified to
have malignant hypertension. Clinical records were examined and clinical details were collected
. All categorical variables were analyzed by chi square test and continuous variables were
analyzed by student’s t tests.
Results: The mean age of the population was 40.83+/-13.03 with a male predominance (82.8%).
58.6 % had primary malignant nephrosclerosis whereas the rest had evidence of underlying
kidney diasease.31 % had underlying glomerulonephritis on kidney biopsy and 41.37% had
documented history of hypertension. 65.5% had dialysis requiring renal failure at presentation .
The clinical and histological characteristics of primary and secondary malignant nephrosclerosis
were comparable except for a high diastolic blood pressure in patients with primary malignant
nephrosclerosis. 51.5% continued to be dialysis dependent on long term follow up. 4patients
expired with in the first year of diagnosis ,of which 3 were having dialysis dependent renal
failure .The non-dialysis dependent patients had incomplete recovery of renal function on follow
up (Mean creatinine 2.44 ±.86 mg/dl) .
Conclusions: Primary malignant nephrosclerosis is the commonest etiology of malignant
hypertension in the study population. Majority had no documented history of hypertension .
Majority of patients did not recover their kidney function. The recovery of renal function is
incomplete in those who are dialysis independent.
Discussion: Malignant nephrosclerosis is not uncommon in the current era , in spite of early
diagnosis of hypertension
and wide spread availability of antihypertensive therapy. Renal
survival remains poor in spite of aggressive control of hypertension and supportive therapy.
CN 11: Genetic diagnosis of steroid-resistant nephrotic syndrome in
children: A targeted next-generation sequencing assay using
customized gene panel
Karthik Neelakandan1, Annes Siji1, Varsha Pardeshi 1, Hamsa Reddy2, Arpana
Iyengar2, Anil Vasudevan1,2 1 Division of Molecular Medicine St. John’s Research
Institute, 2 Department of Pediatric Nephrology St. John’s Medical College and
Hospital,
Bengaluru,
India.
email:
anilvasu@hotmail.com,
anil.vasudevan@sjri.res.in
Aim: To explore the potential for molecular diagnosis of SRNS in children using targeted next-generation
sequencing (NGS) approach with a customized gene panel
Materials and methods: DNA samples of ten children with primary SRNS (males: 9 females: 1; age
range: 5 months - 16 years) and 2 apparently healthy subjects were used for the study. A customized gene
panel consisting of 17 most prevalent genes involved in primary SRNS (NPHS1, NPHS2, WT1, INF2,
TRPC6, LAMB2, PLCE1, ACTN4, CD2AP, MYO1E, COQ2, COQ6, LMX1B, NEIL1, PDSS2, PTPRO,
and ADCK4) was designed using Ion AmpliSeq. Simultaneous resequencing of the 17 genes was
performed on the Ion Torrent PGM™ Sequencer using a standardized protocol in our institute. The data
was analysed using Ion Reporter and read outs were checked visually on IGV-2.3.25 viewer. All variants
identified were compared with specific databases and they were classified using stringent criteria as
pathogenic, likely pathogenic unknown significance or likely benign.
Results: Sequencing of NS panel genes in 10 patients with SRNS/FSGS and 2 control individuals
generated a mean of 219K reads per individual. On average, 94% of reads were on the targeted region. A
mean coverage of 453 × was achieved for the 17 genes across all individuals. A total of 20 variants (1
non-sense, 19 missense; 5 homozygous and 15 heterozygous) were identified in 9/17 genes namely
NPHS1, NPHS2, COQ2, COQ6, PLCE1, LMX1B, MYO1E, TRPC6, and PTPRO genes. Disease-causing
mutations were identified in three genes in 2 out of 10 patients (20%). One child had two mutations (1
novel missense mutation in NPHS1, 1 known frame shift mutation in NPHS2) while the second child had
one novel missense mutation in COQ2 gene. We also identified 13 variants of uncertain significance in 7
patients and 2 controls and 4 benign variants (1 patient; 3 controls).
Discussion: This is the first report from India using targeted resequencing for molecular diagnosis of
SRNS using a customised gene panel which established the molecular diagnosis in two patients. The lack
of population based allele frequency may be a limiting factor in the evaluation of variants classified as
uncertain significance. The clinical sensitivity of this 17 - gene panel is being tested in a larger cohort of
SRNS which would help in genetic counselling and clinical decision making in fast and cost efficient
manner.
CN 12: Phlegmasia cerulean dolens
M. Hari Krishna Reddy, Anil Kumar C V, Sangeetha, Chaitanya , R. Ram,
Sandeep P, V. Sivakumar, Sri Venkateswara Institute of Medical Sciences,
Tirupati, email: hkrmogili@gmail.com
Introduction: There are three less frequent manifestations of acute venous thrombosis &
obstruction of the venous drainage of an extremity. They are phlegmasiaalbadolens, phlegmasia
cerulean dolens (PCD) & venous gangrene. The term PCD differentiates ischemia-associated
venous thrombosis from phlegmasia alba dolens, which describes fulminant venous thrombosis
without ischemia. In PCD, the thrombosis extends to collateral veins, resulting in venous
congestion with massive fluid sequestration .Of PCD patients, 40-60% also has capillary
involvement, which results in irreversible venous gangrene that involves the skin, subcutaneous
tissue, or muscle. Venous pressure may increase to 16- to 17-fold within 6 hours. Fluid
sequestration may reach 6-10 L in the affected extremity within days. Circulatory shock, may
evolve.
Case report: A 55-year-old lady, non-diabetic, hypertensive for the past fifteen years, presented
with pedal oedema and breathlessness at rest(NYHA class IV). About a month prior to admission,
she fell down and diagnosed dislocation of left patella. She was treated with a plaster cast and
immobilization for 3 weeks. Investigations revealed serum creatinine: 8.8 mg/dL, blood urea:
150 mg/dL, serum sodium: 138 mEq/L. serum potassium: 6.5mEq/L haemoglobin: 8.5 g/dL,
platelet count: 1.8 lakhs per mm3, serum bicarbonate: 9.4 mmol/L & on ultrasound abdomen:
right kidney: 7.8 x 3.5 cm, left kidney: 8.0 x 3.8 cm. Its our Institute’s protocol to haemodialyse
through femoral veins in all patients. She was initiated on haemodialysis via two single lumen
catheters (14 GA and 13.3 cm, Shinecath, St. Stone Medical Devices Pvt. Ltd., India) placed in
left femoral vein. After three sessions of haemodialysis of one, two & three hours duration on
three consecutive days, an untunnelled internal jugular catheter was placed on right side The
femoral catheters were removed after third session of haemodialysis. On fourth day, the patient
complained pain & blue discolouration of left toes. On examination left lower limb was swollen,
discoloured & cold up to ankle joint. The left dorsalispedis and posterior tibial pulses were not
palpable. In next 12 hours, the signs extended to upper one-third of leg with blebs . A Doppler
study revealed, thrombosis of left common, external iliac, femoral, popliteal, anterior & posterior
tibial veins. There was thrombosis of superficial venous system of lower limb. The arterial
system of the left lower limb did not show occlusive disease. The D-dimer was high. Patient had
3 of 6 "Ps" seen with compartment syndrome – pain out of proportion to the physical findings,
paresthesia, pallor, paralysis, pulselessness, and poikilothermia. The fasciotomy of compartments was
done. She was initiated on unfractionated heparin and antibiotics. On third day of treatment with
heparin the platelet count reduced to 25000 per mm. It was replaced with fondaparinux (7.5 mg
subcutaneous once daily). The treatment with fondaoparinux was overlapped with acitrom
(acenocoumarol) 2 mg per day. The dose was modified to maintain INR at 2.5. On third day
after initiation of therapy, there was hypotension. She required inotropes. A team of cardiologists
and CTVS surgeons opined that she might not be fit for inferior vena cava filter placement &
surgical thrombectomy owing to hypotension. After two weeks there was partial recanalization
of veins but the swelling & pain in leg have worsened. The number of blebs increased& limb
became cold & blue. Below knee amputation of left lower limb performed. During second week,
a Tenckhoff peritoneal dialysis catheter was placed & she was initiated on peritoneal dialysis
after ten days. She was discharged after four weeks.
Discussion: The aetiology of PCD and venous gangrene include malignancy, in 20-40 %of
patients and primary hypercoagulable state such as deficiencies of antithrombin III, proteins
C or S, or plasminogen. Lupus anticoagulant maybe detected. May also occur following
surgery or trauma & postpartum. Prolonged immobility is a precipitating factor. In
approximately 10% of patients no cause is found. In this patient investigations revealed no
hypercoagulable state and lupus anticoagulant was absent.
The highest incidence is between fifth and sixth decades of age and women are more affected
than men. Left lower limb is more affected than right because of overlying of right iliac artery on
left iliac vein. Swelling, pain and cyanosis are the triad of clinical features that characterize
PCD. Cyanosis spreads from distal to proximal involving whole limb.
