SUPPLEMENTAL METHODS
Methods used for genotyping
As subjects were recruited from independent databases, BDNF genotype
analysis was performed using methods routinely used in the respective
laboratories.
Method 1 (NIHR Cambridge BioResource and Oxford Bioresource)
DNA was extracted from blood samples via standard methods and genotyped
for the BDNF Val66Met SNP on an ABI7900HT Sequence Detection System
with the use of TaqMan® a 5’exonuclease assay (Applied Biosystems).
Approximately 15 mL of venous blood was collected into 3 x 4.9 mL K2 EDTA
Gel tubes (Sarstedt, Nümbrecht, Germany). On receipt blood tubes were
centrifuged to generate a cell pack. The plasma was decanted and the gel
bung removed and discarded. The EDTA cell pack and plasma was stored at
-80°C for not less than 24 hours. DNA was extracted on the defrosted cell
pack using an organic chloroform extraction method (2 mL ChCl3, 3.5 mL
GuHCl, 260µl NH4Ac, 260µl Na Sarcosyl, 50µl Protinase K). Once generated,
the DNA was quantified using Quant-iTTM Picogreen®ds DNA reagent (Life
TechnologiesTM), and run on 0.75% agarose gel to check for a high
molecular weight product (>23 kbp). Genotyping was performed on an
ABI7900HT Sequence Detection System with the use of TaqMan® assays
(Applied Biosystems,). A final reaction volume of 5 μL was used per well of a
384-well plate. The reaction mix for amplification was prepared by mixing
2.5μL TaqMan Genotyping Master Mix (Applied Biosystems, Foster City, CA,
USA), 0.03μL of SNP Genotyping Assay (Applied Biosystems) and 0.47μL
distilled water per sample. To this reaction mixture 2μL DNA solution (with a
total of 8ng DNA) were added to achieve a final volume of 5μL. Amplification
was performed using a protocol with 40 cycles, 15s at 92°C (denature), 1 min
at 60°C (anneal/extend). An initial hold with 10 min at 95°C was applied.
Analysis of data was performed according to the manufacturer's instructions.
Primer sequences;
forward: GGCTTGACATCATTGGCTGAC,
reverse: GGTCCTCATCCAACAGCTCTT,
Probe sequences;
Vic: ACTTTCGAACACATGATAG,
Fam: CTTTCGAACACGTGATAG.
Method 2 (Glaxo Smithkline – Clinical Unit Cambridge)
Genotyping was conducted by LGC Genomics (http://lgcgenomics.com/).
SNPs were genotyped using the KASP SNP genotyping system. KASP is a
competitive allele-specific PCR incorporating a FRET quencher cassette (see
http://lgcgenomics.com/kasp-genotyping-reagents for more information).
Venous blood was collected from each consented subject into an EDTA
vacutainer. DNA was extracted using the Gentra Autopure LS automated
DNA
purification
concentration
and
process
by
Quest
quality
of
the
Diagnostics
isolated
DNA
Heston,
were
UK.
verified
The
via
spectrophotometry and agarose gel electrophoresis by the vendor and GSK
laboratories, respectively. Genotyping was performed using a TaqMan® SNP
Genotyping Assay (Applied Biosystems) at KBioSciences, Hoddesdon, Herts,
UK. A total mixture, made from the universal master mix, the SNP-specific
assay and molecular biology grade water was dispensed to the microtitre
plates containing DNA using KBioscience’s Meridian liquid dispensing device.
The plates were then sealed using KBioscience’s Fusion laser welding system
which applies a permanent and hermetic seal of polypropylene, through which
the eventual fluorescent signal can be determined. PCR was carried out in
KBioscience’s waterbath-based thermal cycling system (Hydrocycler) using
the following conditions: 15s at 94⁰ C (denature) and 1 min at 60 ⁰ C
(anneal/extend) for a total of at least 35 cycles. An initial hold with 15min at
94⁰ C was applied. After PCR, the fluorescent signals from the TaqMan assay
were read on a BMG Pherastar fluorescent plate reader. The raw fluorescent
values for FAM, VIC and ROX were imported into KBioscience’s Kraken
software and represented on a graphical cluster plot, showing FAM / ROX (xaxis) and VIC / ROX (y-axis). ROX is used in this genotyping system as a
normalising dye.
Reaction Volumes
1uL per well in 1536-well format, 3uL per well in 384-well format.
A total mixture, made from the universal master mix, the SNP-specific assay
(and molecular biology grade water to make the final concentrations correct),
was dispensed to the 384-well or 1536-well microtitre plates using
KBioscience’s Meridian liquid dispensing device. The plates (of either format)
were then sealed using KBioscience’s Fusion laser welding system. The
Fusion system applies a permanent and hermetic seal of polypropylene,
through which the eventual fluorescent signal can be determined (see below).
PCR cycles
PCR was carried out in KBioscience’s waterbath-based thermal cycling
system (Hydrocycler) using the following conditions:
94°C
15mins (enzyme activation)
94°C
15sec
60°C
60sec
Steps (1) and (2) repeated to total of 35cycles.
Post thermal cycling, the plate was read on a fluorescent plate reader (see
below).
Where the PCR had not reached completion or satisfactory
genotyping groups had not yet been achieved, the samples were subjected to
three further PCR cycles, of steps (2) – (3) again, and re-read on the plate
reader. This process was repeated as required.
Detection
After PCR, the fluorescent signals from the assay were read on a BMG
Pherastar fluorescent plate reader. The raw fluorescent values for FAM, VIC
and ROX were imported into KBioscience’s Kraken software and represented
on a graphical cluster plot, showing FAM / ROX (x-axis) and VIC / ROX (yaxis). ROX is used in this genotyping system as a normalising dye, negating
any variances in FAM and VIC signal occurring due to well-to-well differences
in liquid volume.