Introduction
Here we introduce a scheme for amplification and re-generation of a randomized
pool of LNA-containing oligomers. We successfully incorporated either LNA T or
LNA A in two DNA libraries and found that after three rounds of amplification and
re-generation the LNA content in our pools was reduced by approximately
*PERCENT* percent.
Results
Phusion DNA polymerase reads LNA-containing strands
Library design
We wanted to find out whether we could employ the previously established LNAcompatible polymerases, KOD DNA polymerase and Phusion DNA polymerase, to
successfully amplify and re-generate a library of LNA-containing single-stranded
sequences. We based our library design on the following guidelines: (1) No LNA
moieties in the primer binding regions; (2) *****
Phusion DNA polymerase can employ LNA templates
Phusion DNA polymerase had previously been shown to be able to amplify an
LNA-containing template in a PCR setup, *REFS* however, the templates
employed were fairly short (*XXX* nucleotides) and their LNA content and
distribution did not correspond well with a typical in vitro selection library. We
therefore asked whether Phusion DNA polymerase could indeed amplify a ‘long’
(>60 nucleotides) LNA-containing template.
We prepared the LNA A-containing template shown in *FIG* and found that
Phusion DNA polymerase was able to successfully generate a double-stranded allDNA product of the expected size under standard PCR conditions (*FIG*). In
contrast, when we tried to substitute LNA ATP for deoxy-ATP we were unable to
obtain the desired product (*FIG*). This was the case across a range of
experimental conditions and templates (data not shown), indicating that Phusion
DNA polymerase is only able to synthesize double-stranded LNA-containing
products of less than *XXX* base pairs.
A
GGTCTGGTCCACACCCAG-CCGCCaCCCaGGGaCGCaGCCaGGCaCGGCGGGCCTATAGTGAGTCGTATTA
* figur med primere: 18n GGTCTGGTCCACACCCAG og 21n
GGCCTATAGTGAGTCGTATTA *
B
C
*GEL AF VELLYKKET DNA PCR PÅ
* GEL AF LNA PCR PÅ NAC2919 A70 *
NAC2919 A70 *
Figure 1: PCR amplification with LNA ATP by Phusion DNA polymerase.
*vi laved noged PCR på NAC2919 A70*
Phusion DNA polymerase correctly reads LNA
The fidelity of Phusion DNA polymerase reading an LNA A-containing template was
tested using an LNA -containing library with a core of 25 randomized positions (C,
G or T) and 7 LNA A-moieties at fixed positions (Figure 3A). We chose this design,
as: (1) its LNA content emulated that of a typical in vitro selection library, and (2) it
allowed us to quickly identify LNA A-related sequence errors in the product. The
library was amplified by PCR with deoxyribonucleotide triphosphates, and the
corresponding double-stranded DNA was then cloned into a bacterial plasmid
vector and sequenced.
Figure 3B shows a sequence logo obtained from multiple alignment of the 32
positively identified member sequences. All LNA A positions were clearly identified
in all members. Three members contained single-nucleotide insertions and one
member had a single-nucleotide deletion, but neither of these involved
adenosines. Whether these minor errors stem from our library preparation, the
PCR or even the vector’s maintenance in the bacterial host is unclear. We
conclude that Phusion DNA polymerase correctly reads LNA A moieties that are
spaced 3 or more nucleotides apart in a DNA library.
KOD DNA polymerase can incorporate LNA triphosphates
KOD DNA polymerase correctly incorporates all four LNA triphosphates
KOD DNA polymerase was previously shown to be able to incorporate LNA *XXX*
triphosphates under primer extension conditions. *REF* We extended this
analysis by attempting primer extension with three deoxy-triphosphates plus
either of the four LNA triphosphates on *XXX* (*FIG*).