Heparin helps in preventing proximal propagation of thrombosis. Heparin may act as a hapten,
and thus be targeted by the immune system. Fondaparinuxis used to anti-coagulate patients with
established HIT as it has no affinity to PF-4. We have not contemplated to use novel oral
anticoagulants, dabigatran (direct thrombin inhibitors) and apixaban and rivaroxaban( factor Xa
inhibitors) for these drugs were not approved for patients in stage 5 chronic kidney disease.8
The options to treat the thrombosis include thrombolysis and surgical thrombectomy. Currently,
thrombolysis & thrombectomy are generally reserved for treatment following failure of
anticoagulation or impending venous gangrene. The mortality rate of PCD is between 20 and
40%. Pulmonary embolism responsible for 30% of the deaths reported from PCD. Overall,
amputation rates of 12-50% have been reported among survivors.
PCD and venous gangrene are rare conditions. Nephrologists encounter them only a few times in
a career. In our patient the effect of immobilization appears to be compounded by the femoral
vein catheterization resulting in PCD.
CN 13: A Study of Renal Stone Disease in a tertiary center catering
the South Indian Children
Nikhil Lohiya, Sudha E, Nandhini G, VinodChoudhary,Kalaivani G, Vijayakumar
M, Prabha S Mehta Children’s Hospital, Chennai, India, email:
drnnlohiya@gmail.com
Aim: To study profile and outcome in children with renal stone disease (RSD) and evaluate the
differences between persisting and resolved renal stone.
Materials and methods: A prospective observational study involving 104 children recruited
during June 2006 to 2014. Clinical, laboratory, radiology and treatment data at initial
presentation and 1 year of follow-up recorded. Analysis was done comparing variables among
resolved and persisting stones with appropriate statistical tests using SPSS software.
Results: The mean age of presentation was 5.3±4.5 years with M:F of 62:42. Clinical
presentation was abdominal pain 43.3%, dysuria 34.3%, hematuria 26.3%, %, passage of stones
12.7% and increased frequency in 11.4%. Family history of RSD was present in 45.2%. Pyuria
was noticed in 22.1% and proteinuria in 14.4%. Metabolic work-up showed hypercalciuria
41.3%, hyperoxaluroia 19.2% hyperuricosuria 13.5%. On USG 10.5% children had medullary
nephrocalcinosis and remaining had nephrolithiasis. Stones were located in kidney in 83.5%,
ureter in 9.6% and in bladder 6.7%. Multiple stones were recorded in 47.1% and bilateral in
34.6%. Obstruction features noted in 26.9%. Surgical intervention was done in 15.4% and rest
medically managed. Stone analysis showed calcium phosphate stones in 14, oxalate in 11,
uricacid in 4 and ammonium phosphate in 2. After 1 year follow-up 77.3% had no residual stone.
Children with family history of RSD, nephrotic range proteinuria, hematuria, and multiple stones
were found to be associated with persistence of stones. Independently family history of RSD
(OR 3.9, 95% CI 1.15 to 13.17) was found to have a significant association with persistence of
stone by multivariate analysis.
Discussion: Children with RSD have a varied presentation. Proteinuria, hematuria and multiple
stones are important predictors of outcome after 1 year. Positive family history is not only
common in children with RSD but also useful in predicting the course of disease.
CN 14: Growth and Renal function of Children with Posterior
Urethral Valves – Five Years Post Surgery Follow Up
Vinod Choudhary, Sudha E, Kalaivani G, Prabha S, Vijayakumar M, Mehta
Children’s Hospital Chennai email: drvinod2007@gmail.com
Aim: To assess growth, renal function and factors influencing renal function at 5 years post
surgery for posterior urethral valve (PUV).
Methods: Thirty three children recruited between 2005 and 2009, The age of diagnosis varied
from AN period to 72 months of age, who completed 5 years follow-up after surgery for PUV
were analysed for clinical, investigatory and surgical data. Factors like antenatal (AN)
presentation, high grade VUR, oligohydramnios and serum creatinine at presentation,
intervention in newborn (NB) and beyond NB period, recurrent UTI and scars during follow up
were considered. Study population was divided into two groups: eGFR < 60 ml/min/1.73m2
(group 1) and > 60 ml/min/1.73m2 (group 2) for comparison. All children were managed
according to standard of care per unit protocol. Comparative analysis of factors involved in
outcome of eGFR at 5 years follow-up post surgery was done using SPSS(20.0), Univariate
analysis was used to find the association between variables. P ≤0.05 is considered as statistically
significant.
Results: The commonest presenting symptom diagnosed postnatally was poor urinary stream in
14(77.78%). Intervention in NB and beyond was done in 22 and 11 children respectively. The
age of the study population at follow up was 60-132 months. At 5 years post surgery, 12(36.4%)
were symptomatic with recurrent UTI being the most common symptom. At the end of 5 years
eGFR <60 ml/min/m2 was documented only in 8(24.2%) children. Stunting was noticed in
21.2%. Comparison of factors showed recurrent UTI and renal scars by DMSA to be significant.
Discussion: Even with modernisation of treatment 24-45 % of children progress to CKD with
unfavourable prognostic indicators. Children with recurrent UTI and renal scars had significant
morbidity whereas time of diagnosis, early intervention and high grade VUR did not have
significant correlation. In our series growth and renal function was relatively well preserved with
effective reno-protective measures.
CN 15: Profile And Outcome Of Children With Infantile Nephrotic
Syndrome- A Tertiary Pediatric Nephrology Unit Experience
Kalaivani G, Nikhil Lohiya, Sudha E, Vinod Choudhary, Sangeetha G, Prabha S,
Vijayakumar
M,
Mehta
Children’s
Hospital
Chennai,
email:
dr.kalai8283@gmail.com
Aim:: To study profile and outcome children with Infantile Nephrotic Syndrome (INS).
Materials and methods: Retrospective review of 28 case records with INS was done of whom
23 fulfilled inclusion criteria of 2 years follow-up and were analysed. Data pertaining to clinical,
laboratory, radiology, renal biopsy and management parameters were analysed with SPSS
software.
Results: There were 10 boys and 13 girls. The mean age was10.1±1.5 months. At presentation
all had edema, normal renal function(creatinine 0.37±0.2 mg/dL, eGFR 122.9±86.9
mL/min/1.73m2), nephrotic range proteinuria, hypoalbuminemia (1.64±0.57 g/dL) and
hypercholesterolemia (388.1±91.8 mg/dL). Four (17.4%) had transient hypertension, 2(8.7%)
microscopic hematuria and 4(17.4%) hyperechogenic kidneys by ultrasound. All infants
werestarted on prednisolone. Thirteen (56.5 %) were steroid sensitive NS (SSNS) and10(43.5%)
were steroid resistant NS (SRNS). Infrequent relapse- 4(30.7%), frequent relapsing NS (FRNS)6(46.1%); of whom 5(83.3%)and1(16.7%) responded to levamisole and IVcyclophosphamide
respectively. Steroid dependent NS (SDNS) were 3(23.2%) in whom 2 responded to levamisole
and 1 to cyclophosphamide. All children with SRNS (10) and those before starting IV
cyclophosphamide in SDNS (1) and FRNS (1) group underwent renal biopsy. Histology revealed
minimal change nephropathy (MCN)- 8(66.7%), focal segmental glomerulosclerosis (FSGS)3(25%) and diffuse mesangial sclerosis (DMS)- 1(8.3%).Late SRNS documented in 2(20%) of
whom 1 with MCN responded to IV cyclophosphamide and other with FSGS attained partial
remission with tacrolimus. In 8(80%) primary SRNS 5(62.5%)with MCN were started on IV
cyclophosphamide of whom 4 responded well and 1on tacrolimus developed renal toxicity,
2(25%) FSGS infants started on tacrolimus 1 responded well and other attained partial remission
and 1(12.5%) with DMS died due to septicemia. Ultrasonography showing hyperechogenic
kidneys in 4 infants belonged to SRNS group. The difference between SSNS and SRNS group
presentation was not significant (P>0.05).
Discussion: INS has a varied outcome and not all INS are steroid resistant. Steroid responsive
infants do well. Genetic testing and further studies are needed for understanding optimal
outcome in INS.
CN 16: Study of IgG4 staining in Membranous Nephropathy
Murugananth S , Anila A 1 , Dinesh kumar T, Dhanapriya J, Sakthirajan R, Malathy N,
Balasubramaniyan T, Gopalakrishnan N , Department of Nephrology, Madras Medical College,
Chennai . 1 Renopath Center For Renal and Urological, Chennai, email: drmuruga97@gmail.com
Back ground: Membranous nephropathy is the commonest cause of nephrotic syndrome in
adults. Differentiation of idiopathic membranous nephropathy (iMN) from secondary MN(sMN)
is sometimes difficult. Various studies have documented 60 -70 % prevalence of serum Anti –
Phospholipase A2 receptor antibody ( APLA2RAB) in iMN with a specificity of 95 – 100%.
Dominance of IgG4 subclass of IgG in kidney biopsy in iMN has been observed. Hence IgG4
staining of kidney biopsy may aid in analysis of APLA2RAB negative patients with MN in
whom potential secondary causes have been ruled out.
Aim: To study the IgG4 staining pattern in renal biopsy in patients with MN.
Materials & Methods: A retrospective study of 17 patients with biopsy proven MN.
Investigations including serum APLA2RAB were done. Those who tested positive for
APLA2RAB were considered as iMN. Those with identifiable secondary causes were
considered to have sMN . Immunoflorescence study for the presence of IgG4 in glomerular
capillaries was done from archival paraffin kidney biopsy block.
Results: Of the 17 patients 9 were males. Mean age- 37 years . Of the four patients of iMN (
serum APLA2RAB –positive) 3 showed positivity for IgG4 staining (75%). Five patients had
secondary causes (lupus nephritis -3, hepatitis B -1, history of native medicine intake -1 ). Of
these only one patient had positivity for IgG4 staining (20%). Of the eight patients with
presumed iMN ( secondary causes ruled out by appropriate tests and followed for atleast 6
months, but serum APLAR was negative) 6 had positive for IgG4 staining (75%).
Conclusions1. There is significant concordance between serum APLA2R antibody positivity and IgG4
staining (75%).
2. IgG4 positivity in kidney biopsy can be considered as a marker of iMN.
CN 17: Renal Manifestations in Non-Renal malignancies
Archana,V. Suresh Babu, Urmila Anandh, Aruna, Department of Nephrology,
Yashoda Superspeciality Hospital, Hyderabad, email: drarchana_s@rediffmail.com
Aim: To determine the incidence of renal diseases in non- renal malignancies. To know the
effect of the treatment of primary malignancy on kidneys and to study the impact of renal
involvement on mortality and morbidity.
Materials and methods: It is a cross sectional study conducted in Yashoda Hospital Hyderabad
over 2 years of period. Total 550 patients with non -renal malignancies were admitted and out of
them 95 patients had renal involvement. Patients with Diabetes, pre-existing renal disease and
renal transplantation were excluded from the study. Patients were assessed byclinical details and
relevant investigations. Chi-Square test and odds ratio were used as statistical tools for data
analysis.
Results: Total No. of patients (n =95),Mean age of the patient 55yrs(range 39-72yrs). The study
population included 61 male patients (64.20%) and 34 female patients(35.80%). Out of 95
patients, 31 patients (32.70%) were with haematological malignancies and 64patients (67.30%)
had non-haematological malignancies.
Renal Manifestations
Number of patients (percentage)
AKI
Obsrtuctive Nephropathy
31(32.63%)
ATN
10(10.53%)
TumorLysis Syndrome
06(06.31%)
Drugs
NSAIDs
10(10.53%)
Aminoglycosides
01(01.05%)
Contrast Media
01(01.05%)
CKD
02(02.10%)
Glomerulonephritis
MCD
05(05.26%)
MGN
02(02.10%)
LCDD
02(02.10%)
AD
01(01.05%)
Dyselectrolemia
Hyperkalemia
40(42.10%)
Hypercalcemia
26(27.36%)
Hyperphosphatemia
15(15.78%)
Hypocalcemia
13(13.68%)
UTI
Hyponatremia
Hyperuricemia
Hypokalemia
With obstructive
Nephropathy
Without obstructive
Nephropathy
11(11.57%)
06(06.31%)
04(04.21%)
13(72.22%)
05(27.78%)
Conclusion: The incidence of renal involvement is significant in non- renal malignancies.
Obstructive Uropathy is the commonest cause of AKI. Drug induced (NSAIDs) AKI is common.
More than 50% patients required renal replacement therapy. Minimal change disease and
membranous nephropathy are frequently associated glomerulopathies while hyperkalemia and
hypercalcemia are common dyselectrolemias in these patients.
CN 18: Mesoamerican Nephropathy in North Kerala
Dipin S, M Sreelatha, Noushad TP, Jayakumar E K, Medical College Kozhikkode
dipins1234@gmail.com
Introduction: Mesoamerican Nephropathy, also called as Chronic Dehydration Nephropathy is
a newly recognized cause of CKD in people working in hot climatic zones with episodes of
dehydration. Classical clinical picture includes CTID with hyperuricaemia and gouty attacks.
A similar form of unexplained CTID with hyperuricaemia, gout and renal calculi is found to be
common among gulf returneesworking in similar occupational environment ( working in
kitchen). Renal pathology and clinical characteristics in this group have not been reported so far.
Whether it can be considered analogous to the already reported Mesoamerican nephropathy in
Central America needs further clarity.
Methods and Results: 7 patients with similar clinical characteristics were recruited from the
patient population attending Nephrology Department, Medical College Calicut. All of them were
gulf returnees or currently working in the Middle East, with occupational exposure to heat and
settings of dehydration. All of them were males with a mean age of 49.1yrs (40-60), with most
having hypertension (3/7), dyslipidemia (2/7) renal calculus disease (3/7), gouty arthritis (3/7).
Evaluations revealed bland urinary sediments or minimal proteinuria (6/7),shrunken kidneys
(7/7), with associated hyperuricaemia (7/7). The GFR at the time of presentation was<30 ml in
the majority (5/7), with relatively mild symptoms to account for.
Discussion: Our observation from the present case series possibly suggests a group of
tubulointerstitial disease unique to this population with similar environmental exposures and
epidemiological characteristics. A study of renal pathology was not feasible among the recruited
cases as all of them had shrunken kidneys at the time of presentation. Most epidemiological and
clinical characteristics being similar to the now well established Mesoamerican nephropathy,
may suggest a similar pathophysiology and analogy to the same.
CN 19: Clinical and pathological profile of patients with C3
glomerulopathy – an Observational study
Sarfaraz Aslam, Sreelatha M, Noushad TP, Department of Nephrology, Govt
Medical College, Kozhikode, email: sarfaraz.doc@gmail.com
Introduction: C3 glomerulopathy is a disease process due to abnormal control of complement
activation, deposition or degradation. It is characterized by predominant glomerular C3
deposition with electron dense deposits on electron microscopy. It often progresses to ESRD and
recurs after transplantation.
Aim: (1) To study the clinical and pathological profile of patients who had renal biopsy findings
suggestive of C3 glomerulopathy (2) To study clinical response of patients to
immunosuppressive strategies
Methodology: All patients with biopsy findings suggestive of C3 glomerulopathy from January
2011 to June 2015 were included. The demographic profile, clinical presentation and
biochemical profile at presentation were noted down. The pathological findings on renal biopsy
were studied. These patients were followed up. If these patients received immunosuppression the
response was also noted.
Results: 16 patients who satisfied the inclusion criteria were included in the study. 8/16 (50%) of
the patients were in the age group 10-19 years, 3/16 (18.75%) in the age group 20-29 years and
30-39 years. 10/16 of our patients were males (62.5%). The most frequent clinical presentation
was acute nephritic syndrome. 8 patients had normal C3 at presentation (50%). 5/16 patients
presented with cresentric glomerulonephritis. 2/16 (12.5%) patients had normal biopsy on Light
microscopic examination. 12 patients were subjected to immunosuppression. Of them in 2
patients it had to be stopped due to opportunistic infections. In 4 patients there was complete
remission and RFT normalized. In 6 patients there was only partial response or no response. 1/16
patient progressed to ESRD requiring RRT. 1/16 patient progressed to ESRD and is on
conservative measures.
Discussion: C3 glomerulopathy is increasingly being recognised, predominantly affecting the
younger age group. The most common clinical presentation was acute nephritic syndrome. A
significant proportion had normal C3 levels at presentation. Cresentric glomerulonephritis was
seen in 31.25% of patients on renal biopsy. Immunosuppression may have a role in management
of this condition though a significant percentage can progress to ESRD.
CN 20: Biomarkers in Preeclampsia – are they good enough?
Monica K, Abhinesh V , Vivek Praveen R, Chandramohan G, Thirumavalavan S,
Noor Mohammed SAK, Srinivasaprasad ND, Sujit S, Edwin Fernando
M,Vasanthamani, Srinivasa Raman, Govt. Stanley Medical College& Anderson
Laboratory , Chennai, TN, email: nephroeddy@gmail.com
Introduction: Pre-eclampsia is a pregnancy-specific hypertensive disorder that may lead to
serious maternal andfetal complications.Recently Soluble fms like tyrosine kinase(SFLT) and
Placental growth factor(PlGF) and and the ratio between these two were found to be sensitive
biomarkers.
Aims & objectives: To study the maternal biomarkers SFLT & PlGF in pregnant mothers to
predict preclampsia.