* primer ext med alle fire LNA-TPer *
A
LNA ATP:
GGACAGGACCACACCCAGVVVVVVVTVVVVVVTVVVVVVTVVVVVVTVVVVVVGGCCAAAA
GAGAGACGAAA
* 2080-T *
LNA TTP:
GGACAGGACCACACCCAGDDDDDDDCDDDDDDCDDDDDDCDDDDDDCDDDDDDGGAAGGTT
GTGTGTAGTTG
LNA GTP:
GGACAGGACCACACCCAGDDDDDDDCDDDDDDCDDDDDDCDDDDDDCDDDDDDGGAAGGTT
GTGTGTAGTTG
LNA mCTP:
GGACAGGACCACACCCAGHHHHHHHGHHHHHHGHHHHHHGHHHHHHGHHHHHHCACCTTCC
ATACATCATCC
* husk at angive primer-binding sites! *
* bedre at vise produkt OG template (farvekodet, naturligvis)
*
* hør, hvordan lavede jeg lige prxt med LTTP? Jeg har ingen
A-template?! *
B
* http://www.boergedoessing.net/holger/wiki/dokuwiki-2009-0214/doku.php?id=day-to-day_notes:september_2009 (skal gentages – også med
LNA mCTP – for LNA-T-prøverne virker stort set ikke?! *
Figure 2
Developing an amplification scheme for LNA strands
Template preparation with lambda exonuclease
Carry-over of the DNA template or
* lambda! *
Asymmetric PCR increases yield over primer extension
* farver! *
* skal nok gentages med: 1) nyere protokol, 2) både 2080 og 2080-T. Bemærk!
Her bruges regulær KOD DNApol.!! *
*NB! Denne figur mangler gel for dATP-reaktionen! Kan vi undvære den? Det skal
formodentlig gentages! *
* Desuden er dette lavet med regulær KOD DNApol., ikke XL! *
*VI SKIFTEDE TIL KOD XL – HVORFOR?*
Purification of full-length LNA strands
* dynabeads *
LNA strands are specifically amplified
* pcr qc *
LNA is retained over multiple rounds
LNA is the natural substrate for neither Phusion nor KOD XL DNA polymerase and
it is conceivable that library members with little or no LNA content would be
preferentially amplified in our selection scheme. We therefore sought to
determine whether our scheme left our sequence pool devoid of LNA strands after
a number of rounds of amplification. Importantly, we performed our rounds
without selection against a target ligand. The only selection pressure on our library
was therefore imposed by the amplification procedure itself.
Starting out from an all-DNA library with a random region of 40 nt (*FIG*) we used
this setup:
1. PCR with Phusion DNA polymerase and DNA triphosphates to obtain the
corresponding double-stranded DNA. The primer for the non-template
strand carried a 5′ phosphate.
2. Purification of the dsDNA on a spin column.
3. Digestion of the phosphorylated strand by Lambda exonuclease. This left
the single-stranded template DNA.
4. 15 rounds of asymmetric PCR with KOD XL DNA polymerase and an LNA
triphosphate and the additional three DNA triphosphates.
5. Purification of the full-length LNA strands by annealing to a capture oligo
bound to magnetic beads.
6. After careful washing the LNA strands were heat-eluted into 1×SSC. A
fraction of the eluted LNA strands were then used as template in step 1
for another round of amplification.
We performed 3 such amplification rounds using either LNA ATP or LNA TTP (in
which case the template was the library complementary strand).
The pools contain LNA after 3 rounds
The LNA content of the LNA strands obtained from rounds 1-3 were subjected to
nucleolytic digestion by KOD DNA polymerase. Unlike the KOD XL variant this
polymerase has a very aggressive 3-5′ exonuclease activity against single-stranded
DNA (*REF*), however, it is unable to digest LNA moieties (*REF*). Incubation of
the LNA strands with KOD DNA polymerase yielded only partially digested
products (Figure 4A/B, lanes 1-6), whereas the crude DNA library was fully
digested (Figure 4A/B, lanes 7-8). The digestion patterns exhibit the expected
characteristics of LNA-containing pools: First, digestion stops – visible as a smear –
are confined to a region corresponding to the LNA-encoding cores. Second, line
densitometry curves (Figure 4C/D, red curves) of these regions appear to have set
decay rates. This is in accordance with a uniform distribution of LNA moieties
within the randomized cores.
The exponential decay rates (slope) decrease slightly from round 1 to round 3.
This indicates that fewer LNA moieties are present near the 3′ end of the LNA
strands rounds 2 and 3 and so the exonuclease can digest further into the random
region. This effect is most pronounced with LNA A-containing strands (compare
red curves in Figure 4C). We also find that the LNA A-containing strands are less
stable against nucleolytic attack than LNA T-containing strands, as reflected in the
lower decay constants; this could be due to a higher LNA content and/or higher
nuclease stability of the LNA T-containing strands (compare red curves in Figure 4C
and Figure 4D).