Methodology: Case cohort prospective study in the antenatal clinic. High risk normotensive
normoglycemic pregnant women between 15 to 20 weeks of gestation were subjected to this
study. Inclusion criteria included primigravida,less than 20yrs,elder more than 30, previous
preeclampsia, bad obstetric history, obese -BMI more than 30. Exclusion criteria – preexisting
hypertension, chronic renal failure, multiple pregnancies, diabetes mellitus, other autoimmune
diseases. Blood was drawn between 15-20 weeks for these biomarkers and patients were
followed till delivery.
The data was analysed using SPSS version 16.ROC curves were obtained and positive predictive
and negative predictive value for the tests were obtained
Results: 50 patients were studied,mean age was 25  5.4. 5 patients were lost to followup,6
developed preclampsia by ACOG criteria of 2013.SFLT was done by ELISA and Time resolved
fluoroimmunoassay by DELPHIA method was used for PlGF. Kits manufactured by Qayee –
Bio.6 pts developed preeclampsia.None of these 6 patients had any abnormalities of the
biomarkers.
SFLT
AUC
0.48
CUT OFF
174.6
SENSITIVITY
50.00%
SPECIFICITY
49.70%
PPV
52.60%
NPV
48.40%
ACCURACY
49.85%
PlGF
AUC
CUT OFF
0.679
192
SENSITIVITY
66.70%
SPECIFICITY
56.40%
PPV
56.50%
NPV
44.20%
ACCURACY
61.50%
Conclusions: Novel biomarkers like SFLT andPlGF did not pick up preclampsia in the
population
studied.
cn
CN 21: Prevalence of Subclinical Hypothyroidism in patients with
Chronic Kidney Disease
Siva Somana J , Srinivasaprasad ND Sujit S, Vivek Praveen R, Chandramohan G,
Thirumavalavan S, Noor Mohammed SAK, Abhinesh V, Edwin Fernando M
Govt. Stanley Medical College, Chennai, TN. email: nephroeddy@gmail.com
Introduction: Subclinical hypothyroidism is found to be 4 – 10% prevalent in the general
population. In the third NHANES participants, CKD was found to be associated with a higher
prevalence of clinical and subclinical primary hypothyroidism. At present there is scarcity of
Indian data about the prevalence and the factors associated with subclinical hypothyroidism in
persons with non dialyticCKD.
Aims: 1. To evaluate the prevalence of subclinical hypothyroidism in patients with CKD.2. To
study the correlation between thyroid dysfunction and the various stages of CKD.
Materials and methods: This analytical study was conducted in nephrology clinic between Dec
2014 and May 2015. Study population consisted of 50 controls (healthy persons aged more than
20yrs who had master health checkup) and 50 CKD patients undergoing treatment for at least 6
months in nephrology clinic. The study population was tested for serum urea, creatinine, total
protein, free T4 and TSH. GFR was calculated using MDRD formula.
Statistical methods: Students unpaired t test, Chi square test and Pearson coefficient of
correlation were used.
Results: According to the study there exists significant difference in TSH, urea, creatinine, BP,
total protein and eGFR values between cases and controls.50% of patients were in stage IV.
Stage II, III and V has 14%, 16% and 20% patients respectively. Thyroid abnormalities are 42%
among males and 24% among females. Prevalence of thyroid abnormalities increases as the
duration of CKD increases. Thyroid abnormalities are found in 66% of CKD patients.
Subclinical hypothyroidism (SCH) was found in 6% of controls and 40% of cases.92% of cases
and all controls have normal freeT4 levels.6% of cases have lower FT4 values and 2% have
higher FT4 levels. The TSH levels in CKD patients range from 0.14 to 30 mIU/ml and the free
T4 levels persists in the normal range. Among CKD patients the prevalence rates of SCH,
hypothyroidism, subclinical hyperthyroidism and hyperthyroidism were 40%, 20%, 4% and 2%
respectively. 34% of CKD patients have normal thyroid function. The prevalence of thyroid
abnormalities in stages II, III, IV and V were 71%, 63%, 56% and 80% respectively. Prevalence
rates of SCH in the CKD stages II, III, IV and V were 8%, 10%, 20% and 16% respectively.
Pearson’s correlation coefficient shows that TSH varies directly with urea and inversely with
eGFR and free T4 varies directly with eGFR and inversely with urea and creatinine.
Conclusions: 1. The prevalence of Subclinical Hypothyroidism is high among all the stages of
CKD patients.2. The prevalence of thyroid abnormalities increases with increasing stage of
CKD.
CN 22: Factors determining clinical response of Membranous
Nephropathy: A single centre descriptive study of Indian cohort
Nithin. J, Bushra Bahjat, Renuka.S, St. Johns’ Medical College, Bangalore, email:
drnithinj@gmail.com
Aim: To study the factors determining the clinical outcome of membranous nephropathy.
Materials and methods: This is retrospective descriptive study from 2010 till date. We recorded
demographic data, clinical outcome of all the follow up patients in OPD with membranous
nephropathy. Serial monitoring of laboratory values were done. We included only those patients
regular on treatment and follow up. Patients were divided into 2 groups with group A consisting
of patients with normal renal function & group B with abnormal renal function at presentation.
Statistics was analyzed using SPSS 22 version software. Categorical data was represented in the
form of Frequencies and proportions. Chi-square was used as test of significance. Continuous
data was represented as mean and SD. ANOVA (Analysis of Variance) was the test of
significance to identify the mean difference between more than two groups. p value <0.05 was
considered as statistically significant.
Results: Mean age group in our study was 43.35 ± 12.62 yrs, with 65% being males. Group A
consisted of 69% of patients while group B consisted 31%.Hypertension were present in 12.5%
and 21% of group A and B respectively. Nephrotic range proteinuria was predominant in both
groups (group A- 87.5% and group B- 79%). Equal percentage (50%) of patients in group A had
complete and partial remission with better response to ACEI/ARB and Modified Ponticelli
regimen. Lower rates of complete remission (20%) were noticed in group B. Histological chronic
changes were more in group A. Regression analysis was not significant for chronicity, serum
albumin and hypertension and didn’t correlate with outcomes.
Conclusions: The clinical response to therapy was better in group A patients with normal renal
functions (p value<0.05).Histological chronicity, serum albumin and presence of hypertension
didn’t correlate with outcomes.
CN 23: Renal biopsy in the very elderly
Jansi Ramesh, Anila Abraham Kurien, Center for renal and urological pathology,
Chennai, email: anila_abraham08@yahoo.com
Aim: Very few studies have focused on renal biopsy finding in very elderly(>80yrs) patients and
no published data is available from our country. This study aims to
1) examine the clinical presentation, histopathological diagnosis of the renal biopsy in very
elderly patients
2) compare our findings with published data.
Materials and methods: Biopsies from patients aged ≥ 80 yrs were included in this study.
Native kidney biopsies reported between Aug2013-November2015 were reviewed and 17
biopsies identified. Patient demographics, clinical findings and histopathological diagnosis were
evaluated. Our findings were compared with published data
Results: There were 7484 native kidney biopsies over this period, 21(0.28%) were from patients
≥80 years of age,(M15:F6). Rapidly progressive renal failure(RPRF)(9,42.9%), nephrotic
syndrome with renal failure(RF)(5,23.8%), nephrotic syndrome(4,19% ) and acute kidney
injury(AKI)(3,14.3%) were the indications for biopsy.
Among the 9 patients with RPRF, 8 had infection related glomerulonephritis(IRGN) of which
one was IgA dominant and another underwent crescentic transformation. The remaining case
showed acute tubular injury.
All 5 cases of NS with RF had minimal change disease and acute tubular injury on biopsy, 4 of
these patients were on NSAIDS. AL-Amyloidosis, diabetic nephropathy, membranous
nephropathy and FSGS secondary to hypertension were the biopsy diagnosis in patients who
presented with NS.
Three patients who presented with AKI had acute tubular injury.
Discussion: IRGN is an important cause of renal dysfunction in the very elderly, not reported
previously. NSAID induced minimal change disease with associated acute tubular injury is
another cause of acute renal dysfunction in this age group. Clinical indications and
histopathological findings in our population are different from that published in literature. Renal
biopsy is a valuable diagnostic tool to provide an accurate diagnosis and initiate specific
treatment
in very
elderly patients
CN 24: Role of vascular endothelial function assessed by angio
defender method and AVF anastomosis angle in AV fistula
maturation- single center study.
Sonu Sing Patil, Ilangovan V, Nirmala, Vasanth G, Vikas C, Ramswamy S, K.G
Hospital and P.G Institute, Coimbtore, dr.sonusing40@yahoo.in
Aim: Role of vascular endothelial function assesed by angio defender method and AVF
anastomosis angle in AV fistula maturation- single center study.
Background: Many arteriovenous fistulas (AVF) fail prior to use due to lack of maturation.
Determining vascular endothelial function prior to surgery may be helpful to predict subsequent
AVF maturation.The AngioDefender system represents a innovative solution to the technical,
clinical, ease of use and cost challenges relating to assessment of endothelial dysfunction. These
advantages position AngioDefender testing to become part of the standard screening
methodology applied by physicians to their patients.
Materials and Methods: It is prospective observational study, 24 CKD stage 5 patients were
included into the study. Vascular endothelial function was measured by angio defender prior to
surgey. All surgeries will be done by single surgeon and by end to side anastomosis.
Arteriovenous Anastomosis picture was taken after release of vascular clamps on surgery table
to measure arteriovenous anastomosis angle. All surgeries are brachiocephalic fistula. AVF
assement was done every weekly and date of cannulation decided by nephrologist and two senior
dialysis technicians.
Results: Out of 24 patients 6 patients (25%) had primary AVF failure and 18 patients had
working AVF. Mean value of endothelial function by angidefender was 7±2.2%. The AVF
primary failure rate was 11.1% and 33.3% for angiodefender value more than 7% and less than
7% respectively. AVF anastomosis angle less than 90 degrees was associated with primary
failure in 50% of cases while only 12.5% had primary failure with angle more than 90 degrees.
Conclusion: Vascular endothelial function has no role in predicting AVFistula success but obtuse
AVF anastomosis angle has role in predicting AVF success. Further evaluation iin a larger
sample is needed to confirm role of endothelial function and role of AVF anastomosis angle in
fistula patency.
CN 25: Acquired partial lipodystrophy and Membranoprlifertive
glomerulonephritis type I -A case report.
Aruna M, Harikrishna Reddy M, Anil Kumar C V, Sangeetha.B, Chaitanya V,
Sandeep, Ram R, Siva Kumar V, Sri Venkateswara Institute of Medical Sciences,
Tirupati, email: aruna.mangipudi@gmail.com
Acquired partial lipodystrophy is commonly associated with membranoproliferative
glomerulonephritis (MPGN) type II. We report a rare case of co-existence of acquired partial
lipodystrophy with MPGN type I in a 12-year-old boy who presented with progressive thinning
of skin over the face for last six months and swelling of feet15 days. Examination revealed fat
loss in a ‘‘cephalocaudal’’ distribution involving face , neck, upper limbs, thorax, and abdomen;
with sparing of the lower extremities and there was pedal oedema. Urine routine and microscopy
showed plenty of red blood cells/hpf , serum creatinine was 3.9 mg/dL, blood urea was 88
mg/dL, serum sodium was 132 mEq/L, serum potassium: 4.4 mEq/L, haemoglobin was 12.1
g/dL serum total proteins were 4.4 g/dL, serum albumin was 2.5 g/dL, serum cholesterol was 325
mg/dL, serum triglycerides were 275 mg/dL and 24 hour urine protein was 11.8 g. Renal biopsy
showed extreme lobularity and increased mesangial cellularity, diffuse increase in mesangial
matrix and thickening and ‘double contour’ appearance of the glomerular capillary walls.
Immunofluorescence revealed granular deposition of C3, and IgG suggestive of MPGN and
electron microscopy showed electron-dense deposits in the subendothelium conforming the
diagnosis of MPGN type I. Patient was started on oral Prednisolone 40 mg/m2/ alternate day,
dipyramidole and aspirin. After six months, injection cyclophosphamide, six monthly doses of
500 mg were given as there was rise in serum creatinine. After 24 months of initial diagnosis, the
patient had to be initiated on renal replacement therapy.
CN 26: A case of acquired Bartter syndrome induced by topical
neomycin
Unnikrishnan Ramachandran,Varada Aravindan, Sebastian Abraham,Usha Samuel,
Jayakumar K P, Government Medical College Kottayam, email:
nephrology.department@gmail.com
Aim: To describe a case of Bartter syndrome attributable to Topical use of Neomycin oinment
Case Report: A 65 year old male with history of systemic hypertension of 6 year duration and
eczema bilateral feet of 2 year duration presented with history of altered behaviour, gait
instability and polyuria of 10 day duration. 6 months back he was diagnosed to have
hyponatremia and hypokalemia when he presented with increased tiredness and abnormal
behaviour to neurology department. He was diagnosed to have frontal lobe dysfunction
secondary to hyponatremia and I/V correction was given. He became asymptomatic and hence
was discharged. But no cause was identified for the disturbance during that admission.
Examination and investigations: On examination BP 140/80 mm Hg,weaping eczema feet with
secondary infection, no focal neurological deficit. BRE, Cr WNL,Na-106.K2.5 Ca7.4,PO44,Mg
1.2.ABG Ph 7.46 HCO3 28,PCO2 44 Urine specific gravity 1.005 Urine Ca 430 mg/dy; Urine
Na 30 Meq/Dy; Urine K + 18 meq/l Fractional excretion of PO4 7%. Investigations suggested
hyponatremia, hypokalemia,hyperurecemia,metabolic alkalosis suggestive of bartters syndrome.
Results: Patient's drug history was reevaluated the topical agent that he was using for the past 2
years was a mixture of clobetazone and neomycin. Since aminoglycosides are known to cause
bartter syndrome it was stopped. On follow up the patient remain symptom free and his
electrolyte values normalized.
Discussion: There has been reports of topical neomycin induced deafness and anaphylactic
shock,which is attributable to enhanced systemic absorption after application on
fresh/weeping/granulating wound. Aminoglycosides directly activates the calcium sensing
receptor in the thick ascending loop of Henle and the distal tubule, resulting in hypokalemia,
metabolic alkalosis, hypomagnesemia with hypermagnesuria, and hypercalciuria.
CN 27: A Comparative study on the Effectiveness of Prednisolone
versus Deflazacort in Adult Nephrotic Syndrome
Unnikrishnan Ramachandran, Varada Aravindan, Sebastian Abraham, Usha
Samuel, Jayakumar K P, Government Medical College Kottayam,
nephrology.department@gmail.com
Aim: To study the efficacy and side effect profile of oral Deflazacort and compare it with oral
Prednisolone in inducing remission in new onset Nephrotic Syndrome.
Materials and methods: Sixty consecutive patients who presented with nephrotic syndrome to
the nephrology outpatient department were studied. 20 patients received deflazacort and 40
received prednisolone. They were reviewed every 2 months during the total study period. 50%
reduction in proteinuria and adverse drug reaction profile were compared and statistically
analyzed using appropriate methods.
Results: Majority of the study subjects were <40 yrs(60%).More than half 57% of the study
subjects were females. Most common histological diagnosis was Minimal Change Disease(68%).
MCD had the highest incidence for all the age groups. Baseline characteristics
(Age,gender,weight,,Systolic and diastolic BP,Base line proteinuria, serum cholesterol and blood
sugar) values were comparable in both the treatment groups. Both groups had significant
reduction in proteinuria as assessed by Wilcoxon Signed-Rank test.Proteinuria between the two
groups were compared using Mann Whitney U test. The median proteinuria was significantly
lesser in the deflazacort group during all follow up visits. All patients treated with Deflazacort
achieved 50% reduction in proteinuria compared with 82.5% in the prednisolone group.
Deflazacort produced a faster reduction in proteinuria, 45%vs2.5% in first visit,85%vs17.5% at
the second visit. The number of reported adverse effects was less in deflazacort group even
though not statistically significant.
Discussion: Patients in the Deflazacort treated group achieved 50%reduction in proteinuria
earlier than in prednisolone treated group. Overall incidence of adverse effects though
statistically not significant was lower in deflazacort treated group. Larger samples with sufficient
follow up are required to prove the claims of safety of deflazacort as reported in earlier literature.
CN 28: IgG4 Related Chronic Tubulointerstitial Disease in an old
case of Castleman’s Disease
Karan S1, Srikanth P1, Ravindra P1, Shankar P1, Dharshan R1, Mahesha V2, Sindhu
K1, Srinivas S1, Ashwani S1, Mohit M1 1Department of Nephrology, KMC,
Manipal, Karnataka, 2Department of pathology, Manipal Hospitals, Bangalore
email: karan.doc@gmail.com
Introduction: IgG4 related disease is a newly recognized fibroinflammatory condition
characterized by lymphoplasmacytic infiltration, storiform fibrosis, and obliterative phlebitis.
It mimics many malignant, infectious, inflammatory disorders and links many disorders
previously regarded as isolated, single-organ diseases without any known underlying systemic
condition. Here we report a rare case of IgG4 related chronic tubulointerstitial disease occurring
in a patient who had Castleman’s disease in the past.
Case: A 37year old male presented in 2012 with asymptomatic cervical lymphadenopathy. On
excision biopsy he was found to have castleman’s disease and was treated conservatively. Patient
was asymptomatic till recently and presented to us with nocturia for 6 months. Physical
examination was normal. Lab data showed 2+ proteinuria with bland sediments, 24 hour urine
protein was 1.6gm, low C3/C4, ANA negative with serum creatinine of 5.0mg/dl. USG abdomen
showed bilateral bulky kidneys with heterogenous echotexture. Renal biopsy showed diffuse
areas of interstitial fibrosis and plasma rich inflammatory cells with focal areas of classic
storiform fibrosis. IgG4 staining was noted in >25 cells/hpf. Findings were suggestive of IgG4
related disease. He was started on 1mg/kg/day prednisolone. On follow up his kidney sizes have
reduced, proteinuria has decreased to <500mg/day and creatinine is stable at 4.0mg/dl.