Nucleotide compositions are skewed towards ***
Next, we wanted a quantitative measure of the LNA content in our pool. We
approached this by analyzing the nucleoside composition of our LNA strand pools.
This can be done by digesting the DNA of interest with nuclease P1,
phosphodiesterase I, and alkaline phosphatase (*REF*) and subjecting the
resulting nucleoside mix to LC-MS. However, due to the nuclease resistance of
(successive) LNA moieties we opted to use Phusion DNA polymerase on our LNA
strands to obtain the corresponding double-stranded DNAs. By using a doublybiotinylated primer for the template-encoding strand we were able to immobilize
the DNA on streptavidin-coated magnetic beads and subsequently heat-elute the
complementary strand (*FIG*). The eluted single-stranded DNA oligomers were
therefore iso-sequential to the original LNA strands and could easily be digested
and analyzed by LC-MS.
******
** NOGET OM AT LNA-INDHOLDET STABILISERES HEREFTER ***
Sequence analysis indicates fewer ‘LNA islands’
Finally, we looked at the sequence composition at the basal level by sequencing.
Clones were obtained by amplifying either the crude DNA library or LNA A- or LNA
T-containing strands from round 3 with Phusion DNA polymerase and cloning the
resulting DNA into a plasmid vector. Sequencing yielded between *XXX-XXX*
clones. While the crude library encodes many adenosine or thymidine duplets and
triplets (*FIG*) these were remarkably absent from the LNA-containing pools
obtained after 3 rounds of our selection scheme (*FIG*). The average distance
between LNA moieties within the random region was *XXX.X* nt for the LNA Acontaining pool and *XXX.X* nt for the LNA T-containing pool (*FIG: søjlediagram
over afstande mellem Aer eller Ter i de forskellige pools. Husk at angive n [antal
kloner] og gennemsnitsværdi.*).
Materials & Methods
Oligonucleotides
*NAC2080, F2080, R2080 m/u modifikationer, 2080-T, 2080-G, 2080-C og
tilhørende primere m/u modifikationer, capture oligo(er), NAC2919 A70, AT50,
AT50’ primere m/u modifikationer.*
Polymerase chain reaction (PCR)
0.5 nM template (all-DNA or LNA-containing single-stranded DNA) and 0.5 µM of
each primer were combined in 1× Phusion HF buffer with 200 µM of each
deoxyribonucleotide triphosphate and 0.04 units/µl Phusion DNA polymerase. PCR
conditions were typically: 98 °C/5 min., 20 cycles (98 °C/5 s, 53 °C/10 s, 72 °C/5
min.), 4 °C/hold.
Lambda exonuclease digestion
Double-stranded DNA was prepared with a 5′-phosphorylated primer and a 5′
fluorophore-labeled primer. Digestion with lambda exonuclease (New England
Biolabs) was with 6.7 units/µg double-stranded DNA (50 ng/µl final DNA
concentration) at 37 °C for 25 min. The reaction was stopped by quenching with
addition of 1 vol. 50 mM EDTA or by heating to 75 °C for 15 min. Full digestion was
verified by agarose gel electrophoresis and ethidium bromide staining.
Fluorescence scanning was on a Typhoon Trio system (GE Healthcare).
Primer extension
Asymmetric PCR
Oligo capture on magnetic beads
Digestion assay
Ca. 1.5 pmol of LNA-containing strands isolated after 1, 2 or 3 rounds of
amplification and regeneration of library AT50 (*TABEL?*) were 5′-radiolabelled.