Discussion: Renal involvement in IgG4 related disease occurs mostly in the form of interstitial
nephritis (19%) and is often associated with involvement of other organs (96%). Isolated renal
involvement is rare. We report a case of IgG4 related disease with isolated renal involvement in
an old case of Castleman’s disease.
CN 29: Diagnostic Utility of Urine Dipstick Test in Patients with
Suspected Urinary Tract Infection Requiring Hospitalization
Prashant Bafna, Deepanjali S, Jharna Mandal, RP Swaminathan, P.S. Priyamvada,
Jawaharlal Institute of Postgraduate Medical Education and Research (JIPMER)
email: bafnaprashantgadag@gmail.com
Aim: To determine the diagnostic performance characteristics of urinary dipstick tests in patients
with suspected urinary tract infection requiring hospitalization.
Material and methods: This was an analytical study done in JIPMER emergency care where patients
>13 yrs presenting with symptoms and signs of UTI requiring hospitalization were included. Cases of
CA-UTI were excluded. Patients midstream urine was collected in clean container and dipstick test was
performed with SiemiensMultistix 10SG for leukocyte esterase(LE) and nitrite(NT). Urine microscopy
and culture was done within 2 hrs.
Results: When dipstick were compared with microscopy, the sensitivity, specificity, positive predictive
value (PPV), negative predictive value(NPV) and diagnostic odds ratio(DOR) for LE were
95%,55%,95%,55% &24 respectively and those of NT were 55.4%,71%,95%,15.4% & 3.7 respectively
and combination of LE+NT had higher specificity(80%) and PPV(96.2%). When dipstick is compared
with culture, the sensitivity, specificity, PPV, NPV and DOR of the LE were 87%,27.1%,27.7%,46.3%
and 2.26 respectively and those of NT were 63.7%,70%,79.6%,49.4% and 3.82 respectively and
combination of LE and NT had highest specificity(82.8%), PPV(88.8%) and DOR (11.9).
Discussion: Several laboratory based studies had higher NPV and concluded that if dipstick is negative
for LE & nitrite, UTI can be "ruled out".However in emergency care based studies where clinical features
also were taken into consideration, comparatively low NPV was found. In our study, when dipstick is
compared with microscopy and culture, higher specificity and PPV was found. In general, in a patient
with low pretest probability of UTI, negative dipstick rules out disease. Conversely, a positive test in
patient with classic symptoms of UTI and high pretest probability may adequately confirm the disease.
When the various combinations are considered, a combination of LE+ NT was found to have the DOR of
11.9. Hence, this combination may be helpful in “ruling in” UTI.
CN 30: Monoclonal gammapathy of renal significance (MGRS)single centre experience
T. Arun Varghese J. Dhanapriya, T. Dineshkumar, R. Sakthirajan, N.Malathy, T.
Balasubramaniyan, N. Gopalakrishnan, Madras medical college email:
arun.arun.ncj@gmail.com, mmcnephro@gmail.com
Aims: To study the clinical and patholologic presentations of disorders caused by monoclonal
immunoglobulin deposition in the kidneys and their followup over two and half years.
Materials and methods: Patients admitted to Madras Medical College Nephrology department
between March 2013 to September 2015 and having monoclonal immunoglobulin deposition in
renal biopsy were studied. Clinical features, hematologic characteristics and kidney biopsy
findings were evaluated. Treatment regimen included Bortezomib, Thalidomide and high dose
Dexamethasone.
Results: Twenty five patients were studied. Renal biopsy details
Cast nephropathy
13
Light chain deposition disease(LCDD)
9
AL amyloidosis
4
Light chain proximal tubulopathy (LCPT)
5
Heavy chain deposition disease (HCDD)
3
Proliferative
monoclonal
glomerulonephritis
immunoglobulin
with 1
deposition
disease (PGNMID)
Two patients had triple lesion in biopsy (cast nephropathy, LCDD and LCPT). Seven patients
had combined cast nephropathy with LCDD. Cast
nephropathy with LCPT and cast
nephropathy with amyloidosis were found in one patient each.
Monoclonal proliferation could be identified in serum in 22 patients (88%)(serum protein
electrophoresis- eleven patients, serum immunofixation electrophoresis - five patients
and
serum free light chain assay - two patients. Plasma cell proliferation in bone marrow (bone
marrow plasma cells less than 10%) could be identified in 15 patients (60%)
At presentation eight patients had subnephrotic/nephrotic proteinuria, twelve patients had rapidly
progressive renal failure (RPRF) and three patients had advanced chronic kidney disease. Two
patients had plasmacytoma. All patients presenting with RPRF required dialysis at presentation.
On follow up mortality was maximum in patients presenting with RPRF(50%).Among patients
with RPRF four patients(33.3%) became dialysis independent. In patients presenting with
nephrotic/subnephrotic proteinuria 2 patients (25%) had complete or partial remission and 2
patients (25%) expired. Sepsis was the contributing cause of mortality in all patients.
Conclusion: Patients presenting with RPRF have high mortality. Monoclonal immunoglobulin
deposits in kidneys can be seen without demonstrable monoclonal proliferation in serum and
bone marrow as in HCDD. There is high morbidity and mortality varying with clinical
presentation, renal histology and presence of sepsis.
CN 31: Clinical Spectrum and Renal Outcome in Collapsing
Glomerulopathy – Single Centre Experience
Padmakumar C, Dinesh kumar T, Dhanapriya J, Sakthirajan R, Malathy N,
Balasubramaniyan T, Gopalakrishnan N , Anila A 1Madras Medical College,
Chennai, 1Renopath Center For Renal and Urology, Chennai, email:
mmcnephro@gmail.com
Background: Collapsing glomerulopathy is a distinct histopathological pattern with
heterogenous etiology, characterized by collapse of capillary tufts with hyperplasia and
hypertrophy of the epithelial cells and marked tubulointerstitial changes. Collapsing
glomerulopathy has been reported sparsely as case reports and small studies.
Aim: To analyse the clinical profile, laboratory parameters and treatment outcome of collapsing
glomerlopathy in renal biopsy of native/allograft kidney.
Materials and Methods: A retrospective analysis of collapsing glomerulopathy in the biopsy of
native/allograft kidney over 2 years from January 2014 to November 2015. Detailed
demographic and clinical data were recorded including clinical presentation, course of disease,
treatment and renal outcome till the last follow-up.
Results: Out of the 998 kidney biopsies(allograft kidney biopsy -131), there is 6 patients (0.6
%). had collapsing glomerlopathy. Mean age of the patients was 38 years(22-60y).There was
female predominance(M:F 1:5). At presentation oliguria and hypertension were noted in 5(83%).
Nephrotic proteinuria at presentation was 4(67%). Mean serum creatinine at presentation was
5.3mg/dl(2.2-7.7mg/dl). Mean urine spot PCR of 5.5. Two graft kidney CG patients tested
positive for CMV treated with IV Ganciclovir and ACE inhibition had graft dysfunction. Two
postpartum CG patients also showed evidence for TMA and received plasmapheresis. One
patient had severe sepsis(splenic abscess). In one patient the cause for CG was unknown. At
three months follow up, two postpartum CG and Septicemia with CG had normal renal function.
Two post transplant patients with CG had graft failure and dialysis dependency.
Conclusion: In our study, CG portends poor prognosis (50% progress to ESRD. Postpartum
TMA associated CG showed better outcome.CG in renal transplant recipients had poor outcome
CN 32: Myoglobinuric acute tubular injury
Jansi Ramesh, Anila Abraham Kurien, Center for Renal and Urological Pathology,
Chennai,
email: anila_abraham08@yahoo.com
Aim: Rhabdomyolysis occurs due to injury to skeletal muscle fibres and the release of muscle
contents into circulation. Myoglobinuria occurs due to rhabdomyolysis and it causes renal failure
in about 15%-33% of cases. The purpose of this study is to present the various causes and
histopathological findings in immunohistochemistry(IHC) proven cases of myoglobin cast
nephropathy.
Materials and methods:
Medical records of all patients were reviewed from 1.1.15 to 30.11.15 (11 months). The criterion
for inclusion in the study population was IHC proven cases of myoglobin cast nephropathy.
Results:
Fourteen patients, ten males and four females were included in the present study. The mean age
was 31 years and range of 16 to 55 years. Indication of renal biopsy was acute kidney injury in
all patients. Rhabdomyolysis was not clinically suspected in 4 of these cases.
Age
Sex
Etiology
1
18
F
2
18
F
3
4
34
21
M
M
5
26
M
6
7
33
40
M
M
8
9
26
27
M
M
10 49
M
11 21
12 55
M
F
Guillain–
Barre
syndrome
Rat killer
poison
PUO
Snake
bite
Alcohol
binge
PUO
Alcohol
binge
Unknown
Snake
bite
Snake
bite
Unknown
PUO
Creatinine Proteinuria
Urine
Follow Creatinine
at time of
myoglobin
up
biopsy
( dip stick)
8.5
Trace
Negative
Lost to
follow
7.1
3+
Negative
10.0
11.2
2+
2+
positive
Not done
10.5
3+
positive
Lost to
follow
8
1.2
Lost to
follow
6
1.1
20.8
8.9
3+
1+
Negative
positive
5
5
0.8
1.3
20
10.8
Trace
Trace
Not done
positive
4
1
1.2
1.3
7
2+
Negative
1
1.2
11.9
5.2
Trace
3+
Negative
positive
3
3
1.1
1.4
13 55
M
14 16
F
Snake
bite
PUO
9.4
Trace
Not done
2
9.8
3+
Negative
Due
1.3
The cause of rhabdomyolysis was identified by chart review. The causative factors in our study
population include snake bite, PUO, alcohol intake and rat killer poison.
Discussion: All the fourteen cases had acute tubular injury along with the presence of pigment
casts. By orthotoludine dipstick, myoglobinuria was positive only in 42% patients. So urine
dipstick test is not a sensitive marker for myoglobinuria. IHC staining on renal biopsy samples is
indicated for confirming myoglobin cast nephropathy. Not all patients with rhabdomyolysis have
myoglobin casts but all patients with myoglobin casts have rhabdomyolysis. Above all, a high
index of suspicion and immunohistochemical staining is required for an accurate
histopathological diagnosis.
CN 33: Histopathology of lupus nephritis
Jansi Prema, Anila Abraham Kurien, Center for Renal and Urological Pathology,
Chennai, email: anila_abraham08@yahoo.com
Aim: Renal involvement is one of the most severe complications of SLE. About half of the
patients suffering from SLE have nephritis and if untreated, it is an important cause of mortality
and morbidity. A total of 635 patients, 581(91.5%) females and 54 (8.5%) males were included
in the present study to compare the clinicopathologic findings.
Materials and method: Renal biopsy records of all patients were reviewed from 1.8.13 to
30.11.15. 635 confirmed cases of lupus nephritis were included in the study. Revised ISN/RPS
criteria of SLE were met by all patients.Clinical and laboratory parameters at the time of biopsy
were reviewed. For all cases immunofluorescene data were also available.
Results: A total of 635 patients were included in the study. Mean age was 27 years. 581(91.5%)
patients were females and 54(8.5%) were males. 16 (2.5%) patients were in class I, 53 (8.3%) in
class II, 58(9.1%) in class III,267(42%) in class IV,96 (15.1%) in class V,1 (0.1%) in class VI
and 144 (22.7%) patients in mixed group. Mixed group includes patients with classIII+V and
class IV+V. Similar to previous studies class IV was the most common subtype in our study
population. Patients with class IV present most commonly with hypertension. In classIV higher
frequency (41.6%) of antidsDNA antibody is present. Patients with classIV had a higher
percentage of crescent formation, hyaline thrombi, wireloop lesions, neutrophilic infiltration,
karryorhexis, fibrinoid necrosis and interstitial inflammation. Twelve classIV and one classV
patient presented with thrombotic microangiopathy, 8 had necrotizing vasculitis.
Discussion: Presence of hypertension and anti ds-DNA positivity at renal biopsy correlates with
the most severe class – class IV. Histologic activity index strongly predicts renal function. It is
based upon endocapillary proliferation, neutrophilic infiltration, hyaline thrombi, fibrinoid
necrosis, cellular crescent and interstitial inflammation. All these parameters are more frequent
in class IV.
CN 34: Low glomerular density predicts progression of
membranous nephropathy
Ilangovan Veerappan [1], Georgi Abraham [2]
1-KG Hospital & Post Graduate Institute, Coimbatore, Tamil Nadu; 2-Pondicherry
Institute of Medical Sciences, Puducherry, email: ilangovanv@gmail.com
Abstract: Aim: Density of functioning nephrons is a surrogate marker of total nephron number
or kidney function. In risk prediction models, glomerular density (GD) has been consistently
been neglected though all kidney biopsy specimens have that information available. The present
study examines the role of GD in patients with membranous nephropathy.
Material & Methods: The predictive value of conventional factors affecting progression of
kidney disease in membranous nephropathy was tested along with GD. In a prospective study, 43
patients were followed up for at least one year.
Results: The GD varied from 0.3 to 5.2/mm2 with 17 fold variation in glomerular density. The
variation in the GD between the individuals was 17-fold. Patients with GD ≥ 2.0/mm2 had eGFR
120 ± 48 ml/min at baseline and 119 ± 66 at one year versus 83± 29 ml/min (p<0.01) at baseline
and 91 ± 44 ml/min/1.73m2 (p<0.04) at one year in patients with GD < 2/mm2. The age, GFR at
baseline, amount of urine proteinuria at end of one year, ACE-I/ARB use, one year average
blood pressure, complete or partial remission of proteinuria showed no difference between the
groups with GD < or ≥ 2/mm2. However the ∆eGFR per year was −1.1± 3.5 ml/min/1.73m2 in
group with GD < 2/mm2 versus 1.0 ± 4.1 ml/min/1.73m2 in group with GD ≥2.0/mm2 (p<.03).
In multivariate regression analysis only GD was predictive of GFR at one year.
Discussion: Low GD is a risk factor for progression of kidney disease in patients with
membranous nephropathy. The improvement in eGFR was seen even in patients with no
remission of proteinuria suggesting that GD is more predictive of future events than conventional
factors like proteinuria and baseline eGFR.
CN 35: An Interesting case of Rapidly Progressive Renal Failure
S.Sakthivel, A.Ezhilarasii, Dept. of Nephrology, GMKMCH, Salem, email:
dr.bala07@gmail.com
Rapidly progressive renal failure (RPRF) is an initial clinical diagnosis in patients who present
with progressive renal impairment. The underlying etiology may be a primary renal disease or a
systemic disorder.
Case report: A 36 year old male admitted with h/o diarrhea with dehydration. On previous
admissions for seizure, altered sensorium, malignant hypertension, he was diagnosed to have
systemic sclerosis & had nonoliguric renal failure& hence treated with steroids, enalapril &
discharged.O/E he had cutaneous manifestations of scleroderma withaccelerated hypertension,
proteinuria, micro hematuria, with USG - normal sized kidney.During this admission, the patient
had oliguric renal failure &he was supported with Hemodialysis.Enalapril was withheld
temporarily.Patient general condition improved very well on follow up.
Conclusion: Early definitive diagnosis of RPRF is essential to reverse the otherwise relentless
progression to end-stage kidney disease.
CN 36: A rare case of unilateral kidney
S.Balamurugan, A.Ezhilarasii, Dept. of Nephrology, GMKMCH, Salem, email:
dr.bala07@gmail.com
It is a complex heterogeneous entity that results in cervical vertebral fusion. The classic clinical
triad is short neck, low hairline, and restricted neck motion . It may associated with Aortic arch
anomalies and Renal anomalies. We are reporting a case of KFS with single kidney with sensory
neural hearing loss.
Case report: A 60 years old hypertensive male admitted with c/o recurrent hicough and dysuria,
H/O hearing impairment and neck deformity since childhood. O/E Right side mild torticollis,
Springel shoulder, Short neck, Height neck ratio is16.8, Kyphoscoliosisand Sensory neural
deafness.No signs of cranio-vertebral junctionalanomalies.
Labs; Hb-9gm%,Urea- 126 mg%, creatinine-4.7 mg%, electrolytes-normal. Peripheral smearIron deficiency Anemia. Urine alb- 1+, Urine PCR- 0.2, USG abdomen - left unilateral
contracted kidney (8×5 cm). Right kidney was not visualised. X Ray cervical spine-fused all
cervical vertebrae and Kypho scoliosis (Feil classification- Type 3). CT- KUB confirmed right
renal Agenesis. Audiogram revealed his sensory neural deafness and it was corrected with
hearing aid.
As patient had eGFR of 16, in Stage 4 CKD, Pt was treated conservatively and on continues
follow up.
Conclusion: Even though it is a multisystem disorder, Pt had only renal manifestations and
hearing impairment, treated conservatively and being presented this case for it’s rare
presentation.
CN 37: Secondary HemophagocyticLymphohistiocytosis in
Multidrug Resistant Pseudomonas infection in an adult patient.
Hilal , Archana, Urmila A, Shailaja Y, Sachin, Yashoda Hospital, Secunderabad,
email: drarchanadaftardar24@gmail.com
HLH (HemophagocyticLymphohistiocytosis) is a fatal hyperinflammatory syndrome which is
characterised by fever,hepatosplenomegaly,cytopenias,high serum triglyerides, ferritin levels
and hemophagocytosis in bone marrow or lymphnodes. Primary and secondary HLH are the
types of HLH. Primary is familial and due to genetic defect in NK cell activity which is mainly
seen in newborns and infants .Secondary HLH occurs in the clinical settings of malignancies,
autoimmune diseases and various infections ( viral, bacterial, parasitic and fungal ).We report a
case of Secondary HLH which occurred in the setting of Multi Drug Resistant Pseudomonas
aeuroginosa infection.