Full-length oligomers were isolated on a 6% denaturing polyacrylamide gel and
eluted into 100 µl water each. Sample volumes were then adjusted to achieve
equivalent specific activity. Similarly, the crude DNA library and an LNA A oligomer
(5′-GGTCTGGTCCACACCCAGCCGCCaCCCaGGGaCGCaGCCaGGCaCGGCGGGCCTATAGTGAGTCGTATTA; lower case is LNA A) were 5′-radiolabelled to 7.5 nM. 5 µl of
each oligomer was then incubated at 72 °C in digestion buffer (1× KOD buffer #2, 3
mM MgSO4, 0.2 mg/ml BSA) with or without 0.2 units KOD DNA polymerase
(Novagen) (10 µl final volume). 1.5 µl samples were drawn at intervals, quenched
in 1 vol. ice-cold 95% formamide/50 mM EDTA and resolved on 13% denaturing
polyacrylamide gels. Autoradiography was with the PhosphoImager system
(*MANUF*), and line densitometry was with spline curves (width: 30) in ImageJ
1.44j (NIH). Data pairs (i.e. with/without polymerase) were matched to achieve
identical overall intensity and then normalized (Excel 2010, Microsoft).
LC-MS analysis
Sequencing
Phusion DNA polymerase was used to generate double-stranded DNA from LNAcontaining templates. The DNA was then 5′-phosphorylated and blunt-end cloned
into SmaI-digested pUC19 ; this offers multiple inserts per plasmid. The plasmids
were transformed into E. coli TOP10. 22 re-streaked colonies were chosen for
plasmid purification (Miniprep, Qiagen). Cycle sequencing at Eurofins MWG
Operon (Germany) was with the ‘M13 rev (−49)’ primer and yielded 32 library
member sequences. Multiple sequence alignment was with ClustalW 1.83 (*REF*)
and JalviewLite 2.6.1 (*REF*), and sequence logos were created with WebLogo
2.8.2 (http://weblogo.berkeley.edu/; *REF*).
Figures
A
5′-GGACAGGACCACACCCAG-aBBBBaBBBaBBBaBBBaBBBaBBBaBBBB-GGCCTTTTGTGTGTCGTTT-3′
B
Figure 3: Phusion DNA polymerase correctly reads an LNA A-containing DNA template.
(A) Sequence of the DNA library used. Lowercase ‘a’ denotes LNA A moieties; ‘B’
denotes C, G or T. (B) Sequence logo of the randomized core of the sequenced
library members. All LNA A-positions were clearly identifiable in all 32 members.
Positions 1, 20 and 30 are alignment artifacts caused by single-nucleotide
insertions in three members. Another member had a single-nucleotide deletion
(aligned to pos. 25).
*Første del af figuren burde måske være noget med at vise amplifikationssetuppet.*
*Anden del af figuren kunne så være en illustration af den måde biblioteket
aflæses den ene hhv. den anden vej.*
A
B
C
D
Figure 4: Both LNA A and LNA T are retained in libraries over 3 rounds of amplification, but LNA T
offers superior incorporation and/or stability.
A library (40 nt fully randomized) was used as template for making LNA-containing
strands, which were used in subsequent rounds of amplification in order to test
whether our amplification scheme entails intrinsic selection pressure against LNAcontaining pool members. LNA content of strands from round 1-3 was assayed by
digesting with a 3′-5′ deoxyribonuclease (KOD DNA polymerase) that cannot digest
past LNA moieties. (A, B) Digestion analysis of strands amplified using LNA ATP (A)
or LNA TTP (B). Lanes 1-6 show 5′-radiolabeled LNA strands incubated at 37 °C/20
min. without or with nuclease. The position of the LNA-induced digestion stops is
consistent with the expected position of the LNA moieties in the oligomer pools.
Lanes 7, 8: The all-DNA crude library is fully degraded. Lanes 9, 10: Digestion of an
LNA A-containing oligomer yields stops at the expected intervals. All the digestive
patterns shown here remained virtually identical after 80 min. (not shown). (C, D)
Densitometry scans of lanes 1-6 in A and B. Total pixel intensities of lane pairs (i.e.
with and without nuclease) were matched, and all pairs were then normalized for
direct comparison. Blue curves indicate ‘without nuclease’, red curves indicate
‘with nuclease’. Curve brightness reflects round number. (C) As expected for a
fully randomized library the intensity of the nuclease stops fits an exponential
decay function. The decay slope decreases from round 1 to round 3, indicating
that the LNA A content in the pool decreases. (D) Similarly, the LNA content also
decreases in a pool propagated with LNA TTP. However, the densitometry curves
are higher and steeper than for the LNA ATP-propagated pool, suggesting that LNA
TTP offers better incorporation and/or higher stability.