CN38: Plasmapheresis in Myasthenia Gravis -- Experience from a
Tertiary Care Hospital in South India
Sandeep P, Om Prakash B, Chaitanya V, Sangeetha Lakshmi B, Varalakshmi Devi
B, Ram R, Vengamma B, Sivakumar V, Sri Venkateswara Institute of Medical
Sciences, Tirupati, AP, email: drpeddisandeep@yahoo.com
Aim: To study the effectiveness of Therapeutic Plasma Exchange in Myasthenia Gravis patients.
Materials & Methods: Patients of MG crisis admitted in the Neurology Intensive Care Unit (ICU) and
Respiratory ICU (RICU) on mechanical ventilation and patients requiring PE before thymectomy during
the period January 2013 to December 2014 (2 years study) were included in the study. TPE was initiated
and monitored by the Department of Nephrology in a tertiary care hospital. The muscle weakness and
disability in the patients was assessed by OG score and MGFA-task force scoring. All patients were
treated with plasmapheresis, with our protocol which is as follows, Regimen – total 5 sessions given on
alternate day, Anticoagulant – Heparin, Exchange volume – one plasma volume calculated in each
patient as per Kaplans formula, (10) Replacement fluid – 5% albumin and Fresh Frozen Plasma.
Procedure – with plasma filter(Fresenius Plasma flux ). The statistical analysis was performed using
IBMSPSS 19.0 version. Since the scores of OG & MGFA are in ordinal type in order to see the impact of
plasmpheresis before and after, the appropriate non parametric statistical test is Wilcoxon sign rank match
pair test. The significance value was compared at 5 % level.
Results: Of the total number of 14 patients, 12 were in myasthenia crisis and 3 were in preparation for
thymectomy at the time of admission. Male to female ratio was 11:3 and the mean age was 40.5 years
with age range 17-58 years. Majority of the patients were in the class III of OG and IVb as per MGFAtask force. All patients were treated with plasmapheresis, with our protocol. The median scores of OG &
MGFA are depicted in the table 2 below. There was a significant improvement in muscle power as
assessed by OG & MGFA scores with plasmapheresis. We observed therapeutic response in 11
patients(78%). In the remaining 3 patients, one patient did not respond even after 5 exchanges. The other
patient though responded initially presented again about a year later in crisis and did not respond to PE. In
the third patient who was on ventilatory supports manifested sepsis after the first session of PE and hence
the therapy was not continued. We observed hypotension in two patients which was corrected with saline
infusion, paresthesias in two patients which responded to calcium supplementation, as side effects with
plasmapheresis.
Conclusion: In conclusion we observed that plasmapheresis is an effective modality of support in
improving muscle weakness in crisis patients and also in the preparation prior to thymectomy.
CN39: Anti-C1q Antibody and Anti-ds DNA Antibody in Predicting
Histopathological Activity in Lupus Nephritis.
Binoy Philip1, Noble Gracious1,Thekkumkara Surendran Nair Anish2, Jacob
George3, M.K.Mohandas3 ,Sajeev kumar3 ,Vineetha3
Senior Resident1, Assistant Professor1, Senior Lecturer in Community medicine2,
Professor and Head of the Department3, Assistant Professor3, Assistant Professor3
Department of Nephrology, Government Medical College Trivandrum, Kerala
email: bin05drphy@gmail.com
Abstract: Diagnosis of Lupus Nephritis (LN) is often dependent on renal biopsy findings and
is aided by immunological marker anti-ds DNA. However clinical experience and evidence have
shown that anti-ds DNA is not strong enough in predicting histological classes in LN.
Objective. In this case series analysis from April 2014 to October 2015 in 72 consecutive LN
patients we compared the ability of anti -C1q antibody and anti- ds DNA antibody in predicting
histopathological activity.
Materials and Methods: All patients who underwent renal biopsy for evaluation of suspected
lupus nephritis at Government Medical College Trivandrum were included. Sera were assessed
for anti-C1q antibody and anti- ds DNA antibody concurrently at time of renal biopsy at the
institution. Serological results were compared in proliferative and non-proliferative LN patients
diagnosed by renal biopsy.
Results: 49 patients had proliferative LN and 23 had non proliferative LN. High titres of anti C1q antibody independently discriminated proliferative from non-proliferative LN. Logistic
Regression Analysis showed that anti -ds DNA is not a predictor of proliferative LN in presence
of anti-C1q in the model. Anti -C1q antibody in comparison to anti- ds DNA were found to be
correlating more with Activity Index and SLEDAI clinical Activity scoring .
Conclusion. Anti - C1q antibody titer is a better noninvasive marker in comparison to anti -ds
DNA titer in discriminating proliferative from nonproliferative LN.
CN40: Efficacy and safety of Bortezomib based regimen in Multiple
Myeloma with Cast Nephropathy
Sarfaraz Aslam, Sreelatha M, Noushad TP, Department of Nephrology,
Government Medical College, Kozhikode, email: sarfaraz.doc@gmail.com
Aim: (1) To assess the efficacy and safety of Bortezomib based regimen and plasma exchange in
patients with Multiple Myeloma and cast nephropathy. (2) To study the clinical profile of
patients with Multiple Myeloma and renal involvement. (3) To assess the factors affecting the
renal outcome of these patients.
Materials and methods: This prospective observational study done in Department of
Nephrology, Medical College, Kozhikode enrolled consecutive patients who were admitted in
Nephrology ward/ICU who satisfied Inclusion criteria during the study period from October
2013 to September 2015. The clinical, demographic and biochemical profile of these patients
was studied. Serum Free light chain levels were estimated. Renal biopsy and bone marrow
biopsy were done. After confirming diagnosis of Multiple Myeloma, these patients were
managed
with
plasmapheresis
and
Bortezomib
based
regimen
(Bortezomib/Thallidomide/Dexamethasone) induction for period of 16 weeks. Renal and
hematologic response was noted. These patients were followed up for next 6 months.
Results: 18 patients satisfied the inclusion criteria and included for analysis. 15 patients had a
denovo disease, 3 patients had relapsed myeloma (16.67%). Mean Hb was 7.31 ± 1.25 g/dl. All
patients had AKIN stage III AKI. Mean eGFR at presentation was 6.19 ± 2.61 ml/min/1.73m2.
Mean Serum Creatinine was 7.95 ± 2.07 mg/dl. 14 patients had significant hypercalcemia
(77.78%). 6 patients had elevated FLC kappa levels. 12 patients had elevated FLC lambda levels
(66.67%). Serum immunofixation electrophoresis was uniformly positive in all patients. Renal
biopsy was suggestive of cast nephropathy in all patients (100%) with varying degrees of tubular
atrophy. 15 patients had dialysis requiring renal failure (83.33%). Following the institution of
plasma exchange and Bortezomib based induction regimen, 8 patients had complete renal
response (44.44%), 7 patients had partial renal response (38.88%). All patients achieved
hematologic remission. Mean eGFR at the end of therapy was 56.79 ml/min/1.73m2, which was
statistically significant. The FLC reduction at the end of 16 weeks was statistically significant. (p
<0.01). The eGFR showed a progressive improving trend in period of 16 weeks (p<0.001). 5
patients developed peripheral neuropathy (27.77%), 2 patients (11.11%) had cytopenias, 5
patients had non life threatening infection episodes (27.77%). 3 patients died during the follow
up of next 1 year. 1 year survival was 83.33%.
Discussion: Bortezomib based regimen combined with plasma exchange sessions upfront
demonstrated a high hematologic response and renal response in the study population. Based on
IMWG criteria, 83.33% patients achieved a favourable renal response either partial or complete
and all patients achieved complete hematologic response, which are comparable to other study
groups. Our study group had a predominant lambda subtype myeloma in contrast to other studies
reporting kappa light chain to be more frequently associated with cast nephropathy. There are
conflicting reports on the role of plasma exchange in management of cast nephropathy. All our
patients underwent plasma exchange sessions from a minimum of 5 to a maximum of 7 in the
initial 2 week period. Our study was not designed to assess the efficacy of plasma exchange
without Bortezomib. There is emerging data regarding the use of renal biopsy as a prognostic
tool in cast nephropathy, though the role of renal biopsy as such is unclear. In our study group
there was a trend towards significant tubular atrophy in those patients who had attained less than
a complete renal response.
Conclusion: Bortezomib based regimens with Plasma exchange is effective in inducing
hematologic and renal response in patients who had presented with Cast nephropathy by a
prompt reduction in the free light chain load with occurrence of Peripheral Neuropathy as a
common side effect, with no life threatening infective episodes. Further studies will be needed to
shed light on other maneuvers to reduce the free light chain load such as high cut off dialysis.